Aortic carboxypeptidase-like polypeptide

Cloning of ACLP Genes

ACLP was identified in a screen for proteins interacting with the E47 product of the E2A gene. A recombinant E47 fusion protein (N3-SH[ALA]), containing the basic helix loop helix domain of hamster shPan-1 (amino acids 509-646, with mutations R551A, V552L, and R553A) with a heart muscle kinase recognition sequence and the FLAG epitope, was expressed and purified as described (Blanar et al., 1995, Proc. Natl. Acad. Sci. USA 92:5870-4; Blanar and Rutter, 1992, Science 256:1014-8). N3-SH[ALA] was phosphorylated by heart muscle kinase in the presence of γ- 32 P-ATP and used to screen a human aorta λgt11 cDNA expression library (Clonetech) by interaction cloning (Blanar et al., 1995, Proc. Natl. Acad. Sci. USA 92:5870-4; Blanar and Rutter, 1992, Science 256:1014-8). A 1450-bp cDNA clone (ΔE2A-BP) obtained from interaction cloning was radiolabeled by random priming and used to isolate a 2786 bp cDNA clone from the same human aorta λgt11 cDNA library. Data from Northern blotting experiments revealed that the ACLP-1 RNA was about 3.9 kb in size and suggested that the 2786 bp cDNA clone was a partial cDNA clone. Additional 5′ sequences of the ACLP cDNA were isolated by 5′ rapid amplification of cDNA ends from human aortic smooth muscle cell RNA (Gibco-BRL). The full length sequence of the human ACLP cDNA was found to be 3935 bp and is shown in Table 1 (SEQ ID NO:1). The full length human ACLP cDNA contains an open reading frame (nucleotides 140-3613 of SEQ ID NO:1) encoding a polypeptide of 1158 amino acids. The open reading frame is preceded by a Kozak consensus translation initiation sequence, which in turn is preceded by an in frame stop codon.

The human ACLP protein has a calculated molecular mass of 130 kDa, an estimated pI of 4.8, and contains a putative signal peptide sequence. In addition, it contains an 11 amino acid lysine- and proline-rich motif repeated four times at the N-terminus, a domain with 30% amino acid identity to the slime mold adhesion protein discoidin I, and a C-terminal domain with 39% identity to carboxypeptidase E. The human ACLP gene maps to the short arm of chromosome 7 (between D7S478 amd D7S519).

The sequence of the human ACLP cDNA (GENBANK™ accession number AF053944) was compared to sequences present in GENBANK™ databases. A 3′ portion of ACLP CDNA was found to share homology with the sequence of a cDNA encoding mouse adipocyte enhancer binding protein 1 (AEBP1; He et al., 1995, Nature 378:92). AEBP1 was originally identified as a 2.5 kb cDNA that hybridized to a 4 kb band on Northern blot analysis, and was predicted to encode a 719 amino acid, 79 kDa protein.

To isolate mouse ACLP cDNA (GENBANK™ accession number AF053943), first strand cDNA from C2C12 mouse myoblast total RNA was synthesized by reverse transcription with the primer 5′ ATCTGGTTGTCCTCAAT 3′ (SEQ ID NO:4). The nested primer 5′ TGACTCCATCCCAATAG 3′ (SEQ ID NO:5) and the anchor primer included in the kit for 5′ rapid amplification of cDNA ends was then amplified to produce a product of approximately 1400 bp in size. This product was sequenced using standard methods.

The entire open reading frame of mouse ACLP was then amplified from C2C12 RNA by reverse transcription PCR (EXPANDLONG™ Template PCR System, Boehringer Mannheim, Indianapolis, Ind.). The human and mouse clones were sequenced by the dideoxy nucleotide chain termination method using a combination of Sequenase Version 2.0 (Amersham, Arlington Heights, Ill.), the Thermo Sequenase 33 P terminator cycle sequencing kit (Amersham), and the Thermo Sequenase fluorescent-labeled cycle sequencing kit with 7-deaza-GTP (Amersham) on a Licor (Lincoln, Nebr.) apparatus.

Sequencing of the 3633 bp mouse ACLP cDNA fragment, revealed that it encoded an open reading frame (1128 amino acids) similar to that of the full-length human ACLP cDNA, indicating that it is the mouse ACLP homologue. A comparison of the human and mouse ACLP amino acid sequences is shown in FIG. 1 A. Overall, the two proteins are 85% identical and 90% similar.

Identification of a Promoter-Enhancer Sequence Associated with the ACLP Gene

To identify genomic sequences that mediate tissue specific and developmental expression pattern of the ACLP gene, a region of genomic DNA adjoining the 5′ end of the mouse ACLP coding sequences was isolated (FIGS. 2 A and 2 B). Portions of this genomic DNA were then used in reporter transfection assays to determine their ability to direct expression of a reporter gene in transfection assays. ACLP promoter/enhancer DNA was cloned into the pGL2 Basic vector (Stratagene) and transfected into rat aortic smooth muscle cells (RASMC) to measure promoter activity. Using this assay, a region containing an ACLP promoter/enhancer sequence was identified and is shown in Table 3 (SEQ ID NO:3). ACLP promoter/enhancer DNA was found to have transcriptional activity both in vitro (using cultured cells) and in vivo (in a transgenic mouse).

Generation and Characterization of Antibodies to ACLP Peptides

A carboxy terminal fragment of mouse ACLP was expressed in bacteria, purified, and used as an immunogen to raise antibodies in rabbits.

To produce a polyclonal anti-ACLP antibody, a BamHI-EcoRI fragment of mouse ACLP (encoding amino acids 615-1128) was subcloned into the pRSET C bacterial expression vector (Invitrogen), and the resulting plasmid was transformed into BL21(DE3)pLysS-competent bacteria (Stratagene). Protein expression was induced with 1 mM isopropyl β-D-thiogalactopyranoside for 3 h. Bacteria were sonicated in lysis buffer (50 mM NaH 2 PO 4 , 10 mM Tris, pH 8, 100 mM NaCl) containing the protease inhibitors aprotinin, leupeptin, and phenylmethylsulfonyl fluoride. Lysates were clarified by centrifugation at 10,000 g for 15 min, and the pellet was resuspended in lysis buffer supplemented with 8 M urea. His-tagged proteins were purified with Talon resin (Clontech) and eluted in lysis buffer containing 8 M urea and 100 mM ethylene diamine tetraacetic acid. Proteins were dialyzed against water and measured with the Bio-Rad (Hercules, Calif.) protein assay reagent. 100 μg of the purified protein was used to immunize New Zealand white rabbits. Antiserum was collected, titered against the recombinant protein, and used for immunoblot analysis. Specificity of the antiserum was determined by using preimmune serum and by competition with a recombinant protein. The same methods are used to raise antibodies to human ACLP. The rabbit antisera raised against a portion of mouse ACLP was found to crossreact with human ACLP.

Protein extracts from cultured cells were prepared for Western blotting in extraction buffer (25 mM Tris, pH 7.4, 50 mM NaCl, 0.5% sodium deoxycholate, 2% Nonidet P-40, and 0.2% sodium dodecyl sulfate) containing the protease inhibitors aprotinin, leupeptin, and phenylmethylsulfonyl fluoride. To obtain proteins from mouse tissues, individual organs were homogenized in 25 mM Tris, pH 7.5, 50 mM NaCl, and 10 mM ethylene diamine tetraacetic acid containing protease inhibitors (Complete, Boehringer Mannheim). Proteins were measured with the BCA protein assay kit (Pierce, Rockford, Ill.). After 50 μg aliquots had been resolved on 6% sodium dodecyl sulfate-polyacrylamide gels (18), proteins were transferred electrophoretically to nitrocellulose membranes (Schleicher and Schuell, Keene, N.H.) in 48 mM Tris, pH 8.3, 39 mM glycine, 0.037% sodium dodecyl sulfate, and 20% methanol transfer buffer. Blots were equilibrated with 25 mM Tris, pH 8, 125 mM NaCl, and 0.1% Tween 20 and blocked in the same solution containing 4% nonfat dry milk. Blots were incubated with anti-ACLP serum diluted 1:1000 and then horseradish peroxidase-conjugated goat anti-rabbit serum diluted 1:4000. Membranes were processed with an enhanced chemiluminescence reagent (ECL reagent, NEN, Boston, Mass.) and exposed to film.

By Western blot analysis, this antibody detected a single band corresponding to a protein with an apparent mobility of approximately 175 kDa in mouse aortic smooth muscle cells (MASMC) extracts. This protein showed a similar migration to a protein generated by transcription and translation in vitro of a mouse ACLP cDNA clone, providing additional evidence that the isolated human and mouse cDNA clones encode full-length ACLP.

Monoclonal antibodies can be obtained using full-length human or mouse ACLP or fragments thereof using standard methods, e.g., the process described by Milstein and Kohler, 1975, Nature 256:495-97, or as modified by Gerhard, 1980, Monoclonal Antibodies, Plenum Press, pages 370-371. Hybridomas are screened to identify those producing antibodies that are specific for an ACLP. Preferably, the antibody will have an affinity of at least about 10 8 liters/mole and more preferably, an affinity of at least about 10 9 liters/mole.

Subcellular Localization and Tissue Localization of ACLP Proteins

To assess the subcellular localization of ACLP, a mouse ACLP expression construct was generated with a c-myc epitope at the C-terminus. The myc epitope was placed at the C-terminus to avoid interference with signal peptide-mediated processes, e.g., ACLP secretion mechanisms. To construct a c-myc-tagged ACLP expression plasmid (pcDNA3.1/ACLP-Myc-His), the open reading frame of mouse ACLP was amplified with the Expand Long Template PCR System (Boehringer Mannheim). A 5′ primer containing an EcoRI site (5′ CGGAATTCAGTCCCTGCTCAAGCCCG 3′; SEQ ID NO:6) and a 3′ primer containing a HindIII site (5′ CGAAGCTTGAAGTCCCCAAAGTTCACTG 3′; SEQ ID NO:7) was used, which resulted in the deletion of the endogenous termination codon in the PCR product. The PCR product was then digested with EcoRI and HindIII restriction enzymes and ligated into the EcoRI and HindIII sites of pcDNA3.1(−)/Myc-His A (Invitrogen). Cells were transfected transiently with pcDNA3.1/ACLP-Myc-His by the DEAE-dextran method with minor modifications (Tan et al., Kidney International 46:690, 1994). Twenty-four hours after transfection, cells were trypsinized and plated onto chamber slides (Nunc, Naperville, Ill.) and grown for an additional 24 h. Cells were fixed with 4% paraformaldehyde in phosphate-buffered saline and immunostained using standard methods.

Amonoclonal anti-c-myc primary antibody (9E10 Ab-1, Oncogene Research Products, Cambridge, Mass.) and a rhodamine-conjugated goat anti-mouse IgG secondary antibody were used to immunostain the cells. Nuclei were counterstained with Hoechst 33258 (1 μg/ml) and visualized with a fluorescence microscope.

RASMC and A7r5 cells both exhibited strong membrane-associated or cytoplasmic staining. Staining was most intense in the perinuclear region and was not observed in the nucleus. Various other tissues were examined for the presence of ACLP mRNA and protein. Gene expression studies confirmed expression in aortic smooth muscle cells, and levels of ACLP mRNA were found to be high in the whole aorta (including adventitia) compared to most other tissue types tested, e.g., heart, brain, stomach, thymus, and liver. ACLP message was also detectable in colon and kidney tissue.

To examine expression of ACLP, extracts from mouse tissues were subjected to Western blot analysis using anti-ACLP sera. ACLP was strongly expressed in the mouse aorta (without adventitia) but not in the adventitia, heart, liver, skeletal muscle, or kidney. The presence of ACLP mRNA in the kidney (but absence of protein) indicates that the level of ACLP in the cells is regulated at the level of translation of ACLP mRNA into polypeptide.

To identify cell types expressing ACLP in an adult animal, in situ hybridization was performed on adult rat aorta and skeletal muscle using known methods. Adult male Sprague-Dawley rats were perfused with 4% paraformaldehyde and their organs were removed and sectioned. ACLP mRNA was detected with a [ 35 S] UTP-labeled antisense riboprobe synthesized with SP6 RNA polymerase from a linearized 0.7 kb fragment of ACLP cDNA. As a control, a sense RNA probe was synthesized with T7 RNA polymerase from a linearized ACLP cDNA fragment. The antisense riboprobe detected specific ACLP expression in the smooth muscle cells of the aorta, whereas the control (sense) probe did not. Neither the sense nor the antisense probe hybridized to skeletal muscle cells.

ACLP Expression in Smooth Muscle Cell Differentiation

ACLP protein expression was examined during vascular smooth muscle cell growth and differentiation. RASMC and MASMC were isolated from the thoracic aortas of adult male Sprague-Dawley rats and C57Bl/6 mice using standard methods. Human aortic smooth muscle cells (HASMC) were purchased from Clonetics (San Diego, Calif.), and rat A7r5 smooth muscle cells and C2C12 mouse myoblasts were purchased from the American Type Culture Collection (Rockville, Md.). Mouse neural crest cells (Monc-1 cells) were cultured on fibronectin-coated plates. RASMC, MASMC, and A7r5 cells were cultured in Dulbecco's modified Eagle's medium with 3.7 g/liter glucose (Gibco-BRL, Gaithersburg, MD) supplemented with 10% fetal bovine serum (Hyclone, Logan, UT), 4 mML-glutamine, 100 μg/ml streptomycin, 100 units/ml penicillin, and 10 mM HEPES (pH 7.4). C2C12 cells were grown in Dulbecco's modified Eagle's medium supplemented with 15% fetal bovine serum, 4 mM L-glutamine, 100 μg/ml streptomycin, and 100 units/ml penicillin. HASMC were cultured in M199 medium (Gibco) supplemented with 20% fetal bovine serum, 4 mM L-glutamine, 100 μg/ml streptomycin, and 100 units/ml penicillin. Cells were grown at 37° C. in a humidified incubator containing 5% CO 2 . MASMC were cultured for 3 days in 0.4% calf serum containing medium that induces quiescence. RNA and protein extracts were then prepared from the cells and analyzed.

The amount of ACLP mRNA was higher (about 2-fold) in serum-starved (quiescent) MASMC than in control cells (normal proliferating MASMC). In RASMC, ACLP mRNA was approximately 3-fold more abundant in quiescent cells than in their actively proliferating counterparts. ACLP protein was also elevated in quiescent MASMC.

ACLP expression was examined in an in vitro system for differentiating smooth muscle cells from a Monc-1 cell line, a mouse line derived from the neural crest. Monc-1 cells differentiate into smooth muscle cells when tissue culture medium supplemented with chick embryo extract is replaced with differentiation medium. To examine ACLP expression during the transition of undifferentiated Monc-1 cells to smooth muscle, the time course of ACLP expression was measured. ACLP mRNA was nearly undetectable in undifferentiated Monc-1 cells. As the cells differentiated, however, ACLP expression increased until it became marked at days 4 and 6 after the start of differentiation. Under these conditions, induction of ACLP appeared to lag behind that of smooth muscle α-actin, a marker for smooth muscle cells. To compare the level of ACLP protein in cells treated similarly, protein extracts were prepared from undifferentiated Monc-1 cells and from cells allowed to differentiate for 6 days. ACLP protein was not detectable in undifferentiated Monc-1 cells but was expressed highly (day 6) under conditions that promote Monc-1 cell differentiation into smooth muscle cells. The abundance of ACLP protein in these cells was similar to that in MASMC.

As is described below, the Monc-1 cells (and other cells expressing ACLP) can be used to screen for compounds that stimulate a therapeutic increase in ACLP production (e.g., during cell differentiation and/or fetal development).

Genetically-altered Animals

An ACLP deficient animal, e.g., an ACLP knockout mouse, is produced as follows.

The targeting construct was made by deleting exons, e.g., 7-15 of the mouse ACLP gene (see FIG. 3 ). A SalI-BamHI fragment of the ACLP gene was replaced with pPGK-neo to generate the targeting construct.

The linearized targeting construct (shown in FIG. 3) was transfected into murine D3 embryonic stem (ES) cells, and a clone with the correct homologous recombination (yielding the appropriately disrupted ACLP gene shown in FIG. 3) injected into blastocysts and used to generate ACLP chimeric mice using standard methods. The chimeric mice were bred with wild type mice to generate ACLP-mutated heterozyous mice. ACLP-mutated heterozygous mice were born normal. To generate an ACLP knockout mouse (i.e., homozygous for the ACLP mutation), the heterozygous mice were mated. The genotype of newborn mice was evaluated at 3 weeks. Out of 205 live pups, 74 were found to have the wild type ACLP gene, 113 were found to be heterozygotes, and 18 were found to be homozygous for the ACLP null mutation, i.e., ACLP knockout mice. These data indicate that many of the knockout mice died before or immediately after birth.

The phenotype of ACLP knockout mice was evaluated during development. Cesarean sections were performed to obtain embryos at 18.5 embryonic days (El8.5). ACLP-knockout mice were found to have an abdominal defect with extrusion of abdominal organs, whereas the wild type mice were normal.

The progress of the development of gastroschisis is evaluated by mating heterozygous ACLP-mutant mice and obtaining embryos at various time points, e.g., E18.5, E16.5, E12.5, E10.5, and E8.5. Embryos are examined at both gross and microscopic levels. Histological evaluation of embryonic tissue, e.g., to follow the formation of the omphalomesenteric arteries, is used to determine the incidence and time of development of gastroschisis.

ACLP-deficient animals can be used to screen for compounds to treat or prevent the development of gastroschisis. To determine whether a given compound prevents or reduces the development of gastroschisis in developing embryos, the compound is administered to the pregnant animal (e.g., systemically, in utero, or directly to an embryo itself) and the embryos examined as described above. For example, a nucleic acid encoding a full length wild type ACLP gene (or an ACLP gene which may differ from the wild type sequence but still retains ACLP function) can be tested to evaluate the effect of such gene therapy on the development of gastroschisis. A reduction in the severity of gastroschisis in treated embryos compared to untreated embryos indicates that the compound or gene therapy approach to treatment of gastroschisis is clinically beneficial.

ACLP deficient mice and ACLP deficient cell lines derived from such mice are useful in determining the etiology of gastroschisis and screening for therapeutic compositions.

Diagnosis of Disorders Associated with Altered Levels of ACLP Expression or Activity

The data described herein indicates that an ACLP mutation (e.g., in ACLP coding or regulatory sequences) is involved in the development of gastroschisis. Thus, individuals (e.g., those with a family history of the disease) can be tested for the presence of a mutated ACLP gene which may contribute to the development of gastroschisis in children of an individual harboring a mutated gene. Detection of such a mutation will permit appropriate genetic counseling of those individuals regarding the risks associated with pregnancy. In addition, such testing can be used to identify individuals with subclinical gastroschisis or other related gastrointestinal abnormalities. Prenatal testing may be carried out to determine whether a developing fetus is at risk of developing gastroschisis. Although gastroschisis may be detected at approximately the second trimester of pregnancy by conventional prenatal ultrasound testing, early detection of a genetic abnormality permits early intervention, including genetic therapy, which may prevent the development of the condition or reduce its severity.

Analysis can be carried out on any suitable genomic DNA sample (e.g., maternal tissue and/or fetal tissue) to be tested. Typically, a blood sample or a sample of placental or umbilical cord cells is tested. A sample of fetal cells can be obtained by amniocentesis or chorionic villi sampling.

Standard genetic diagnostic methods are used to detect a mutation in the ACLP gene. For example, PCR (polymerase chain reaction) is used to identify the presence of a deletion, addition, or substitution of one or more nucleotides within any one of the exons of ACLP. Following the PCR reaction, the PCR product can be analyzed by methods as described above, such as the heteroduplex detection technique based upon that of White et al., 1992, Genomics 12:301-306, or by techniques such as cleavage of RNA-DNA hybrids using RNase A (Myers et al., 1985, Science 230:1242-1246); single-stranded conformation polymorphism (SSCP) analysis (Orita et al., 1989, Genomics 10:298-299); and denaturing gradient gel electrophoresis (DGGE; Myers et al., 1987, Methods Enzymol. 155:501-527). PCR may be carried out using a primer which adds a G+C-rich sequence (termed a “GC-clamp”) to one end of the PCR product, thus improving the sensitivity of the subsequent DGGE procedure (Sheffield et al., 1989, Proc. Natl. Acad. Sci. USA 86:232-236). If the particular mutation present in the patient's family is known to have removed or added a restriction site, or to have significantly increased or decreased the length of a particular restriction fragment, a protocol based upon restriction fragment length polymorphism (RFLP) analysis (perhaps combined with PCR) can be used to identify the genetic defect.

In addition to evaluating genomic DNA of a patient, an ACLP defect can be detected by evaluating an ACLP gene product. Unlike genomic DNA-based diagnostic methods, this approach permits detection of defects resulting in a decrease in the level of expression of an ACLP gene (i.e., a defect which does not involve mutations in the coding sequence itself). In addition to detection of a gene product, gene expression is also measured using mRNA-based methods, such as Northern blots and in situ hybridization (using a nucleic acid probe derived from the relevant cDNA), and quantitative PCR.

An ACLP gene product can be tested for abnormalities, e.g., differences in the level of expression compared to wild type ACLP, truncation of an ACLP gene product, or deletion of a portion of an ACLP gene product. Deletion ACLP mutants, e.g., those characterized by the loss of an ACLP epitope, can be detected using an ACLP-specific antibody. Western blotting and Northern blotting techniques are used to quantitate the amount of expression of a ACLP in the tissue of interest. For example, an individual who is heterozygous for a genetic defect affecting level of expression of ACLP may be diagnosed by detecting reduction in the level of expression of this gene in such a hybridization or antibody-based assay, and an individual who is homozygous may be identified by detection of a comparatively lower level of expression.

The diagnostic method of the invention is carried out by measuring ACLP gene expression in a tissue, e.g, a biopsy, or in a bodily fluid, e.g., blood or plasma. Detection of expression and determination of the level of gene expression is measured using methods known in the art, e.g., in situ hybridization, Northern blot analysis, or Western blot analysis using ACLP-specific monoclonal or polyclonal antibodies. An decrease in the level of ACLP expression per cell in the test sample of tissue compared to the level per cell in control tissue indicates that the patient has gastroschisis, is predisposed to developing gastroschisis, or is a carrier of a genetic defect associated with gastroschisis.

The diagnostic procedures described above are useful to identify patients in need of therapeutic intervention to reduce the severity of or prevent the development of gastroschisis.

Treatment of Disorders Associated with Altered Levels of ACLP Expression or Activity

Gene therapy may be carried out by administering to a patient a nucleic acid encoding a therapeutic polypeptide, e.g., an ACLP or fragment thereof, by standard vectors and/or gene delivery systems. Suitable gene delivery systems may include liposomes, receptor-mediated delivery systems, naked DNA, and viral vectors such as herpes viruses, retroviruses, adenoviruses and adeno-associated viruses, among others.

In addition to a gene delivery system as described above, the therapeutic composition may include a pharmaceutically acceptable carrier, e.g., a biologically compatible vehicle such as physiological saline, suitable for administration to an animal. A therapeutically effective amount of a compound is an amount which is capable of producing a medically desirable result in a treated animal, e.g., a reduction in the severity of gastroschisis or the prevention of the development of gastroschisis (e.g., in a fetus).

Parenteral administration, such as intravenous, subcutaneous, intramuscular, and intraperitoneal delivery routes, may be used to deliver the compound. Dosage for any one patient depends upon many factors, including the patient's size, body surface area, age, the particular compound to be administered, sex, time and route of administration, general health, and other drugs being administered concurrently. Dosage of the compound to be administered will vary. A preferred dosage for intravenous administration of nucleic acids is from approximately 10 6 to 10 22 copies of the nucleic acid molecule. Compounds, including therapeutic nucleic acids, may be administered locally through the uterine wall to the developing fetus using known methods.

ACLPs may be similarly administered, e.g., locally or systemically, e.g., intravenously, in a pharmaceutically acceptable carrier such as physiological saline. Standard methods for intracellular delivery of peptides can be used, e.g. packaged in liposomes. Such methods are well known to those of ordinary skill in the art. It is expected that an intravenous dosage of approximately 1 to 100 μmoles of the polypeptide of the invention would be administered per kg of body weight per day. The compositions of the invention are useful for parenteral administration, such as intravenous, subcutaneous, intramuscular, and intraperitoneal.

ACLP encoding DNA is be introduced into target cells of the patient by standard vectors, e.g., a vector which contains DNA encoding an ACLP operably linked to an ACLP promoter/enhancer sequence. Suitable gene delivery systems may include liposomes, receptor-mediated delivery systems, naked DNA, and viral vectors such as herpes viruses, retroviruses, and adenoviruses, among others. ACLP DNA under the control of a strong constitutive promoter may be administered locally using an adenovirus delivery system.

Drugs which stimulate an endogenous ACLP promoter may also be administered as described above to increase the level of expression ACLP in patients in which the underlying clinical defect is a pathologically low level of ACLP production.

Identification of Compounds that Alter ACLP Expression or Activity

ACLP knockout mice have the clinical manifestations of gastroschisis. Compositions that ameliorate the symptoms of gastroschisis or prevent the development of gastroschisis in a developing fetus can be identified using ACLP knockout mice. A test compound is administered to an ACLP knockout mouse. As a control, the compound is administered to a normal wild type mouse (preferably with the same genetic background as the ACLP knockout mouse). A reduction in the severity of gastroschisis in ACLP knockout mice treated with the test compound compared to control ACLP mice which have not been exposed to the test compound is an indication that the test compound is capable of ameliorating the symptoms of or preventing the development of gastroschisis.

Compounds can also be screened by contacting cells in vitro, e.g., VASMC, MASMC, RASMC, Monc-1 cells, or cells derived from an ACLP knockout mouse or from an animal or patient with gastroschisis, with a candidate compound and measuring the level of ACLP expression (or activity) in the cells. An increase in cellular ACLP expression (compared to the level of expression in the absence of a test compound) indicates that the compound is clinically useful to prevent or treat gastroschisis in which the underlying defect is pathological reduction in the level of ACLP production.

Other embodiments are within the following claims.

1

tccctcgctc accccatcct ctctcccgcc ccttcctgga ttccctcacc cgtctcgatc 60

ccctctccgc cctttcccag agacccagag cccctgaccc cccgcgccct ccccggagcc 120

ccccgcgcgt gccgcggcc atg gcg gcc gtg cgc ggg gcg ccc ctg ctc agc 172

Met Ala Ala Val Arg Gly Ala Pro Leu Leu Ser

1 5 10

tgc ctc ctg gcg ttg ctg gcc ctg tgc cct gga ggg cgc ccg cag acg 220

Cys Leu Leu Ala Leu Leu Ala Leu Cys Pro Gly Gly Arg Pro Gln Thr

15 20 25

gtg ctg acc gac gac gag atc gag gag ttc ctc gag ggc ttc ctg tca 268

Val Leu Thr Asp Asp Glu Ile Glu Glu Phe Leu Glu Gly Phe Leu Ser

30 35 40

gag cta gaa cct gag ccc cgg gag gac gac gtg gag gcc ccg ccg cct 316

Glu Leu Glu Pro Glu Pro Arg Glu Asp Asp Val Glu Ala Pro Pro Pro

45 50 55

ccc gag ccc acc ccg cgg gtc cga aaa gcc cag gcg ggg ggc aag cca 364

Pro Glu Pro Thr Pro Arg Val Arg Lys Ala Gln Ala Gly Gly Lys Pro

60 65 70 75

ggg aag cgg cca ggg acg gcc gca gaa gtg cct ccg gaa aag acc aaa 412

Gly Lys Arg Pro Gly Thr Ala Ala Glu Val Pro Pro Glu Lys Thr Lys

80 85 90

gac aaa ggg aag aaa ggc aag aaa gac aaa ggc ccc aag gtg ccc aag 460

Asp Lys Gly Lys Lys Gly Lys Lys Asp Lys Gly Pro Lys Val Pro Lys

95 100 105

gag tcc ttg gag ggg tcc ccc agg ccg ccc aag aag ggg aag gag aag 508

Glu Ser Leu Glu Gly Ser Pro Arg Pro Pro Lys Lys Gly Lys Glu Lys

110 115 120

cca ccc aag gcc acc aag aag ccc aag gag aag cca cct aag gcc acc 556

Pro Pro Lys Ala Thr Lys Lys Pro Lys Glu Lys Pro Pro Lys Ala Thr

125 130 135

aag aag ccc aag gag gag cca ccc aag gcc acc aag aag ccc aaa gag 604

Lys Lys Pro Lys Glu Glu Pro Pro Lys Ala Thr Lys Lys Pro Lys Glu

140 145 150 155

aag cca ccc aag gcc acc aag aag ccc ccg tca ggg aag agg ccc ccc 652

Lys Pro Pro Lys Ala Thr Lys Lys Pro Pro Ser Gly Lys Arg Pro Pro

160 165 170

att ctg gct ccc tca gaa acc ctg gag tgg cca ctg ccc cca ccc ccc 700

Ile Leu Ala Pro Ser Glu Thr Leu Glu Trp Pro Leu Pro Pro Pro Pro

175 180 185

agc cct ggc ccc gag gag cta ccc cag gag gga ggg gcg ccc ctc tca 748

Ser Pro Gly Pro Glu Glu Leu Pro Gln Glu Gly Gly Ala Pro Leu Ser

190 195 200

aat aac tgg cag aat cca gga gag gag acc cat gtg gag gca cag gag 796

Asn Asn Trp Gln Asn Pro Gly Glu Glu Thr His Val Glu Ala Gln Glu

205 210 215

cac cag cct gag ccg gag gag gag acc gag caa ccc aca ctg gac tac 844

His Gln Pro Glu Pro Glu Glu Glu Thr Glu Gln Pro Thr Leu Asp Tyr

220 225 230 235

aat gac cag atc gag agg gag gac tat gag gac ttt gag tac att cgg 892

Asn Asp Gln Ile Glu Arg Glu Asp Tyr Glu Asp Phe Glu Tyr Ile Arg

240 245 250

cgc cag aag caa ccc agg cca ccc cca agc aga agg agg agg ccc gag 940

Arg Gln Lys Gln Pro Arg Pro Pro Pro Ser Arg Arg Arg Arg Pro Glu

255 260 265

cgg gtc tgg cca gag ccc cct gag gag aag gcc ccg gcc cca gcc ccg 988

Arg Val Trp Pro Glu Pro Pro Glu Glu Lys Ala Pro Ala Pro Ala Pro

270 275 280

gag gag agg att gag cct cct gtg aag cct ctg ctg ccc ccg ctg ccc 1036

Glu Glu Arg Ile Glu Pro Pro Val Lys Pro Leu Leu Pro Pro Leu Pro

285 290 295

cct gac tat ggt gat ggt tac gtg atc ccc aac tac gat gac atg gac 1084

Pro Asp Tyr Gly Asp Gly Tyr Val Ile Pro Asn Tyr Asp Asp Met Asp

300 305 310 315

tat tac ttt ggg cct cct ccg ccc cag aag ccc gat gct gag cgc cag 1132

Tyr Tyr Phe Gly Pro Pro Pro Pro Gln Lys Pro Asp Ala Glu Arg Gln

320 325 330

acg gac gaa gag aag gag gag ctg aag aaa ccc aaa aag gag gac agc 1180

Thr Asp Glu Glu Lys Glu Glu Leu Lys Lys Pro Lys Lys Glu Asp Ser

335 340 345

agc ccc aag gag gag acc gac aag tgg gca gtg gag aag ggc aag gac 1228

Ser Pro Lys Glu Glu Thr Asp Lys Trp Ala Val Glu Lys Gly Lys Asp

350 355 360

cac aaa gag ccc cga aag ggc gag gag ttg gag gag gag tgg acg cct 1276

His Lys Glu Pro Arg Lys Gly Glu Glu Leu Glu Glu Glu Trp Thr Pro

365 370 375

acg gag aaa gtc aag tgt ccc ccc att ggg atg gag tca cac cgt att 1324

Thr Glu Lys Val Lys Cys Pro Pro Ile Gly Met Glu Ser His Arg Ile

380 385 390 395

gag gac aac cag atc cga gcc tcc tcc atg ctg cgc cac ggc ctg ggg 1372

Glu Asp Asn Gln Ile Arg Ala Ser Ser Met Leu Arg His Gly Leu Gly

400 405 410

gca cag cgc ggc cgg ctc aac atg cag acc ggt gcc act gag gac gac 1420

Ala Gln Arg Gly Arg Leu Asn Met Gln Thr Gly Ala Thr Glu Asp Asp

415 420 425

tac tat gat ggt gcg tgg tgt gcc gag gac gat gcc agg acc cag tgg 1468

Tyr Tyr Asp Gly Ala Trp Cys Ala Glu Asp Asp Ala Arg Thr Gln Trp

430 435 440

ata gag gtg gac acc agg agg act acc cgg ttc aca ggc gtc atc acc 1516

Ile Glu Val Asp Thr Arg Arg Thr Thr Arg Phe Thr Gly Val Ile Thr

445 450 455

cag ggc aga gac tcc agc atc cat gac gat ttt gtg acc acc ttc ttc 1564

Gln Gly Arg Asp Ser Ser Ile His Asp Asp Phe Val Thr Thr Phe Phe

460 465 470 475

gtg ggc ttc agc aat gac agc cag aca tgg gtg atg tac acc aac ggc 1612

Val Gly Phe Ser Asn Asp Ser Gln Thr Trp Val Met Tyr Thr Asn Gly

480 485 490

tat gag gaa atg acc ttt cat ggg aac gtg gac aag gac aca ccc gtg 1660

Tyr Glu Glu Met Thr Phe His Gly Asn Val Asp Lys Asp Thr Pro Val

495 500 505

ctg agt gag ctc cca gag ccg gtg gtg gct cgt ttc atc cgc atc tac 1708

Leu Ser Glu Leu Pro Glu Pro Val Val Ala Arg Phe Ile Arg Ile Tyr

510 515 520

cca ctc acc tgg aat ggc agc ctg tgc atg cgc ctg gag gtg ctg ggg 1756

Pro Leu Thr Trp Asn Gly Ser Leu Cys Met Arg Leu Glu Val Leu Gly

525 530 535

tgc tct gtg gcc cct gtc tac agc tac tac gca cag aat gag gtg gtg 1804

Cys Ser Val Ala Pro Val Tyr Ser Tyr Tyr Ala Gln Asn Glu Val Val

540 545 550 555

gcc acc gat gac ctg gat ttc cgg cac cac agc tac aag gac atg cgc 1852

Ala Thr Asp Asp Leu Asp Phe Arg His His Ser Tyr Lys Asp Met Arg

560 565 570

cag ctc atg aag gtg gtg aac gag gag tgc ccc acc atc acc cgc act 1900

Gln Leu Met Lys Val Val Asn Glu Glu Cys Pro Thr Ile Thr Arg Thr

575 580 585

tac agc ctg ggc aag agc tca cga ggc ctc aag atc tat gcc atg gag 1948

Tyr Ser Leu Gly Lys Ser Ser Arg Gly Leu Lys Ile Tyr Ala Met Glu

590 595 600

atc tca gac aac cct ggg gag cat gaa ctg ggg gag ccc gag ttc cgc 1996

Ile Ser Asp Asn Pro Gly Glu His Glu Leu Gly Glu Pro Glu Phe Arg

605 610 615

tac act gct ggg atc cat ggc aac gag gtg ctg ggc cga gag ctg ttg 2044

Tyr Thr Ala Gly Ile His Gly Asn Glu Val Leu Gly Arg Glu Leu Leu

620 625 630 635

ctg ctg ctc atg cag tac ctg tgc cga gag tac cgc gat ggg aac cca 2092

Leu Leu Leu Met Gln Tyr Leu Cys Arg Glu Tyr Arg Asp Gly Asn Pro

640 645 650

cgt gtg cgc agc ctg gtg cag gac aca cgc atc cac ctg gtg ccc tca 2140

Arg Val Arg Ser Leu Val Gln Asp Thr Arg Ile His Leu Val Pro Ser

655 660 665

ctg aac cct gat ggc tac gag gtg gca gcg cag atg ggc tca gag ttt 2188

Leu Asn Pro Asp Gly Tyr Glu Val Ala Ala Gln Met Gly Ser Glu Phe

670 675 680

ggg aac tgg gcg ctg gga ctg tgg act gag gag ggc ttt gac atc ttt 2236

Gly Asn Trp Ala Leu Gly Leu Trp Thr Glu Glu Gly Phe Asp Ile Phe

685 690 695

gaa gat ttc ccg gat ctc aac tct gtg ctc tgg gga gct gag gag agg 2284

Glu Asp Phe Pro Asp Leu Asn Ser Val Leu Trp Gly Ala Glu Glu Arg

700 705 710 715

aaa tgg gtc ccc tac cgg gtc ccc aac aat aac ttg ccc atc cct gaa 2332

Lys Trp Val Pro Tyr Arg Val Pro Asn Asn Asn Leu Pro Ile Pro Glu

720 725 730

cgc tac ctt tcg cca gat gcc acg gta tcc acg gag gtc cgg gcc atc 2380

Arg Tyr Leu Ser Pro Asp Ala Thr Val Ser Thr Glu Val Arg Ala Ile

735 740 745

att gcc tgg atg gag aag aac ccc ttc gtg ctg gga gca aat ctg aac 2428

Ile Ala Trp Met Glu Lys Asn Pro Phe Val Leu Gly Ala Asn Leu Asn

750 755 760

ggc ggc gag cgg cta gta tcc tac ccc tac gat atg gcc cgc acg cct 2476

Gly Gly Glu Arg Leu Val Ser Tyr Pro Tyr Asp Met Ala Arg Thr Pro

765 770 775

acc cag gag cag ctg ctg gcc gca gcc atg gca gca gcc cgg ggg gag 2524

Thr Gln Glu Gln Leu Leu Ala Ala Ala Met Ala Ala Ala Arg Gly Glu

780 785 790 795

gat gag gac gag gtc tcc gag gcc cag gag act cca gac cac gcc atc 2572

Asp Glu Asp Glu Val Ser Glu Ala Gln Glu Thr Pro Asp His Ala Ile

800 805 810

ttc cgg tgg ctt gcc atc tcc ttc gcc tcc gca cac ctc acc ttg acc 2620

Phe Arg Trp Leu Ala Ile Ser Phe Ala Ser Ala His Leu Thr Leu Thr

815 820 825

gag ccc tac cgc gga ggc tgc caa gcc cag gac tac acc ggc ggc atg 2668

Glu Pro Tyr Arg Gly Gly Cys Gln Ala Gln Asp Tyr Thr Gly Gly Met

830 835 840

ggc atc gtc aac ggg gcc aag tgg aac ccc cgg acc ggg act atc aat 2716

Gly Ile Val Asn Gly Ala Lys Trp Asn Pro Arg Thr Gly Thr Ile Asn

845 850 855

gac ttc agt tac ctg cat acc aac tgc ctg gag ctc tcc ttc tac ctg 2764

Asp Phe Ser Tyr Leu His Thr Asn Cys Leu Glu Leu Ser Phe Tyr Leu

860 865 870 875

ggc tgt gac aag ttc cct cat gag agt gag ctg ccc cgc gag tgg gag 2812

Gly Cys Asp Lys Phe Pro His Glu Ser Glu Leu Pro Arg Glu Trp Glu

880 885 890

aac aac aag gag gcg ctg ctc acc ttc atg gag cag gtg cac cgc ggc 2860

Asn Asn Lys Glu Ala Leu Leu Thr Phe Met Glu Gln Val His Arg Gly

895 900 905

att aag ggg gtg gtg acg gac gag caa ggc atc ccc att gcc aac gcc 2908

Ile Lys Gly Val Val Thr Asp Glu Gln Gly Ile Pro Ile Ala Asn Ala

910 915 920

acc atc tct gtg agt ggc att aat cac ggc gtg aag aca gcc agt ggt 2956

Thr Ile Ser Val Ser Gly Ile Asn His Gly Val Lys Thr Ala Ser Gly

925 930 935

ggt gat tac tgg cga atc ttg aac ccg ggt gag tac cgc gtg aca gcc 3004

Gly Asp Tyr Trp Arg Ile Leu Asn Pro Gly Glu Tyr Arg Val Thr Ala

940 945 950 955

cac gcg gag ggc tac acc ccg agc gcc aag acc tgc aat gtt gac tat 3052

His Ala Glu Gly Tyr Thr Pro Ser Ala Lys Thr Cys Asn Val Asp Tyr

960 965 970

gac atc ggg gcc act cag tgc aac ttc atc ctg gct cgc tcc aac tgg 3100

Asp Ile Gly Ala Thr Gln Cys Asn Phe Ile Leu Ala Arg Ser Asn Trp

975 980 985

aag cgc atc cgg gag atc atg gcc atg aac ggg aac cgg cct atc cca 3148

Lys Arg Ile Arg Glu Ile Met Ala Met Asn Gly Asn Arg Pro Ile Pro

990 995 1000

cac ata gac cca tcg cgc cct atg acc ccc caa cag cga cgc ctg cag 3196

His Ile Asp Pro Ser Arg Pro Met Thr Pro Gln Gln Arg Arg Leu Gln

1005 1010 1015

cag cga cgc cta caa cac cgc ctg cgg ctt cgg gca cag atg cgg ctg 3244

Gln Arg Arg Leu Gln His Arg Leu Arg Leu Arg Ala Gln Met Arg Leu

1020 1025 1030 1035

cgg cgc ctc aac gcc acc acc acc cta ggc ccc cac act gtg cct ccc 3292

Arg Arg Leu Asn Ala Thr Thr Thr Leu Gly Pro His Thr Val Pro Pro

1040 1045 1050

acg ctg ccc cct gcc cct gcc acc acc ctg agc act acc ata gag ccc 3340

Thr Leu Pro Pro Ala Pro Ala Thr Thr Leu Ser Thr Thr Ile Glu Pro

1055 1060 1065

tgg ggc ctc ata ccg cca acc acc gct ggc tgg gag gag tcg gag act 3388

Trp Gly Leu Ile Pro Pro Thr Thr Ala Gly Trp Glu Glu Ser Glu Thr

1070 1075 1080

gag acc tac aca gag gtg gtg aca gag ttt ggg acc gag gtg gag ccc 3436

Glu Thr Tyr Thr Glu Val Val Thr Glu Phe Gly Thr Glu Val Glu Pro

1085 1090 1095

gag ttt ggg acc aag gtg gag ccc gag ttt gag acc cag ttg gag cct 3484

Glu Phe Gly Thr Lys Val Glu Pro Glu Phe Glu Thr Gln Leu Glu Pro

1100 1105 1110 1115

gag ttc gag acc cag ctg gaa ccc gag ttt gag gaa gag gag gag gag 3532

Glu Phe Glu Thr Gln Leu Glu Pro Glu Phe Glu Glu Glu Glu Glu Glu

1120 1125 1130

gag aaa gag gag gag ata gcc act ggc cag gca ttc ccc ttc aca aca 3580

Glu Lys Glu Glu Glu Ile Ala Thr Gly Gln Ala Phe Pro Phe Thr Thr

1135 1140 1145

gta gag acc tac aca gtg aac ttt ggg gac ttc tgagatcagc gtcctaccaa 3633

Val Glu Thr Tyr Thr Val Asn Phe Gly Asp Phe

1150 1155

gaccccagcc caactcaagc tacagcagca gcacttccca agcctgctga ccacagtcac 3693

atcacccatc agcacatgga aggcccctgg tatggacact gaaaggaagg gctggtcctg 3753

cccctttgag ggggtgcaaa catgactggg acctaagagc cagaggctgt gtagaggctc 3813

ctgctccacc tgccagtctc gtaagagatg gggttgctgc agtgttggag taggggcaga 3873

gggagggagc caaggtcact ccaataaaac aagctcatgg caaaaaaaaa aaaaaaaaaa 3933

aa 3935

2

1158