Bovine rotavirus genes

To prepare genomic dsRNA from the IND strain, the cell-propagated IND strain was subjected to 2 cycles of freezing and thawing, followed by centrifugation at 1,200×g for 30 minutes. The supernatants were centrifuged at 122,000×g for 3 hours at 4° C. through a 40% sucrose cushion to produce viral pellets. The viral pellets were suspended in 1 ml of extraction buffer which contained 0.1 M sodium acetate, pH 5, and 1% sodium dodecyl sulfate. The suspension was extracted twice with an equal volume of phenol/chloroform mixture (1:1), and 0.1 volume of 4 M sodium acetate and 2 volumes of 100% ethanol were added to the aqueous phase. The RNA was allowed to precipitate overnight at −20° C. and was pelleted by centrifugation at 12,000×g. The RNA was resuspended in diethyl pyrocarbonate (DEP)-treated water and stored at −20° C. until used.

Rotavirus dsRNA in extracted samples was analyzed by polyacrylamide gel electrophoresis to confirm the presence of dsRNA and to examine the genomic electropherotypes. The discontinuous buffer system of Laemmli was utilized, and dsRNA was resolved in 10% polyacrylamide slab gels. Electrophoresis was conducted at 12 mA for 14-16 hours. The dsRNA bands were visualized by silver staining or staining with ethidium bromide having a concentration of 0.5 μg/ml. The electropherotype of the dsRNA indicated that 11 segments of dsRNA were present and the migration pattern corresponded to that characteristic of the IND strain.

For PCR amplification, the extracted dsRNA was first purified using the RNAid kit from B101, La Jolla, Calif., according to the manufacturer's instructions. Thereafter the purified dsRNA was boiled in 20% dimethyl sulfoxide for 5 minutes and cooled on ice for 5 minutes.

The BRV IND strain VP7 gene was prepared by polymerase chain reaction (PCR) amplification of gene segment 9 using the purified dsRNA as a template and the following sense primer and antisense primer, respectively: 5′CCCGGGATCCATGGCCGGCTTTAAAA GCGAGAATTT 3′ SEQ. ID. NO. 19, 5′CGATCGCGAATTCTGCGGCAGGTC, SEQ. ID. NO 20.

Amplification of the dsRNA templates required an initial reverse transcription step. The heat-denatured dsRNA was diluted 1:4 with 5% DMSO in a reaction mixture containing 10 mM Tris (pH 8.3), 40 mM KCl, 1.5 mM MgCl 2 , 1 mM dithiothreitol, 200 μM each of dATP, dCTP, dTTP and dGTP, 200 ng each of the sense primer and antisense primer, 10U of AMV reverse transcriptase from Boehinger Mannheim Biochemicals, 2.5 units of Taq polymerase from Boehinger Mannheim Biochemicals and 20 units of RNASIN from Promega.

The tubes were placed in a thermocycler from Perkin Elmer Cetus and incubated at 42° C. to generate cDNA copies of the BRV IND strain dsRNA. The tubes were heated at 94° C. for 5 minutes and subjected to thirty amplification cycles, each consisting of 94° C. for 1 minute to denature the cDNA, 42° C. for 1.5 minutes to anneal the primer to the nucleic acid and 72° C. for 3.5 minutes to extend the strands. The PCR products were purified and analyzed by 1% agarose gel using standard techniques. The PCR products were cloned into the pCRII plasmid from Invitrogen according to manufacturer's instructions and sequenced using the primer extension method of Sambrook et al. (1989) Molecular Cloning: a Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.

As shown in FIG. 1, the VP7 gene of IND strain, SEQ. ID. NO. 1, comprises 1062 base pairs. An AUG codon at base 49 initiates a 978 base pair open reading frame and codes for 326 amino acids. The deduced amino acid sequence of the VP7 protein of the IND strain, SEQ. ID. NO. 6 is shown in FIG. 6 .

Genomic dsRNA was extracted from the cell-propagated 2992 B strain as described in Example 1 and the extracted dsRNA purified as described in Example 1. The BRV 2292B strain VP7 gene was prepared by PCR amplification of gene segment 9 from the 2292 strain dsRNA template using the following sense primer and antisense primer, respectively

5′CCCGGGATCCATGGCCGGCTTTAAAA GCGAGAATTT 3′ SEQ. ID. NO. 19

5′CGATCGCGAATTCTGCGGCAGGTC, SEQ. ID. NO 20.

Amplification of the template was conducted as described in Example 1. The sequence of the VP7 gene of the 2992B strain, SEQ. ID. NO. 2, is shown in FIG. 2 . The deduced amino acid sequence of the VP7 protein of the 2992, SEQ. ID. NO. 7, strain is shown in FIG. 7 .

Genomic dsRNA was extracted from the cell-propagated Shintoku strain as described in Example 1 and the extracted dsRNA purified as described in Example 1. The BRV Shintoku strain VP7 gene was prepared by PCR amplification of gene segment 8 from the Shintoku strain dsRNA template using the following sense primer and antisense primer, respectively:

5′-GGCATTTAAAAAAGAAGAAGCTGT-3′, SEQ. ID. NO. 27

5′-AGCCACATGATCTTGTTTACGC-3′, SEQ. ID. NO. 28.

The dsRNA template was added to a reaction mixture as described in Example 1. The mixture was overlaid with mineral oil and then subjected to one cycle of reverse transcription at 42° C. for 30 minutes and 30 cycles of PCR amplification at 94° C. for 1 minute, 42° C. for minutes. and 72° C. for 3 minutes and a final 7 minute incubation at 72° C. The PCR products were sequenced using the Sequenase version 2 DNA sequencing kit from United States Biochemical. Single-stranded sequencing templates were prepared by digestion of the phosphorylated strand of the PCR products with lambda exonuclease from Pharmacia Biotech. Sequences of both terminal regions of the VP7 genes were determined by a modified procedure of Lambden et al. J. Virol. 66: 1817-1822, 1992. Synthetic primer 1, 5′CCCGTCGACGAATTCTTT-3′-NH 2 , SEQ.ID.NO. 46 was ligated to the 3′ ends of the viral RNA using T4 RNA ligase from GIBCO/BRL. cDNA fragments of 400 to 600 base pairs spanning either the 5′ or the 3′ ends were produced by RT-PCR using primer 2 complementary to primer 1 and virus-specific primers, and were sequenced by using internal primers. The sequence of the VP7 gene of the Shintoku strain, SEQ. ID. NO. 3, is shown in FIG. 3 . The deduced amino acid sequence of the VP7 protein of the Shintoku strain, SEQ. ID NO. 8, is shown in FIG. 8 .

The VP7 gene of the Shintoku strain comprises 1063 nucleotides and contains one open-reading-frame encoding a polypeptide of 332 amino acids. The predicted molecular mass of the VP7 gene from the group C Shintoku BRV is 37.3 to 37.6 kDa.

Genomic dsRNA was extracted from the cell-propagated WD653 strain as described in Example 1 and the extracted dsRNA purified as described in Example 1. The BRV WD653 strain VP7 gene was prepared by PCR amplification of the corresponding gene segment 9 from the 2292 strain dsRNA template using the following sense primer and antisense primer, respectively

5′GGAAATATCAGAGATGCGT 3′ SEQ. ID. NO. 21.

5′TTCTTTATGCTTCGGCCTA 3′ SEQ. ID. NO. 22.

Amplification of the template was conducted as described in Example 1. The sequence of the VP7 gene of the WD653 strain, SEQ. ID. NO. 4, is shown in FIG. 4 . The deduced amino acid sequence of the VP7 protein of the WD653 strain, SEQ. ID. NO. 9, is shown in FIG. 9 .

Genomic dsRNA was extracted from the cell-propagated Shintoku strain as described in Example 1 and the extracted dsRNA purified as described in Example 1. The BRV Shintoku strain VP4 gene was prepared by PCR amplification of gene segment 4 from the Shintoku strain dsRNA template using the following sense primer and antisense primer, respectively

5′GGAAATATCAGAGATGCGT 3′ SEQ. ID. NO.23

5′TTCTTTATGCTTCGGCCTA 3′ SEQ. ID. NO.24.

Amplification of the template was conducted as described in Example 1. The sequence of the VP4 gene of the Shintoku strain, SEQ. ID. NO. 5, is shown in FIG. 5 . The deduced amino acid sequence of the VP4 protein of the IND strain, SEQ. ID. NO. 10, is shown in FIG. 10 .

Genomic dsRNA was extracted from the cell-propagated IND strain as described in Example 1 and the extracted dsRNA purified as described in Example 1. The BRV IND strain VP4 gene was prepared by PCR amplification of gene segment 4 from the IND strain dsRNA template using the following sense primer and antisense primer, respectively

5′CCCGGGATCCGAATTCGGCTATAAA ATGGCTTGGCT 3′ SEQ. ID. NO. 15

5′TCGCGAATTCTGCAGGTACATCCTCCAGAAGCT 3′ SEQ. ID. NO. 16.

Amplification of the template was conducted as described in Example 1. The sequence of the VP4 gene of the IND strain, SEQ. ID. NO. 11, is shown in FIG. 11 . The deduced amino acid sequence of the VP4 protein of the IND strain, SEQ. ID. NO. 13, is shown in FIG. 13 .

Genomic dsRNA was extracted from the cell-propagated Cr strain as described in Example 1 and the extracted dsRNA purified as described in Example 1. The BRV Cr strain VP4 gene was prepared by PCR amplification of corresponding gene segment from the Shintoku strain dsRNA template using the following sense primer and antisense primer, respectively

5′CCCGGGATCCGAATTCGGCTATAAA ATGGCTTGGCT 3′ SEQ. ID. NO. 15

5′TCGCGAATTCTGCAGGTACATCCTCCAGAAGCT 3′ SEQ. ID. NO. 16.

Amplification of the template was conducted as described in Example 1. The sequence of the hypervariable region of the VP4 gene of the Cr strain, SEQ. ID. NO. 12 is shown in FIG. 12 .

Diagnosing Infection with BRV

cDNA probes, preferably full-length cDNA probes, complementary to the VP4 or VP7-encoding gene segments isolated from BRV strains IND, 2292B, and Cr, are useful for diagnosing infection with group A virus in fecal samples from diarrheic animals. cDNA probes, preferably full-length cDNA probes, complementary to the VP7-encoding gene segment isolated from WD653 strain, are useful for diagnosing infection with Group B rotaviruses, and cDNA probes, preferably full-length cDNA probes, complementary to the VP4 and VP7 encoding gene segments from the Shintoku strain are useful for diagnosing infection with group C rotaviruses. The cDNA probes are prepared by PCR amplification of dsRNA extracted from the virus strains using primers for the 5′ ends of the sense and antisense strands. The preferred primers for preparing the full-length cDNA probes of the VP4 and or VP7 genes of BRV strains IND, 2292B, Cr, WD653 and Shintoku, are shown in Table 1.

The cDNA probes are used in hybridization assays with total RNA extracted with phenol/chloroform from fecal samples of calves suspected of having a BRV infection. Preferably, the hybridizations are performed under conditions of moderate stringency, for example, for 16-24 hours at 42° C., when the full length probes are used to detect the presence of Group A, B, and C BRV.

Typing BRV Infections

Probes that are complementary to the hypervariable region of the VP4 and VP7 genes are useful for characterizing the specific genotype of the BRV strain in field isolates. The hypervariable region sequence also serves as the basis for genotyping either G or P type field isolates by a method which employs reverse transcription PCR (RT-PCR) amplification of the hypervariable region and analysis of the size of the PCR product.

The P type and G type of BRV obtained from field isolates are assayed by hybridizing cDNA probes which are complementary to hypervariable regions of the VP4 and VP7 genes of different BRV strains to the dsRNA isolated from fecal samples of diarrheic animals.

The partial-length VP4 and VP7 cDNA probes used in the assays are made by PCR amplification, such as using the techniques described in Examples 1-7 of the cloned genes using primers having sequences complementary to the highly conserved regions of the VP4 and VP7 genes and which flank the hypervariable regions of the VP4 and VP7 genes. Examples of suitable primers for PCR amplification of the hypervariable regions of the VP4 and VP7 genes of BRV strains IND, Cr, 2992B, Shintoku are shown in Table 2. Alternatively, the partial length VP4 and VP7 probes are made using nucleic acid synthesizers. The purified PCR products are then radiolabeled, preferably by using a nick translation kit, such as the kits available from Bethesda Research Laboratories, Gaithersburg, Md.

The dsRNA is extracted from fecal samples obtained from the BRV infected cow or calf with phenol/chloroform as described in Parwani, et al., J. Clinical Microbiology , August 1993, Vol. 31, No. 8, pp. 2010-2015. The dsRNA isolate is then resolved by polyacrylamide gel electrophoresis and denatured by soaking the gel in 0.1 M NaOH and 0.25 M NaCl for 20 minutes at room temperature. The gel is then washed, preferably twice for 20 minutes each time in 4×TAE (I×TAE=0.01 M Tris-acetate, 0.001 M ethylenediaminetetraacetic acid) and once in 1×TAE for 20 minutes. The denatured RNA is electrotransferred, preferably onto Nytran membranes and immobilized using ultraviolet light cross-linking.

For dot blots, dsRNA is preferably denatured at 95° C. for 5 minutes and placed on ice for 5 minutes. The RNA is preferably dotted onto nylon membranes in volumes of 5 μl or less. Following application of the samples, the membranes are air dried and baked for 2 hours at 80° C. in a vacuum oven.

The membranes are prehybridized for preferably 4 hours at 42° C. or 52° C. in hybridization buffer containing 50% formamide, 5×standard saline citrate, 50 mM phosphate buffer at pH 6.5, 0.2% SDS, 2×Denhardt's solution, 100 μg/ml yeast tRNA. Hybridization is performed preferably in 3-5 ml of hybridization buffer containing 4.5% dextran sulfate and 3-5×10 6 counts/minute of heat-denatured PCR probe of approximately 1.2×10 7 CPM/μgDNA template. Preferably, the hybridizations are performed under condition of high stringency, for example, for 16-24 hours at 52° C., when the partial probes are used to genotype the field isolates. The membranes are washed 4 times at room temperature in 2×SSC and 0.1% SDS and 2 times at hybridization temperature in 0.4×SSC and 0.1% SDS. The washed membranes are rinsed once with water, blotted, and exposed to film with intensifying screens at −70° C.

Alternatively, the genotypes of field isolates are determined as in the methods described in Examples 1-7 by isolating dsRNA from the field isolate, preparing cDNA molecules by RT-PCR employing the sense and antisense primers shown in Table 2, cloning the cDNA into a vector, sequencing the cDNA and comparing the sequence obtained to the disclosed sequences for the VP4 and VP7 genes of BRV strains IND, 2292B, Cr, WD653 and Shintoku.

Expression of the VP4 and VP7 Genes

Partially-purified BRV proteins VP2, VP4, VP6 and VP7 are obtained from the IND strain, the 2292 B strain, the WD563 strain and the Shintoku strain by extracting the dsRNA of each strain from cell-culture lysates or infected gnotobiotic calf fecal material, preparing amplified cDNA from the dsRNA by reverse-transcription (RT) PCR using gene specific primers for the 5′ and 3′ ends of the sense and antisense strand of the dsRNA, constructing a recombinant vector with the amplified DNA, transfecting cells with the recombinant vector, lysing the cells, and centrifuging the cell lysates to provide a supernatant containing the partially purified protein. Further purification is accomplished by affinity chromatography using viral protein specific monoclonal antibodies to purify the corresponding protein. The preferred gene specific primers for RT-PCR of the genes which encode the viral proteins from the IND strain, the 2992B strain, the Cr strain, the WD563 strain and the Shintoku strain are shown in Table 1.

The partially-purified VP4 protein of the IND strain was prepared by first amplifying genomic dsRNA extracted from the cell-propagated IND strain as described in Example 1 using a sense primer of SEQ. ID. NO. 15 and the antisense primer SEQ. ID. NO. 16 as shown in Table 1. The PCR-amplified full length VP7 cDNA was purified by centrifugation using a centrix-AG cartridge from Advanced Genetic Technologies, Gaithersburg, and then digested with restriction enzymes BamHI and PstI. The VP4 fragments were then cloned into plasmid pVL1393 from Pharmigen, San Diego. Recombinant plasmids were identified by colony blot hybridization using radiolabeled PCR-derived IND VP4 cDNA as a probe. The probes were prepared using a nick translation kit from Bethesda Research Laboratories, Gaithersburg and 32 P-deoxycytidine-5′-triphosphate from ICN Biochemicals, Irvine, Calif. Plasmid DNAs hybridizing positively with the probes were subjected to restriction enzyme digests to check the size of the inserts. The recombinant plasmids were identified by sequencing in the junction region toward 3′ and 5′ end of the IND VP4 cDNA using polyhedron forward primer 5′-AAATGATAACCATCTCGA-3′, SEQ. ID NO. 49 or the reverse primer 5′-GTCCAAGTTTCCCTG-3′, SEQ. ID. NO. 50.

A cationic liposome mediated transfection kit from Invitrogen, San Diego was used to transfect the recombinant baculovirus into Sf9 cells. Sf9 cells were seeded in 60 mm plates and transfected with a mixture of 3 μg of recombinant transfer plasmid, 1 μg of linear AcMNPV viral DNA and 20 μl of cationic liposome solution. The transfected cells were incubated at 27° C. for 4 to 5 days. Successful transfection was confirmed by the presence of polyhedron within 6 days of transfection.

Serial dilution of the cell culture supernatants obtained from transfected Sf9 cells were used for a plaque assay. Recombinants were selected by occlusion-negative plaques. Virus in occlusion-negative plaques was subjected to three rounds of plaque purifications and used to propagate virus stock.

To confirm the recombination, the cell lysates from mock or recombinant baculovirus infected Sf9 cell monolayers was harvested and total DNA was purified by PEG/NaCl method. The presence of recombinants in the total DNA purified from infected Sf9 cells was determined by PCR using the following primers: 5′-TTTACTGTTTTCGTAACAGTTTTG-3′, SEQ. ID. NO. 47, and 5′-CAACAACGCACAGAATCTAGC-3′, SEQ. ID. NO. 48. The PCR reactions were heated at 94° C. for 2 minutes and subjected to thirty amplification cycles, each consisting of 94° C. for 1 minute, 55° C. for 2 minutes, 72° C. for 3 minutes and one cycle at 72° C. for 7 minutes. The PCR products were purified by centrix-AG cartridge from Advanced Genetic Technologies, Gaithersburg, Md., and analyzed by 1% agarose gel electrophoresis.

An indirect immunofluorescence assay was used to detect the expression of the IND VP7 protein in the infected Sf9 cells. Confluent Sf9 cells grown in 24-well plates were mock infected or infected with recombinant baculoviruses and incubated at 27° C. for 2 to 3 days. After the end of the incubation, the cells were harvested, centrifuged and washed with phosphate buffered saline. The cells were placed on 8 well slides, air dried and fixed with 80% acetone. Guinea pig hyperimmune antiserum to IND BRV was used to detect the expressed proteins. Antiserum at a dilution of 1:500 was incubated with the infected cells at 37° C. for 1 hr. The slides were placed in PBS for 5 minutes. The cells were then incubated with fluorescein-labeled rabbit anti guinea pig serum at a 1:1,000 dilution at 37° C. for 1 hour. Following this, the cells were washed and examined using a fluorescence microscope.

Cells which exhibited a positive fluorescence were sonicated at 40 amplitude for 1 minute, centrifuged at 2000 RPM for ten minutes at 4° C., and the supernatants collected from to provide the partially-purified VP7 protein of the IND strain. Each ml of cell lysate supernatant contained the partially purified VP7 protein from 10 7 transfected cells.

The partially-purified VP7 of the IND strain was prepared first by PCR amplifying the dsRNA extracted from the cell-propagated IND strain as described in Example 1 using the sense primer having SEQ. ID. NO. 19 and the antisense primer SEQ. ID. NO. 20 as shown in Table 1. The PCR-amplified full length VP4 cDNA was purified as described in Example 8 and then digested with restriction enzymes EcoRI and BamHI and cloned into plasmid pVL1393 from Pharmigen, San Diego. Recombinant plasmids were identified as described in Example 8 and used to transfect Sf9 cells as described in Example 8. Transfected cells were identified as described in Example 8, and×106 transfected cells were sonicated, and centrifuged to provide a supernatant containing partially purified VP4 protein of the IND strain. Each ml of cell lysate supernatant contained the partially purified VP7 protein from 10 7 transfected cells.

The partially-purified VP7 of the Shintoku strain was prepared first by PCR amplifying dsRNA from the cell-propagated Shintoku strain as described in Example 1 using the sense primer having SEQ. ID. NO. 25 and the antisense primer SEQ. ID. NO. 26 as shown in Table 1. The PCR-amplified full length VP7 cDNA was purified as described in Example 4 and then digested with restriction enzymes EcoRI and BamHI and cloned into plasmid pCR-Bac from Invitrogen, San Diego. Recombinant plasmids were identified by DNA sequencing in the junction region toward the 3′ and 5′ end of each gene using polyhedron forward primer 5′-AAATGATAACCATCTCGC-3′, SEQ.ID.NO. 49 or the reverse primer, 5′-GTCCAAGTTTCCCTG-3, SEQ. ID. NO. 50.

Recombinant plasmids were used to transfect Sf9 cells as described in Example 4. Transfected cells were identified as described in Example 8, sonicated, and centrifuged to provide a supernatant containing partially purified VP7 protein of the Shintoku strain. Each ml of cell lysate supernatant contained the partially purified VP7 protein from 10 7 transfected cells.

The partially-purified VP4 of the Shintoku strain was prepared first by PCR amplification of the dsRNA obtained from the cell-propagated Shintoku strain as described in Example 1 using the sense primer having SEQ. ID. NO. 23 and the antisense primer SEQ. ID. NO. 24 as shown in Table 1. The PCR-amplified full length VP4 cDNA was purified as described in Example 8 and then digested with restriction enzymes EcoRl and BamHI and cloned into plasmid pCR-Bac from Invitrogen, San Diego. Recombinant plasmids were identified as described in Example 10 and used to transfect Sf9 cells as described in Example 8. Transfected cells were identified as described in Example 8. The supernatant containing partially purified VP4 protein of the Shintoku strain was prepared as in Example 8. Each ml of cell lysate supernatant contained the partially purified VP7 protein from 10 7 transfected cells.

The partially-purified VP6 protein of the Shintoku strains was prepared first by PCR amplification of the dsRNA from the cell-propagated Shintoku strain and PCR as described in Example 1 using the sense primer having SEQ. ID. NO. 25 and the antisense primer SEQ. ID. NO. 26 as shown in Table 1. The PCR-amplified full length VP6 cDNA was purified as described in Example 4 and then digested with restriction enzymes EcoRI and BamHI and cloned into plasmid pCR-Bac from Invitrogen, San Diego. Recombinant plasmids were identified as described in Example 6 and used to transfect Sf9 cells as described in Example 4. Transfected cells were identified as described in Example 4, sonicated, and centrifuged to provide a supernatant containing partially purified VP6 protein of the Shintoku strain. Each ml of cell lysate supernatant contained the partially purified VP7 protein from 10 7 transfected cells.

The partially-purified VP6 protein of the IND strain was prepared first by PCR amplification of the dsRNA from the cell-propagated IND strain as described in Example 1 using the sense primer having SEQ. ID. NO. 17 and the antisense primer SEQ. ID. NO. 18 as shown in Table 3. The PCR-amplified full length IND VP6 cDNA was purified as described in Example 4 and then digested with restriction enzymes EcoRi and BamHI cloned into plasmid pCR-Bac. Recombinant plasmids were identified as described in Example 6 and used to transfect Sf9 cells as described in Example 4. Transfected cells were identified as described in Example 4. Transfected cells were sonicated, and centrifuged to provide a cell lysate supernatant containing partially purified VP6 protein of the IND strain. Each ml of cell lysate supernatant contained the partially purified VP6 protein from 10 7 transfected cells.

Immunization of Animals with Partially Purified VP4, VP6, and VP7 Proteins from Recombinant Baculovirus Cell Lysates

The partially-purified IND VP4 protein, IND VP7 protein, Shintoku VP4 protein and Shintoku VP7 protein respectively of Examples 8, 8, 10, and 11 were injected into guinea pigs. 0.5 ml of the cell lysate supernatant containing the respective partially-purified viral protein was mixed with an equal volume of Freund's complete adjuvant and the entire amount injected into multiple subcutaneous sites of each animal. Two weeks later, booster injections of the same amount of cell lysate supernatant mixed with an equal volume of Freund's incomplete adjuvant were administered. The same inoculum with adjuvant was administered intramusculary at three-week intervals after the second injection up to 4 times. The guinea pigs were bled at 3 and 7 weeks via cardiac puncture after the first injection. Serum samples were tested for the presence of virus neutralizing antibodies by plaque reduction virus neutralization (PRVN) assays and for the presence of antibodies reactive to rotavirus by ELISA, western blot and immunofluorescence assays.

The PRVN test was performed in six well plates containing MA 104 cell monolayers to determine neutralizing antibody titers of the hyperimmune antisera to the recombinant proteins. Serial four fold dilutions of antisera were mixed with equal volumes of viral suspensions containing 60 to 80 PFU/0.1 ml and incubated for one hour at 37° C. The plates were washed once with serum free Earle's Minimal Essential Medium and agar medium containing 0.8% Noble agar, 0.067 mg of neutral red per ml, and 25 μg of pancreatin from Gibco per ml in E-MEM was added. The PRVN titer was expressed as the reciprocal of the highest dilution of serum which produced an 80% reduction in the number of plaques, as compared with the number in virus control wells. The PVRN titers for animals mock-infected baculovirus lysates and with the partially purified proteins of Examples 4, 5, 6, and 7 are shown in Table 4.

Characterizing the Antibody Titer of Animals

The partially-purified VP4 and VP7 proteins of the BRV strains IND, 2992B, Cr, WD653 and Shintoku are useful for measuring the titers of VP4 and VP7 antibodies in serum samples of animals naturally infected with BRV strains having serogroups or serotypes related to each of these respective BRV strains or in animals inoculated with a vaccine made with the related whole virus. The method of measurement involves a direct ELISA testing system using the partially-purified proteins coated directly on the plates or captured on the plates via antibodies.

Nunc plates are coated directly with the supernatant of Examples 4, 5, 6, and 7 diluted 1:25 or with lysates of wild-type baculovirus-infected cells control diluted 1:25. Serum samples from the animals inoculated with the test vaccine are added to each plate. Then secondary antibodies consisting of biotinylated monoclonal antibodies to bovine IgGI; IgG2; and IgM diluted 1:1,000-1:2,000 are added to the plate. The indicator antibody is a peroxidase-conjugated streptavidin b diluted 1:10,000 and the substrate is 2,2 acino-di-(e-ethylbenz-thiazoline-6-sulfonate) with 0.03% H 2 O 2 . For detection of IgA antibodies in the above system, a monoclonal antibody conjugated to alkaline phosphatase diluted 1:500 is used followed by the substrate p-nitrophenol phosphate in 10% DEA buffer. The absorbance for all assays, is determined in an ELISA reader at 405 nm for the alkaline phosphatase system or 450 nm for the peroxidase system. The ELISA antibody titers are expressed as the reciprocal of the highest sample dilution which had an absorbance of greater than 3 SD above the background control sample in mock-infected wild type control wells. Each test includes a positive and negative control serum.

Preparation of Virus-Like Particles

It is currently believed that vaccines which elicit a strong immunogenic response to the outer capsid proteins VP4 and VP7 offer greater protection than vaccines which elicit only a weak immunogenic response to these outer capsid proteins. Unfortunately, vaccines made from live and attenuated viruses do not always raise a high antibody titer to VP4 and VP7. The viruses that are used in such vaccines are obtained from tissue culture and are not always complete, that is, the tissue culture-propagated viruses lack the outer capsid layer. Moreover, the compounds which are used to inactivate the viruses used in vaccines are believed to adversely affect the epitopes which elicit a strong immune response. Accordingly, it is desirable to have a non-infectious, immunogenic virus particle which is comprised of the viral triple capsid layers and the VP2, VP4, VP6 and VP7 proteins. It is also desirable to have a method of assessing the VP4 and VP7 antigenicity of vaccines made with attenuated or inactivated viruses or with immunogenic virus-like particles.

Rotavirus virus-like particles (VLPs) are assembled in a triple-layered structure by coinfecting cells with four different recombinant vectors, wherein one of said vectors comprises a rotavirus VP2 gene, one of said vectors comprises a rotaviarus VP4 gene, one of said vectors comprises a rotavirus VP6 gene, and one of said vectors comprises a rotavirus VP7 gene, and then isolating the assembled particles from the extracellular medium or cell lysates. Preferably the cells are infected with the recombinant vector at a multiplicity of infection of from about 5 to about 10 plaque-forming units (PFUs). Preferably the VLP comprises at least one BRV protein. To form homologous VLP's, the cells are coinfected with vectors that comprise genes from the same BRV strain. Preferably, the vectors used to prepare a homologous VLP comprise the VP2, VP4, VP6, and VP7 genes from one of the following BRV strains: the IND strain, the 2292B strain, the Shintoku strain, the Cr strain, or the WD653 strain. To form heterologous VLPs, the cells are coinfected with vectors that comprise the VP2, VP4, VP6, and VP7 genes from different strains of rotavirus. For heterologous VLPs, it is preferred that the cells be coinfected with baculoviruses comprising the VP4 and VP7 genes from a single BRV strain, more preferably the IND strain, the 2292B strain, the Shintoku strain, or the WD653 strain.

A heterologous VLP was prepared by coinfecting Sf9 cells at a multiplicity of infection of 10 PFU per cell with baculovirus recombinants which comprised of genes encoding the core BRV proteins RF VP2, SA11 VP6, and the outer capsid proteins IND VP4, and IND VP7. The baculovirus recombinants comprising the IND VP4 protein and the IND VP7 protein were prepared as described in Examples 8 and 9, respectively. The baculovirus recombinants were prepared using rotavirus genes 2 and 6 obtained from Dr. M. K. Estes, Baylor College of Medicine, Houston, Tex. The infection was done in Hink's TNM-FH insect medium from JRH, Lenexa, Kans., containing 0.5% FBS. The cells and medium were harvested at 144 hours postinfection, and the medium was clarified by centrifugation for 10 minutes at 2,500 rpm in a Hermle centrifuge. The clarified medium was layered over a 35% sucrose cushion in TNC buffer and centrifuged for 90 minutes at 25,000 rpm in a Beckman SW28 rotor. The resulting pellet was suspended in TNC buffer containing 10 mM Tris-Cl, 140 mM NaCl, 10 mM CaCl 2 . Cesium chloride was added to the pellet to obtain a refractive index of 1.3640, and the mixture was centrifuged for 18 hours at 35,000 rpm in a Beckman SW50.1 rotor. The resulting cesium chloride gradients were fractionated, and fractions which contained the triple-layered VLPs were pooled. The VLPs were then concentrated by centrifugation for 2 hours at 35,000 rpm in a Beckman SW41 rotor, the supernatant removed, and the VLP pellet suspended in TNC buffer. Particle composition and integrity was determined by negative-stain electron microscopy (EM), Western blot, and ELISA.

Administering the VLP p 0.5 ml of the VLP suspension of Example 10 was mixed with an equal volume of Freund's complete adjuvant and the entire amount injected into the multiple subcutaneous sites in each guinea pig. Two weeks later, booster injections of the same amount of suspension with an equal volume of Freund's incomplete adjuvant were administered. The same inoculum with adjuvant was administered intramusculary at three-week intervals after the second injection up to 4 times. The guinea pigs were bled at 3 and 7 weeks via cardiac puncture after the first injection. Serum samples were tested for the presence of virus neutralizing antibodies by PRVN assays and for the presence of antibodies to rotavirus by ELISA, western blot and immunofluorescence assays.

The PRVN test was performed in six well plates containing MA 104 cell monolayers to determine neutralizing antibody titers of the hyperimmune antisera to the VLP particles. Serial four fold dilutions of antisera were mixed with equal volumes of viral suspensions containing 60 to 80 PFU/0.1 ml and incubated for one hour at 37° C. The plates were washed once with serum free Earle's Minimum Essential Medium, and agar medium containing 0.8% Noble agar, 0.067 mg of neutral red per ml, and 25 μl of pancreatin from Gibco per ml in E-MEM was added. The PRVN titer was expressed as the reciprocal of the highest dilution of serum which produced an 80% reduction in the number of plaques, as compared with the number in virus control wells.

The PVRN titers for animals mock-infected baculovirus lysates were less than 4 and the PRVN titers for the animals inoculated with the VLP particles were approximately 3000 following 4 injections with the VLP suspension of Example 10.

50

1

1062