Nucleic acid isolation

Preparation of a Nipam-based Polymer

Three polymerization techniques were used for the preparation of this polymer:

1) batch polymerization (or closed reactor process);

2) semicontinuous polymerization and 3) polymerization on a seed. In each of these techniques, the following same reagents were used:

First monomer: N-isopropylacrylamide (NIPAM) marketed by Kodak,

Cross-linking agent: N,N-methylenebisacrylamide (MBA) available from Aldrich,

Initiator: 2,2′-azobisamidinopropane chloride (V50) marketed by Wako,

Salt to adjust the ionic strength: NaCl (Prolabo),

Functional, second monomer: 2-aminoethylmethacrylate chloride (AEM) marketed by Kodak.

1) Batch Polymerization

The first monomer (NIPAM), the functional, second monomer (AEM) and the cross-linking agent (MBA) are introduced together in a single step before the polymerization is initiated by the addition of the initiator (V50) which decomposes under the effect of heat, producing free radicals. The duration of polymerization is 30 min.

The formulation of the polymer obtained, to which the reference PNIPAM42 has been given, is the following:

(a) Boiled and Degassed Water

The characteristic of the polymer obtained are presented in the following Table I:

2) Semicontinuous Polymerization

A portion of the functional, second monomer is introduced into the reactor over a period between the beginning of the polymerization and the end of the total conversion thereof. This addition can be carried out at a constant speed of injection (polymerization by continuous addition) or alternatively according to a well-controlled addition at regular intervals (semicontinuous polymerization). The aim of this method of polymerization is to increase the incorporation of functional, second monomer (charged) without increasing the percentage of water-soluble polymer in the reaction medium which could disrupt the progress of the polymerization.

The formulation of the polymer obtained, to which the reference PNIPAM45 was given, is the following:

(a) boiled and degassed water

The characteristic of the polymer PNIPAM45 obtained are presented in the following Table II:

3) Polymerization on a Seed

This technique consists in introducing the functional, second monomer into a reaction medium containing a previously prepared and perfectly characterized polymer. The functional, second monomer can be added alone or mixed with the monomer(s) or comonomers, in one step or semicontinuously.

The formulation of the polymer obtained, to which the reference PNIPAM94 was given, is the following:

a volume of 40 ml of seed with a solid level of 4.5% is used. The reagents were added diluted in a volume of 5 ml of water. The molar percentages of NIPAM, MBA and V50 added in the second step are identical to those of the seed (cf 1)). On the other hand, the concentration of functional second monomer is controlled (increased or decreased according to the desired charge density); in this case 10% (mol) of AEM is added relative to the first monomer NIPAM.

The characteristics of the polymer PNIPAM94, obtained after reinoculation using the seed registered under the reference PNIPAM93, synthesized according to the procedure described in 1), are presented in the following Table III:

At the end of polymerization, the particles are collected simply by centrifugation and redispersed in water or in a desired medium.

The characteristics of the polymer obtained according to any one of techniques 1) to 3) are the following:

charge density (cationic) between 5 and 150 μmol/g of polymer

particle size range between 0.05 and 2 μm, particle diameter measured by dynamic diffusion of light at 20° C.

range of critical concentration for coagulation (CCC) between 0.001 and 1.5 mol/l NaCl at 20° C. and between 0.01 and 0.9 mol/l NaCl at 40° C.

Adsorption of RNA or of BSA (Bovine Serum Albumin) on Particles of PNIPAN Polymer as Prepared According to Example 1

The following protocol constitutes the general procedure for the adsorption reactions:

The reaction mixture consists of 10 μl of RNA (4 mg/ml) or of 50 μl of BSA (5 mg/ml), and of 50 μl of NIPAM particles (45 g/l). The final volume of one milliliter is obtained by adding phosphate buffer (10 mM pH 4.6 or 9.2) and NaCl (5 M) so as to reach the desired ionic strength and pH.

The molecular entity (RNA or BSA) is adsorbed onto the particles over 2 hours (at 20 or 40° C.) with predetermined conditions (pH, ionic strength): the mixture is centrifuged for 20 minutes at 14,000 revolutions per minute. The supernatant is recovered, filtered on Millipore filter MILLEX-GV13 (0.22 μm) in order to remove the polymer particles in suspension. The quantity of the biological entity attached to the polymer support is determined by a simple difference between the quantity initially introduced and the remaining and free quantity (assayed in the supernatant): this quantity is expressed in milligram of biological molecules per milligram of polymer (Ns). The concentrations of RNA or of BSA are estimated by UV spectrophotometry (Kontron Instrument) at a wavelength of 260 nm or 280 nm, respectively.

The trials were carried out with E. coli 16S and 23S ribosomal RNA (Boerhinger) and BSA (Sigma reference A0281) used without prior purification.

The particles used are heat-sensitive particles of PNIPAM94. These particles are very hydrophilic at room temperature and hydrophobic at a temperature greater than the LCST (32° C.). They were synthesized as described in Example 1.

Acid phosphate (KH 2 PO 4 10 mM pH 4.6)) and basic phosphate (K 2 HPO 4 10 mM pH 9.2) buffers were used for the adsorption reactions and to control the pH of the reactions.

NaCl (5 M) was used to control the ionic strength of the reactions.

The water used in all the reactions was purified on the MILLIPOR-MILLE Q purification system.

The incubations were performed on a THERMOMIXER (Eppendorf 5436).

All the reactions were carried out in 1.5 ml Eppendorf tubes.

1) Study of the Influence of the pH and of the Temperature on the Adsorption

In accordance with FIG. 2, a better adsorption of the RNA is observed at acidic pH than at basic pH. At acidic pH, the particles are widely positively charged and the negatively charged nucleic acids attach to the particles via electrostatic forces. The attachment is greater at 20° C. than at 40° C. The results at 40° C. illustrate a decrease in the adsorption.

In accordance with FIG. 3, at 40° C., the adsorption of BSA onto the particles is possible with no influence of the pH. At 20° C., no attachment of BSA is observed because of the hydrophilic character of the particles at this temperature.

2) Study of the Influence of Ionic Strength and of the Temperature on the Adsorption

In accordance with FIG. 4, the attractive electrostatic forces between the negatively charged RNAs and the positively charged polymer surface decrease with the increase in ionic strength with, as a consequence, a decrease in the attachment of the RNA.

Under the same experimental conditions, it was verified that the increase in the ionic strength does not promote the attachment of BSA onto the particles.

In conclusion, the nucleic acids are preferably adsorbed onto the particles at a temperature less than the LCST (20° C.), at a low ionic strength and at acidic pH. Under these conditions, the adsorption of the proteins (such as BSA) is not favored.

Desorption of RNA Adsorbed Onto Particles of PNIPAM Polymer

The reagents used are the same as those described in Example 2.

The following protocol constitutes the general procedure for the desorption reactions:

After an adsorption step performed as in Example 2, the desorption reaction is carried out after the centrifugation step at 14,000 revolutions per minute. The supernatant is removed and replaced with one milliliter of desorption buffer (phosphate (10 mM pH 4.6 or 9.2) and NaCl (5 M)) so as to obtain the desired pH and ionic strength. The desorption is performed for 2 hours at 20° C. or 40° C. The mixture is then centrifuged for 20 minutes at 14,000 revolutions per minute. The supernatant is recovered, filtered on MILLIPORE-MILLEX GV13 filter (0.22 μm) so as to remove the polymer particles in suspension. The quantity of RNA liberated is determined by UV spectrophotometry (Kontron Instrument) at a wavelength of 260 nm. The nucleic acid recovered is available for other analyses.

1) Study of the Influence of the pH and of the Temperature on the Desorption of the RNA

According to FIG. 5, the desorption of the nucleic acids at the basic pH is greater because of the loss of charge on the polymer; at acidic pH, the quantity of liberated nucleic acids is much lower because the particles are then highly positively charged.

In accordance with FIG. 6, as above, the desorption of the nucleic acids is promoted at basic pH. It is also promoted by the increase in temperature because for a temperature greater than the LCST (32° C.) the particles retract.

2) Study of the Influence of the Ionic Strength on the Desorption of the RNA

In accordance with FIG. 7, as the ionic strength increases, the attractive electrostatic interactions between the RNAs and the polymer surface decrease.

In conclusion, the desorption of the nucleic acids is preferably performed at 40° C., at a high ionic strength and a basic pH.

Moreover, the retracting property of the particles at 40° C. (temperature greater than the LCST) can be exploited for concentrating a nucleic acid solution. Indeed, after adsorption of the nucleic acids and elevation of the temperature above the LCST, the particles onto which the nucleic acids are adsorbed retract, thus occupying a smaller volume than in the relaxed state and allowing the particles to be taken up, after centrifugation, in a smaller final volume.

Adsorption and Desorption of DNA From a Mixed DNA and BSA Solution Using the NIPAM Particles

The solution of Staphylococcus epidermidis DNA is extracted and purified from colonies isolated from bacteria, according to the protocol described by D. Treco in Short Protocols in Molecular Biology Second Edition Ed : Harvard Medical School, 1992, pp. 2-4/2-7.

A 10% (w/v) BSA (bovine serum albumin) solution (Intergen 3210-01) in MILLIQ water is used.

PCR protocol: the PCR technique followed is that described by Goodman in PCR Strategies Ed: Innis, Gelfand and Sninsky Academic Press 1995, pp. 17-31. Two amplification primerrs were used; they have the following sequences:

Primerr 1: 5′ ATCTTGACATCCTCTGACC 3′--->SEQ ID N01

Primerr 2: 5′ TCGACGGCTAGCTCCAAAT 3′--->SEQ ID N02

The following temperature cycles were used during the amplification protocol:

10 μl of amplification product are deposited on 0.8% agarose gel (FMC 50003) previously stained with ethidium bromide. After electrophoretic migration for 45 minutes at 180 V, the nucleic acid bands are visualized under ultraviolet radiation (D. Voytas in Short Protocols in Molecular Biology Second Edition Ed: Harvard Medical School, 1992, pp. 2-13/2-14).

1) Adsorption and Desorption of DNA on Particles and Detection After PCR Technique of the DNA Liberated

A DNA solution (10 10 copies/ml) was adsorbed onto the particles at 20° C., pH 4.6 for two hours and then subjected to a 15 minute desorption step at 41° C., pH 8.3, ionic strength 0.05 M as described in Examples 2 and 3, respectively. After the desorption step and centrifugation, the material recovered in 50 μl of supernatant was amplified by PCR and analyzed on a 0.8% agarose gel. A band of the expected size (490 pb) is detected on the gel. Moreover, the quantity of DNA detected after PCR is at least equivalent to that detected after PCR amplification of 10 6 copies/ml of DNA not previously adsorbed onto the particles.

The particles of NIPAM94 can therefore also be used to adsorb DNA. After desorption, the DNA can be used in a PCR-type amplification reaction.

2) Adsorption of DNA from a Mixed DNA and BSA Solution, and Detection After PCR Technique of the DNA Liberated by Desorption

A DNA solution (10 10 copies/ml) in the presence of 10% (w/v) of BSA is subjected to an adsorption and desorption step as described in Example 4-1. The same amplification and detection techniques are used. A DNA of expected size (490 pb) is detected on a gel. The intensity of the DNA band visualized is the same in the presence of or in the absence of BSA.

The particles of NIPAM94 make it possible to adsorb and liberate by desorption DNA derived from a mixed DNA—10% BSA solution. The presence of BSA in the initial solution does not disrupt the adsorption of the DNA onto the particles.

Purification of Nucleic Acids Derived from a Bacterial Lysate ( Staphylococcus epidermidis ) Using the Particles of NIPAM

1) Preparation of the Bacterial Lysate

A culture of Staphylococcus epidermidis is formed overnight at 37° C. The number of bacteria contained in the suspension is estimated by measuring the optic density at 550 nm. Bacterial pellets, containing respectively 2.10 6 , 2.10 4 and 2.10 1 bacteria, are prepared in 1.5 ml tubes by centrifugation for 3 minutes at 14,000 revolutions. The supernatant is removed and the bacterial pellet is lysed according to the technique described below (adaptation of Arora et al., J. Dairy Sci. 1990, 73, 264-273).

The pellet is taken up in 1 ml of buffer (30 mM Tris, 100 mM NaCl, 5 mM EDTA, pH 7.2) containing 6 mg/ml of proteinase K (Boehringer) and 300 μl of glass beads. This mixture is stirred on a vortex and incubated for 15 minutes at 37° C. After a centrifugation step (3 minutes at 14,000 revolutions), the supernatant containing the nucleic acids, is recovered for the subsequent stages.

2) Purification of the Nucleic Acids

The particles used are heat-sensitive particles of PNIPAM94 whose synthesis is described in Example 1.

The following protocol constitutes the general procedure for the purification reactions.

The reaction mixture consists of 50 μl of bacterial lysate, containing respectively 10 5 , 10 3 and 10 6 bacteria, and 2 mg of particles. The final volume of one milliliter is obtained by adjusting the reaction volume with phosphate buffer (10 mM, pH /4.6). The reaction is incubated for 30 minutes on a THERMOMIXER (Eppendorf 5436) at 20° C. After a centrifugation step of 20 minutes at 14,000 revolutions per minute, the supernatant is removed. The desorption of the nucleic acids, attached to the particles, is performed by the effect of the ionic strength by adding 50 μl of elution buffer (0.5 M KCl, pH 8.3); the reaction is incubated for 15 minutes at 42° C. on the thermomixer. After another centrifugation step of 20 minutes, at 14,000 revolutions per minute, the supernatant containing the nucleic acids is recovered; 10 μl are used for a DNA amplification step (PCR) and 5 μl for an RNA amplification step (NASBA).

3) Detection of the Nucleic Acids

The purified nucleic acids are analyzed after an enzymatic amplification step (PCR for DNA and NASSA for RNA). The amplification products are then revealed by the ELOSA (Enzyme Linked Oligo Sorbent Assay), microplate (NASBA) or VIDAS (PCR) techniques.

PCR protocol: The protocol followed is the same as that described in Example 4. The amplification products (90 μl) are analyzed on an automatic VIDAS immunoanalysis machine (bioMérieux) in accordance with the protocol described by Mabilat et al., J. Clin. Microbiol; 1994, 32, 2702-2705, the capture and detection probes being the following:

capture probe:

5′ ACCACCTGTCACTCTGTCCC 3′ SEQ ID NO: 3

detection probe:

5′ GGAAGGGGAAAACTCTATCTC 3′ SEQ ID NO: 4

The detection probe is conjugated with alkaline phosphatase.

NASBA protocol: The protocol followed is the same as that described by Kievits et al., J. Virol. Methods (1991) 35, 273-286. The primerrs used have the following sequences:

primer 1:

5′ TCGAAGCAACGCGAAGAACCTTACCA 3′ SEQ ID NO: 5

primerr 2:

5′ AATTCTAATA CGACTCACTA TAGGGAGGTT TGTCACCGGC AGTCAACTTAGA 3′ SEQ ID NO: 6

The amplification products (5 μl) are analyzed with an Elosa technique in microplate format in accordance with the protocol described by Mallet et al., J. Clin. Microbiol. (1993) 31, 1444-1449. The capture and detection probes have the following sequences:

capture probe:

5′ GATAGAGTTTTCCCCTTC 3′ SEQ ID NO: 7

detection probe:

5′ GACATCCTCTGACCCCTCTA 3′ SEQ ID NO: 8

The detection probe is conjugated with horseradish peroxidase.

Proteinase K being a known inhibitor of amplification reactions, 1/10 serial dilutions are carried out before the amplification steps in order to quantify the degree of purification obtained.

The results obtained are assembled in Table IV in the annex.

The inhibitory power of proteinase K is checked since it is necessary to dilute the sample 1/1000 before the amplification step. After the purification step, the sample is now diluted only 1/10 before the amplification step, which represents a gain of a factor of 100. The particles make it possible to purify conjointly the RNA and the DNA present in the sample. These nucleic acids are compatible with the enzymatic amplification steps.

Purification of Nucleic Acids Derived from a Bacterial Lysate ( Staphylococcus epidermidis ) Using the Polymer NIPAM Grafted on a Magnetic Core

The particles described in the preceding examples have the disadvantage of requiring centrifugation steps after the adsorption and desorption steps. These steps are long (twice 20 minutes) and are automatible with difficulty. A possible alternative is to graft the Nipam polymer onto cationic magnetic supports. One of the supports tested is the cationic magnetic latex R95-07 (ESTAPOR, Rhône-Poulenc) whose particles are polydisperse.

The purification capacity of particles thus obtained was tested.

1) Synthesis of the Magnetic Particles of Nipam

The cationic ESTAPOR particles R95-07 were encapsulated. Before each encapsulation, the particles were washed three times with a 0.005 M hydrochloric acid solution.

1 g of seed particles is diluted in 40 ml of MILLIQ water previously heated to boiling temperature and degassed with nitrogen.

100 μg of styrene for the presoiling step (time 2 h at 70° C.), NIPAM, BAM and MAE are solubilized in 10 ml of water and introduced onto the seed (ESTAPOR latex). The initiator, solubilized in 1 ml of water, is added so as to allow the polymerization around the seed particles. The polymerization is performed under a nitrogen atmosphere at 70° C.

These particles then carry a charge of 220 and 82 μmol of NH 2 /g of particles without modifying the size distribution of the particles.

2) Purification of the Nucleic Acids

The protocol used is the same as that described in Example 5 with the following modifications.

200 μg of particles were used,

the centrifugation steps, to separate the particles from the supernatants, are eliminated and replaced by separation steps under the effect of a magnetic field (magnetic separation device, Promega Z5342).

All the other steps remain unchanged.

The results are assembled in Table V in the annex.

The inhibitory power of proteinase K is again observed since it is necessary to dilute the sample 1/1000 before the amplification step. After the purification step, the sample can be diluted 1/10 (PCR) or 1/100 (NASBA) before the purification step, which represents a gain of a factor of 10 to 100. These particles also make it possible to purify conjointly the RNA and the DNA present in the sample. These nucleic acids are compatible with the enzymatic amplification steps.