Modified compounds and uses thereof

The present application is being filed along with a Sequence Listing in electronic format. The Sequence Listing is provided as a file entitled CORE0148USASEQ_ST25.txt created Aug. 4, 2020, which is 368 kb in size. The information in the electronic format of the sequence listing is incorporated herein by reference in its entirety.

The present disclosure provides oligomeric compounds comprising a modified oligonucleotide having a central region comprising one or more modifications. In certain embodiments, the present disclosure provides oligomeric compounds having an improved therapeutic index or an increased maximum tolerated dose.

The principle behind antisense technology is that an antisense compound hybridizes to a target nucleic acid and modulates the amount, activity, and/or function of the target nucleic acid. For example, in certain instances, antisense compounds result in altered transcription or translation of a target. Such modulation of expression can be achieved by, for example, target RNA degradation or occupancy-based inhibition. An example of modulation of RNA target function by degradation is RNase H-based degradation of the target RNA upon hybridization with a DNA-like antisense compound. Another example of modulation of gene expression by target degradation is RNA interference (RNAi). RNAi refers to antisense-mediated gene silencing through a mechanism that utilizes the RNA-induced silencing complex (RISC). An additional example of modulation of RNA target function is by an occupancy-based mechanism such as is employed naturally by microRNA. MicroRNAs are small non-coding RNAs that regulate the expression of protein-coding RNAs. The binding of an antisense compound to a microRNA prevents that microRNA from binding to its messenger RNA targets, and thus interferes with the function of the microRNA. MicroRNA mimics can enhance native microRNA function. Certain antisense compounds alter splicing of pre-mRNA. Regardless of the specific mechanism, sequence-specificity makes antisense compounds attractive as tools for target validation and gene functionalization, as well as therapeutics to selectively modulate the expression of genes involved in the pathogenesis of disease.

Antisense technology is an effective means for modulating the expression of one or more specific gene products and can therefore prove to be uniquely useful in a number of therapeutic, diagnostic, and research applications. Chemically modified nucleosides may be incorporated into antisense compounds to enhance one or more properties, such as nuclease resistance, pharmacokinetics, or affinity for a target nucleic acid.

The present disclosure provides oligomeric compounds and methods of using oligomeric compounds that comprise a modified oligonucleotide consisting of 14-23 linked nucleosides, wherein the modified oligonucleotide comprises a gapmer consisting of a 5′-region, a central region, and a 3′-region wherein:

the 5′-region consists of 2-5 linked modified nucleosides, wherein each nucleoside of the 5′-region comprises a 2′-modified furanosyl sugar moiety; the 3′-region consists of 1-5 linked modified nucleosides, wherein each nucleoside of the 3′-region comprises a 2′-modified furanosyl sugar moiety; the central region consists of 7-10 linked nucleosides, where each nucleoside of the central region comprises a sugar moiety selected from an unmodified 2′-β-D-deoxyribosyl sugar moiety and a modified sugar moiety; wherein the 3′- and 5′-most nucleosides of the central region each comprise a sugar moiety independently selected from a 2′-deoxyfuranosyl sugar moiety or a sugar surrogate; and wherein the central region comprises:

at least one altered nucleotide, comprising a modified internucleoside linkage other than phosphorothioate and/or a modified nucleobase other than 5-methylcytosine and/or a modified sugar moiety; and at least 6 nucleosides each comprising an unmodified 2′-β-D-deoxyribosyl sugar moiety.

In certain embodiments, oligomeric compounds are provided comprising a single conjugate group linked to the 5′-end. In certain embodiments, oligomeric compounds are provided comprising a single conjugate group linked to the 3′-end.

In certain embodiments, the oligomeric compounds provided herein have an increased maximum tolerated dose when administered to an animal compared to an otherwise identical oligomeric compound except that the otherwise identical oligomeric compound lacks the altered nucleotide in the central region.

In certain embodiments, the oligomeric compounds provided herein have an increased therapeutic index compared to an otherwise identical oligomeric compound except that the otherwise identical oligomeric compound lacks the altered nucleotide in the central region.

In certain embodiments, methods of inhibiting target RNA are provided comprising contacting one or more cells, a tissue or an animal with an oligomeric compound as provided herein wherein said oligomeric compound is complementary to a target RNA.

In certain embodiments, the cells are in a human. In certain embodiments, the target RNA is human RNA. In certain embodiments, the target is human mRNA. In certain embodiments, the target RNA is cleaved, thereby inhibiting its function.

In certain embodiments, in vitro methods of inhibiting gene expression are provided comprising contacting one or more cells or a tissue with an oligomeric compound as provided herein.

In certain embodiments, oligomeric compounds are provided for use in an in vivo method of inhibiting gene expression wherein the method comprises contacting one or more cells, a tissue or an animal with an oligomeric compound as provided herein.

In certain embodiments, oligomeric compounds are provided for use in medical therapy.

It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the embodiments, as claimed. Herein, the use of the singular includes the plural unless specifically stated otherwise. As used herein, the use of “or” means “and/or” unless stated otherwise. Furthermore, the use of the term “including” as well as other forms, such as “includes” and “included”, is not limiting.

The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. All documents, or portions of documents, cited in this application, including, but not limited to, patents, patent applications, articles, books, treatises, and GenBank and NCBI reference sequence records are hereby expressly incorporated by reference for the portions of the document discussed herein, as well as in their entirety.

It is understood that the sequence set forth in each SEQ ID NO contained herein is independent of any modification to a sugar moiety, an internucleoside linkage, or a nucleobase. As such, compounds defined by a SEQ ID NO may comprise, independently, one or more modifications to a sugar moiety, an internucleoside linkage, or a nucleobase. Although the sequence listing accompanying this filing identifies each sequence as either “RNA” or “DNA” as required, in reality, those sequences may be modified with any combination of chemical modifications. One of skill in the art will readily appreciate that such designation as “RNA” or “DNA” to describe modified oligonucleotides is, in certain instances, arbitrary. For example, an oligonucleotide comprising a nucleoside comprising a 2′-OH(H) sugar moiety and a thymine base could be described as a DNA having a modified sugar (2′-OH in place of one 2′-H of DNA) or as an RNA having a modified base (thymine (methylated uracil) in place of an uracil of RNA). Accordingly, nucleic acid sequences provided herein, including, but not limited to those in the sequence listing, are intended to encompass nucleic acids containing any combination of natural or modified RNA and/or DNA, including, but not limited to such nucleic acids having modified nucleobases. By way of further example and without limitation, an oligomeric compound having the nucleobase sequence “ATCGATCG” encompasses any oligomeric compounds having such nucleobase sequence, whether modified or unmodified, including, but not limited to, such compounds comprising RNA bases, such as those having sequence “AUCGAUCG” and those having some DNA bases and some RNA bases such as “AUCGATCG” and oligomeric compounds having other modified nucleobases, such as “AT m CGAUCG,” wherein m C indicates a cytosine base comprising a methyl group at the 5-position.

As used herein, “2′-deoxyfuranosyl sugar moiety” or “2′-deoxyfuranosyl sugar” means a furanosyl sugar moiety having two hydrogens at the 2′-position. 2′-deoxyfuranosyl sugar moieties may be unmodified or modified and may be substituted at positions other than the 2′-position or unsubstituted. A β-D-2′-deoxyribosyl sugar moiety or 2′-O-D-deoxyribosyl sugar moiety in the context of an oligonucleotide is an unsubstituted, unmodified 2′-deoxyfuranosyl and is found in naturally occurring deoxyribonucleic acids (DNA).

As used herein, “2′-modified” in reference to a furanosyl sugar moiety or nucleoside comprising a furanosyl sugar moiety means the furanosyl sugar moiety comprises a substituent other than H or OH at the 2′-position of the furanosyl sugar moiety. 2′-modified furanosyl sugar moieties include non-bicyclic and bicyclic sugar moieties and may comprise, but are not required to comprise, additional substituents at other positions of the furanosyl sugar moiety.

As used herein, “2′-ribo-F” indicates a 2′-fluororibose.

As used herein, “2′-substituted” in reference to a furanosyl sugar moiety or nucleoside comprising a furanosyl sugar moiety means the furanosyl sugar moiety or nucleoside comprising the furanosyl sugar moiety comprises a substituent other than H or OH at the 2′-position and is a non-bicyclic furanosyl sugar moiety. 2′-substituted furanosyl sugar moieties do not comprise additional substituents at other positions of the furanosyl sugar moiety other than a nucleobase and/or internucleoside linkage(s) when in the context of an oligonucleotide.

As used herein, “4′-modified” in reference to a furanosyl sugar moiety or nucleoside comprising a furanosyl sugar moiety means the furanosyl sugar moiety comprises a substituent other than H at the 4′-position of the furanosyl sugar moiety. 4′-modified furanosyl sugar moieties include non-bicyclic and bicyclic sugar moieties and may but are not required to comprise additional substituents at other positions of the furanosyl sugar moiety.

As used herein, “4′-substituted” in reference to a furanosyl sugar moiety or nucleoside comprising a furanosyl sugar moiety means the furanosyl sugar moiety or nucleoside comprising the furanosyl sugar moiety comprises a substituent other than H at the 4′-position and is a non-bicyclic furanosyl sugar moiety. 4′-substituted furanosyl sugar moieties do not comprise additional substituents at other positions of the furanosyl sugar moiety other than a nucleobase and/or internucleoside linkage(s) when in the context of an oligonucleotide.

As used herein, “5′-modified” in reference to a furanosyl sugar moiety or nucleoside comprising a furanosyl sugar moiety means the furanosyl sugar moiety comprises a substituent other than H at the 5′-position of the furanosyl sugar moiety. 5′-modified furanosyl sugar moieties may but are not required to comprise additional substituents at other positions of the furanosyl sugar moiety.

As used herein, “5′-substituted” in reference to a furanosyl sugar moiety or nucleoside comprising a furanosyl sugar moiety means the furanosyl sugar moiety or nucleoside comprising the furanosyl sugar moiety comprises a substituent other than H at the 5′-position and is a non-bicyclic furanosyl sugar moiety. 5′-substituted furanosyl sugar moieties do not comprise additional substituents at other positions of the furanosyl sugar moiety other than a nucleobase and/or internucleoside linkage(s) when in the context of an oligonucleotide.

As used herein, “administration” or “administering” refers to routes of introducing a compound or composition provided herein to a subject to perform its intended function. Examples of routes of administration that can be used include, but are not limited to, administration by inhalation, subcutaneous injection, intrathecal injection, and oral administration.

As used herein, “administered concomitantly” or “co-administration” means administration of two or more compounds in any manner in which the pharmacological effects of both are manifest in the patient. Concomitant administration does not require that both compounds be administered in a single pharmaceutical composition, in the same dosage form, by the same route of administration, or at the same time. The effects of both compounds need not manifest themselves at the same time. The effects need only be overlapping for a period of time and need not be coextensive. Concomitant administration or co-administration encompasses administration in parallel, sequentially, separate, or simultaneous administration.

As used herein, “ALT” means alanine aminotransferase. As used herein, “AST” means aspartate transaminase. In certain embodiments, plasma levels of ALT and AST in a subject are measured in units per liter. As used herein, “units per liter” in the context of plasma ALT or plasma AST levels means international units per liter, the standard units for measurement of plasma ALT or plasma AST levels used by those of ordinary skill in the medical arts.

As used herein, “animal” refers to a human or non-human animal, including, but not limited to, mice, rats, rabbits, dogs, cats, pigs, and non-human primates, including, but not limited to, monkeys and chimpanzees.

As used herein, “antisense activity” means any detectable and/or measurable change attributable to the hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid or protein encoded by such target nucleic acid compared to target nucleic acid levels or target protein levels in the absence of the antisense compound.

As used herein, “antisense compound” means a compound comprising an antisense oligonucleotide and optionally one or more additional features, such as a conjugate group or terminal group.

As used herein, “antisense oligonucleotide” means an oligonucleotide having a nucleobase sequence that is at least partially complementary to a target nucleic acid.

As used herein, “ameliorate” in reference to a treatment means improvement in at least one symptom relative to the same symptom in the absence of the treatment. In certain embodiments, amelioration is the reduction in the severity or frequency of a symptom or the delayed onset or slowing of progression in the severity or frequency of a symptom.

As used herein, “bicyclic nucleoside” or “BNA” means a nucleoside comprising a bicyclic sugar moiety. As used herein, “bicyclic sugar” or “bicyclic sugar moiety” means a modified sugar moiety comprising two rings, wherein the second ring is formed via a bridge connecting two of the atoms in the first ring thereby forming a bicyclic structure. In certain embodiments, the first ring of the bicyclic sugar moiety is a furanosyl moiety, and the bicyclic sugar moiety is a modified furanosyl sugar moiety. In certain embodiments, the bicyclic sugar moiety does not comprise a furanosyl moiety.

As used herein, a “central nervous system target” is a target RNA that is expressed in the central nervous system.

As used herein, “cEt” or “constrained ethyl” means a bicyclic sugar moiety, wherein the first ring of the bicyclic sugar moiety is a ribosyl sugar moiety, the second ring of the bicyclic sugar is formed via a bridge connecting the 4′-carbon and the 2′-carbon, the bridge has the formula 4′-CH(CH 3 )—O-2′, and the methyl group of the bridge is in the S configuration. A cEt bicyclic sugar moiety is in the β-D configuration.

As used herein, a “cEt nucleoside” or “cEt nucleotide” is a nucleoside or nucleotide comprising a cEt.

As used herein, “complementary” in reference to an oligonucleotide means that at least 70% of the nucleobases of such oligonucleotide or one or more regions thereof and the nucleobases of another nucleic acid or one or more regions thereof are capable of hydrogen bonding with one another when the nucleobase sequence of the oligonucleotide and the other nucleic acid are aligned in opposing directions. Complementary nucleobases are nucleobase pairs that are capable of forming hydrogen bonds with one another. Complementary nucleobase pairs include adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), 5-methyl cytosine ( m C) and guanine (G). Complementary oligonucleotides and/or nucleic acids need not have nucleobase complementarity at each nucleoside. Rather, some mismatches are tolerated. As used herein, “fully complementary” or “100% complementary” in reference to oligonucleotides means that such oligonucleotides are complementary to another oligonucleotide or nucleic acid at each nucleoside of the oligonucleotide.

As used herein, “conjugate group” means a group of atoms that is directly or indirectly attached to an oligonucleotide. Conjugate groups may comprise a conjugate moiety and a conjugate linker that attaches the conjugate moiety to the oligonucleotide.

As used herein, “conjugate linker” means a group of atoms comprising at least one bond that connects a conjugate moiety to an oligonucleotide.

As used herein, “conjugate moiety” means a group of atoms that is attached to an oligonucleotide via a conjugate linker.

As used herein, “contiguous” or “adjacent” in the context of an oligonucleotide refers to nucleosides, nucleobases, sugar moieties, or internucleoside linkages that are immediately adjacent to each other independent of the other moieties of the oligonucleotide. For example, “contiguous nucleobases” means nucleobases that are immediately adjacent to each other in a sequence. Moieties that are “directly linked” are immediately adjacent to each other and not separated by any other type of moiety.

As used herein, “cytotoxic” or “cytotoxicity” in the context of an effect of an oligomeric compound or a parent oligomeric compound on cultured cells means an at least 2-fold increase in caspase activation following administration of 10 μM or less of the oligomeric compound or parent oligomeric compound to the cultured cells relative to cells cultured under the same conditions but that are not administered the oligomeric compound or parent oligomeric compound. In certain embodiments, cytotoxicity is measured using a standard in vitro cytotoxicity assay.

As used herein, “double-stranded antisense compound” means an antisense compound comprising two oligomeric compounds that are complementary to each other and form a duplex, and wherein one of the two said oligomeric compounds comprises an antisense oligonucleotide.

As used herein, “effective amount” means the amount of compound sufficient to effectuate a desired physiological outcome in a subject in need of the compound. The effective amount may vary among subjects depending on the health and physical condition of the subject to be treated, the taxonomic group of the subjects to be treated, the formulation of the composition, assessment of the subject's medical condition, and other relevant factors.

As used herein, “efficacy” means the ability to produce a desired effect.

As used herein, “expression” includes all the functions by which a gene's coded information is converted into structures present and operating in a cell. Such structures include, but are not limited to, the products of transcription and translation. As used herein, “modulation of expression” means any change in amount or activity of a product of transcription or translation of a gene. Such a change may be an increase or a reduction of any amount relative to the expression level prior to the modulation.

As used herein, “gapmer” means an oligonucleotide having a central region comprising a plurality of nucleosides that support RNase H cleavage positioned between a 5′-region and a 3′-region. Herein, the nucleosides of the 5′-region and 3′-region each comprise a 2′-modified furanosyl sugar moiety, and the 3′- and 5′-most nucleosides of the central region each comprise a sugar moiety independently selected from a 2′-deoxyfuranosyl sugar moiety or a sugar surrogate. The positions of the central region refer to the order of the nucleosides of the central region and are counted starting from the 5′-end of the central region. Thus, the 5′-most nucleoside of the central region is at position 1 of the central region. The “central region” may be referred to as a “gap”, and the “5′-region” and “3′-region” may be referred to as “wings”.

As used herein, “hepatotoxic” in the context of a mouse means a plasma ALT level that is above 300 units per liter. Hepatotoxicity of an oligomeric compound or parent oligomeric compound that is administered to a mouse is determined by measuring the plasma ALT level of the mouse 24 hours to 2 weeks following at least one dose of 1-150 mg/kg of the compound.

As used herein, “hepatotoxic” in the context of a human means a plasma ALT level that is above 150 units per liter. Hepatotoxicity of an oligomeric compound or parent oligomeric compound that is administered to a human is determined by measuring the plasma ALT level of the human 24 hours to 2 weeks following at least one dose of 10-300 mg of the compound.

As used herein, “hybridization” means the pairing or annealing of complementary oligonucleotides and/or nucleic acids. While not limited to a particular mechanism, the most common mechanism of hybridization involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleobases.

As used herein, “inhibiting the expression or activity” refers to a reduction or blockade of the expression or activity relative to the expression or activity in an untreated or control sample and does not necessarily indicate a total elimination of expression or activity.

As used herein, the terms “internucleoside linkage” means a group or bond that forms a covalent linkage between adjacent nucleosides in an oligonucleotide. As used herein “modified internucleoside linkage” means any internucleoside linkage other than a naturally occurring, phosphodiester internucleoside linkage. “Phosphorothioate linkage” means a modified internucleoside linkage in which one of the non-bridging oxygen atoms of a phosphodiester is replaced with a sulfur atom. Modified internucleoside linkages may or may not contain a phosphorus atom. A “neutral internucleoside linkage” is a modified internucleoside linkage that does not have a negatively charged phosphate in a buffered aqueous solution at pH=7.0.

As used herein, “abasic nucleoside” means a sugar moiety in an oligonucleotide or oligomeric compound that is not directly connected to a nucleobase. In certain embodiments, an abasic nucleoside is adjacent to one or two nucleosides in an oligonucleotide.

As used herein, “LICA-1” is a conjugate group that is represented by the formula:

As used herein, “linker-nucleoside” means a nucleoside that links, either directly or indirectly, an oligonucleotide to a conjugate moiety. Linker-nucleosides are located within the conjugate linker of an oligomeric compound. Linker-nucleosides are not considered part of the oligonucleotide portion of an oligomeric compound even if they are contiguous with the oligonucleotide.

As used herein, “non-bicyclic sugar” or “non-bicyclic sugar moiety” means a sugar moiety that comprises fewer than 2 rings. Substituents of modified, non-bicyclic sugar moieties do not form a bridge between two atoms of the sugar moiety to form a second ring.

As used herein, “linked nucleosides” are nucleosides that are connected in a continuous sequence (i.e. no additional nucleosides are present between those that are linked).

As used herein, “liver target” is a target RNA expressed in the liver wherein modulation of the expression of the target RNA in the liver is desired for therapeutic benefit. In certain embodiments, a liver target is expressed in tissues other than the liver as well as in the liver. As used herein, modulation of the expression of a target RNA that is “not a liver target” is desired in a tissue that is not the liver for therapeutic benefit. In certain embodiments, a target RNA that is not a liver target is expressed in the liver and is modulated by an oligomeric compound in therapy.

As used herein, “mismatch” or “non-complementary” means a nucleobase of a first oligonucleotide that is not complementary with the corresponding nucleobase of a second oligonucleotide or target nucleic acid when the first and second oligomeric compound are aligned.

As used herein, “modulating” refers to changing or adjusting a feature in a cell, tissue, organ or organism.

As used herein, “MOE” means methoxyethyl. “2′-MOE” or “2′-O-methoxyethyl” means a 2′-OCH 2 CH 2 OCH 3 group at the 2′-position of a furanosyl ring. In certain embodiments, the 2′-OCH 2 CH 2 OCH 3 group is in place of the 2′-OH group of a ribosyl ring or in place of a 2′-H in a 2′-deoxyribosyl ring.

As used herein, “MOP” or “methoxypropyl internucleoside linkage” means the alkyl phosphonate internucleoside bond shown below:

As used herein, “motif” means the pattern of unmodified and/or modified sugar moieties, nucleobases, and/or internucleoside linkages, in an oligonucleotide.

As used herein, “naturally occurring” means found in nature.

As used herein, “nucleobase” means an unmodified nucleobase or a modified nucleobase. As used herein an “unmodified nucleobase” is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G). As used herein, a modified nucleobase is a group of atoms capable of pairing with at least one unmodified nucleobase. A universal base is a nucleobase that can pair with any one of the five unmodified nucleobases. 5-methylcytosine (NC) is one example of a modified nucleobase.

As used herein, “nucleobase sequence” means the order of contiguous nucleobases in a nucleic acid or oligonucleotide independent of any sugar moiety or internucleoside linkage modification.

As used herein, “nucleoside” means a moiety comprising a nucleobase and a sugar moiety. The nucleobase and sugar moiety are each, independently, unmodified or modified. As used herein, “modified nucleoside” means a nucleoside comprising a modified nucleobase and/or a modified sugar moiety.

As used herein, “oligomeric compound” means a compound consisting of an oligonucleotide and optionally one or more additional features, such as a conjugate group or terminal group.

As used herein, “oligonucleotide” means a strand of linked nucleosides connected via internucleoside linkages, wherein each nucleoside and internucleoside linkage may be modified or unmodified. Unless otherwise indicated, oligonucleotides consist of 8-50 linked nucleosides. As used herein, “modified oligonucleotide” means an oligonucleotide, wherein at least one nucleoside or internucleoside linkage is modified. As used herein, “unmodified oligonucleotide” means an oligonucleotide that does not comprise any nucleoside modifications or internucleoside modifications.

As used herein, “parent oligomeric compound” in the context of an oligomeric compound comprising at least one modification in the central region other than phosphorothioate or 5-methylcytosine means an oligomeric compound that is identical to the oligomeric compound comprising the at least one modification in the central region except that the parent oligomeric compound does not comprise at least one modified internucleoside linkage other than phosphorothioate and/or at least one modified nucleoside comprising a modified nucleobase other than 5-methylcytosine and/or a modified sugar moiety. A parent oligomeric compound and its counterpart oligomeric compound comprising at least one modification in the central region have identical nucleobase sequences or differ in nucleobase sequence only due to inclusion of a modified nucleobase other than 5-methylcytosine in the oligomeric compound comprising at least one modification in the central region.

As used herein, “pharmaceutically acceptable carrier or diluent” means any substance suitable for use in administering to an animal. Certain such carriers enable pharmaceutical compositions to be formulated as, for example, liquids, powders, or suspensions that can be aerosolized or otherwise dispersed for inhalation by a subject. In certain embodiments, a pharmaceutically acceptable carrier or diluent is sterile water; sterile saline; or sterile buffer solution.

As used herein “pharmaceutically acceptable salts” means physiologically and pharmaceutically acceptable salts of compounds, such as oligomeric compounds, i.e., salts that retain the desired biological activity of the compound and do not impart undesired toxicological effects thereto.

As used herein “pharmaceutical composition” means a mixture of substances suitable for administering to a subject. For example, a pharmaceutical composition may comprise an antisense compound and an aqueous solution.

As used herein, “RNAi compound” means an antisense compound that acts, at least in part, through RISC or Ago2 to modulate a target nucleic acid and/or protein encoded by a target nucleic acid. RNAi compounds include, but are not limited to double-stranded siRNA, single-stranded RNA (ssRNA), and microRNA, including microRNA mimics. In certain embodiments, an RNAi compound modulates the amount, activity, and/or splicing of a target nucleic acid. The term RNAi compound excludes antisense oligonucleotides that act through RNase H.

As used herein, the term “single-stranded” in reference to an antisense compound means such a compound consisting of one oligomeric compound that is not paired with a second oligomeric compound to form a duplex. “Self-complementary” in reference to an oligonucleotide means an oligonucleotide that at least partially hybridizes to itself. A compound consisting of one oligomeric compound, wherein the oligonucleotide of the oligomeric compound is self-complementary, is a single-stranded compound. A single-stranded antisense or oligomeric compound may be capable of binding to a complementary oligomeric compound to form a duplex, in which case the compound would no longer be single-stranded.

As used herein, “standard cell assay” means any of the assays described in Examples 1-9, and reasonable variations thereof.

As used herein, “standard in vitro activity assay” means a procedure, as described in Example 1 herein, wherein expression is measured by RT-PCR in cultured cells expressing the target RNA following administration of an oligomeric compound to the cultured cells.

As used herein, “standard in vitro cytotoxicity assay” means a procedure, as described in Example 8 herein, wherein activation of caspases 3 and 7 is measured in cultured 3T3-L1 cells following administration of an oligomeric compound to the cells.

As used herein, “standard in vivo experiment” means the procedure described in Example 10 and reasonable variations thereof.

As used herein, “stereorandom” in the context of a compound or moiety comprising a chiral center means the chiral center has a random stereochemical configuration. For example, in a population of molecules of identical formula comprising a stereorandom chiral center, the number of molecules having the (S) configuration of the stereorandom chiral center may be but is not necessarily the same as the number of molecules having the (R) configuration of the stereorandom chiral center. The stereochemical configuration of a chiral center is considered random when it is the result of a synthetic method that is not designed to control the stereochemical configuration.

As used herein, “subject” means a human or non-human animal selected for treatment or therapy.

As used herein, “sugar moiety” means an unmodified sugar moiety or a modified sugar moiety. As used herein, “unmodified sugar moiety” means a β-D-ribosyl moiety, as found in naturally occurring RNA, or a β-D-2′-deoxyribosyl sugar moiety as found in naturally occurring DNA. As used herein, “modified sugar moiety” or “modified sugar” means a sugar surrogate or a furanosyl sugar moiety other than a β-D-ribosyl or a β-D-2′-deoxyribosyl. Modified furanosyl sugar moieties may be modified or substituted at a certain position(s) of the sugar moiety, or unsubstituted, and they may or may not have a stereoconfiguration other than β-D-ribosyl. Modified furanosyl sugar moieties include bicyclic sugars and non-bicyclic sugars. As used herein, “sugar surrogate” means a modified sugar moiety that does not comprise a furanosyl or tetrahydrofuranyl ring (is not a “furanosyl sugar moiety”) and that can link a nucleobase to another group, such as an internucleoside linkage, conjugate group, or terminal group in an oligonucleotide. Modified nucleosides comprising sugar surrogates can be incorporated into one or more positions within an oligonucleotide and such oligonucleotides are capable of hybridizing to complementary oligomeric compounds or nucleic acids.

As used herein, “susceptible” in the context of a disease, disorder, condition, or symptom such as degeneration, damage, or elevated apoptosis means that a subject has a higher risk than the average risk for the general population for the disease, disorder, condition, or symptom.

As used herein, “target nucleic acid,” “target RNA,” “target RNA transcript” and “nucleic acid target” mean a nucleic acid that an oligomeric compound, such as an antisense compound, is designed to affect. In certain embodiments, an oligomeric compound comprises an oligonucleotide having a nucleobase sequence that is complementary to more than one RNA, only one of which is the target RNA of the oligomeric compound. In certain embodiments, the target RNA is an RNA present in the species to which an oligomeric compound is administered. As used herein, a “liver target” is a target RNA that is expressed in the liver, and modulation of expression of the target RNA in the liver provides a therapeutic effect. As used herein a “central nervous system target” is a target RNA that is expressed in the central nervous system, and modulation of expression of the target RNA in the central nervous system provides a therapeutic effect.

The present disclosure provides certain individual cellular, tissue, or organ targets. For example, a “macrophage target” or a “liver target.” For each such individual target, modulation of the expression of the target RNA in the individual cellular, tissue, or organ target is desired for therapeutic benefit. In certain embodiments, modulation of the target RNA in an individual cellular, tissue, or organ target provides a therapeutic effect. In certain embodiments, a cellular, tissue, or organ target is expressed in tissues other than in a particular type of cell, tissue, or organ as well as being expressed in a particular type of cell, tissue, or organ. For example, certain target RNAs may be expressed in both a macrophage and a hepatocyte.

As used herein, “therapeutically effective amount” means an amount of a compound, pharmaceutical agent, or composition that provides a therapeutic benefit to a subject.

As used herein, “treat” refers to administering a compound or pharmaceutical composition to an animal in order to effect an alteration or improvement of a disease, disorder, or condition in the animal.

As used herein, “maximum tolerated dose” means the highest dose of a compound that does not cause unacceptable side effects. In certain embodiments, the maximum tolerated dose is the highest dose of a modified oligonucleotide that does not cause an ALT elevation of three times the upper limit of normal as measured by a standard assay, e.g. the assay of Example 12 or Example 1. In certain embodiments, the maximum tolerated dose is the highest dose of a modified oligonucleotide that does not cause caspase elevation of greater than 30,000 RLU as measured by a standard assay, e.g. the assay of Example 13, Example 8, or Example 4.

As used herein, “DNA isomer” means a nucleoside that comprises a modified sugar moiety that is a stereoisomer of β-D-2′-deoxyribosyl. As used herein, a “DNA isomer” does not include β-D-2′-deoxyribosyl nucleosides. Seven such isomers of 2′-β-D-deoxyribosyl exist: 2H3-D-deoxyxylosyl β-DANA), 2′-α-D-deoxyribosyl (α-D-DNA), 2′-α-L-deoxyribosyl (α-L-DNA), 2′-β-L-deoxyribosyl (β-L-DNA), 2′-α-D-deoxyxylosyl (α-L-XNA), 1,2′-α-L-deoxyxylosyl (α-LANA), 2H3-L-deoxyxylosyl β-LANA). In certain embodiments, a DNA isomer is 2′-α-D-deoxyribosyl, 2′-α-L-deoxyribosyl, 2H3-L-deoxyribosyl, or 2′-β-D-deoxyxylosyl sugar moiety. As used herein, “DNA isomer” does not include any nonfuranosyl sugar moieties.

As used herein, “DNA nucleoside” means a nucleoside comprising a 2′-H(H) β-D-2′-deoxyribosyl sugar moiety, as found in naturally-occurring DNA. A “DNA nucleoside” may comprise a modified nucleobase or a uracil nucleobase. A DNA nucleoside may be linked to adjacent nucleosides through unmodified phosphodiester internucleoside linkages or through modified internucleoside linkages.

As used herein, a “2′-modified DNA isomer” means a nucleoside that comprises a modified sugar moiety that is selected from 2′-β-D-deoxyxylosyl β-DANA), 2′-α-D-deoxyribosyl (α-D-DNA), 2′-α-L-deoxyribosyl (α-L-DNA), 2H3-L-deoxyribosyl (β-L-DNA), 2′-α-D-deoxyxylosyl (α-LANA), 1, 2′-α-L-deoxyxylosyl (α-LANA), 2H3-L-deoxyxylosyl β-LANA), and that further comprises a 2′-substituent. In certain embodiments, the 2′-substituent is fluoro, alkoxy, or C 1 -C 10 alkyl.

As used herein, “DNA mimic” means a nucleoside other than a DNA nucleoside wherein the nucleobase is directly linked to a carbon atom of a ring bound to a second carbon atom within the ring, wherein the second carbon atom comprises a bond to at least one hydrogen atom, wherein the nucleobase and at least one hydrogen atom are trans to one another relative to the bond between the two carbon atoms. In certain embodiments, a DNA mimic comprises a structure represented by the formula:

wherein Bx is a heterocylic base moiety, the ring contains 5-7 members, and the ring is attached at two positions to a hydroxyl, a phosphate, an internucleoside linking group, or a conjugate linker.

As used herein, a “standard RNase H cleavage assay” is an assay wherein a heteroduplex of the modified oligonucleotide and a complementary strand of unmodified RNA are incubated with each other to form a heteroduplex, and are then incubated with RNase H1 for specified time points before being analyzed on a polyacrylamide gel.

As used herein, a modified nucleoside “supports RNase H cleavage” when incorporated into an oligonucleotide if RNase H cleavage of the complementary RNA is observed within two nucleobases of the modified nucleoside in a standard RNase H cleavage assay.

As used herein, “therapeutic index” means a comparison of the amount of a compound that causes a therapeutic effect to the amount that causes toxicity. Compounds having a high therapeutic index have strong efficacy and low toxicity. In certain embodiments, increasing the therapeutic index of a compound increases the amount of the compound that can be safely administered. In certain embodiments, therapeutic index is the ratio of the amount of modulation of a target nucleic acid by a modified oligonucleotide compared to ALT elevation, wherein the ALT elevation is measured by a standard assay, e.g. the assay of Example 12 or Example 1. In certain embodiments, therapeutic index is the ratio of the amount of modulation of a target nucleic acid by a modified oligonucleotide compared to caspase elevation, wherein the caspase elevation is measured by a standard assay, e.g. the assay of Example 13, Example 8, or Example 4.

As used herein, an “altered nucleotide” is a nucleotide that comprises one or more modifications relative to a nucleotide comprising a 2′-β-D-deoxyribosyl sugar moiety, a nucleobase selected from adenine (A), thymine (T), cytosine (C), 5-methyl cytosine ( m C), uracil (U), or guanine (G), and a 5′ to 3′ internucleoside linkage selected from phosphodiester or stereorandom phosphorothioate. In certain embodiments, the altered nucleotide is an altered nucleoside attached to a phosphorothioate or phosphodiester internucleoside linkage. In certain embodiments, the altered nucleotide comprises a 2′-modified sugar moiety, or is a “2′-altered nucleotide”. In certain embodiments, the altered nucleotide comprises a modified internucleoside linking group, and is a “linkage-altered nucleotide”. Herein, a linkage-altered nucleotide comprises an internucleoside linking group other than phosphodiester or phosphorothioate attached to the 3′ carbon of the sugar moiety, or the equivalent position for a sugar surrogate. The nucleotide on the 5′-end of an internucleoside linking group other than phosphodiester or phosphorothioate is not an “altered nucleotide”, as used herein.

Certain embodiments are described in the numbered embodiments below:

1. An oligomeric compound comprising a modified oligonucleotide consisting of 14-23 linked nucleosides, wherein the modified oligonucleotide comprises a gapmer consisting of a 5′-region, a central region, and a 3′-region wherein:

the 5′-region consists of 2-5 linked modified nucleosides, wherein each nucleoside of the 5′-region comprises a 2′-modified furanosyl sugar moiety; the 3′-region consists of 1-5 linked modified nucleosides, wherein each nucleoside of the 3′-region comprises a 2′-modified furanosyl sugar moiety; the central region consists of 7-10 linked nucleosides, where each nucleoside of the central region comprises a sugar moiety selected from an unmodified 2′β-D-deoxyribosyl sugar moiety and a modified sugar moiety; wherein the 3′- and 5′-most nucleosides of the central region each comprise a sugar moiety independently selected from a 2′-deoxyfuranosyl sugar moiety or a sugar surrogate; and wherein the central region comprises: at least one modified internucleoside linkage other than phosphorothioate and/or at least one modified nucleoside comprising a modified nucleobase other than 5-methylcytosine and/or a modified sugar moiety; and at least 6 nucleosides each comprising an unmodified 2′-β-D-deoxyribosyl sugar moiety.

2. The oligomeric compound of embodiment 1, wherein the 5′-region consists of 2-4 linked nucleosides.

3. The oligomeric compound of embodiment 1, wherein the 5′-region consists of 2 linked nucleosides.

4. The oligomeric compound of embodiment 1, wherein the 5′-region consists of 3 linked nucleosides.

5. The oligomeric compound of embodiment 1, wherein the 5′-region consists of 4 linked nucleosides.

6. The oligomeric compound of embodiment 1, wherein the 5′-region consists of 5 linked nucleosides.

7. The oligomeric compound of any of embodiments 1-6, wherein each nucleoside of the 5′-region comprises a 2′-modified ribosyl sugar moiety.

8. The oligomeric compound of any of embodiments 1-7, wherein at least one nucleoside of the 5′-region comprises a bicyclic furanosyl sugar moiety.

9. The oligomeric compound of any of embodiments 1-8, wherein each nucleoside of the 5′-region comprises a bicyclic furanosyl sugar moiety.

10. The oligomeric compound of any of embodiments 1-8, wherein at least one nucleoside of the 5′-region comprises a non-bicyclic sugar moiety.

11. The oligomeric compound of embodiment 10, wherein the non-bicyclic sugar moiety of the at least one nucleoside of the 5′-region is a 2′-substituted ribosyl sugar moiety.

12. The oligomeric compound of any of embodiments 1-7 or 10-11, wherein each nucleoside of the 5′-region comprises a non-bicyclic sugar moiety.

13. The oligomeric compound of embodiment 12, wherein each nucleoside of the 5′-region comprises a 2′-substituted ribosyl sugar moiety.

14. The oligomeric compound of any of embodiments 1-7, wherein each nucleoside of the 5′-region comprises a 2′-modified furanosyl sugar moiety independently selected from a bicyclic sugar moiety and a non-bicyclic sugar moiety, 2′-substituted ribosyl sugar moiety.

15. The oligomeric compound of any of embodiments 8-11 or 14, wherein each bicyclic sugar moiety of the 5′-region is selected from among cEt, LNA, and ENA.

16. The oligomeric compound of any of embodiments 10-14, wherein each nonbicyclic sugar moiety of the 5′-region has a 2′-substituent selected from among 2′-MOE, 2′-OMe, and 2′-NMA.

17. The oligomeric compound of any of embodiments 1-16, wherein none of the nucleosides of the 5′-region comprise a sugar moiety having a 2′-F substituent.

18. The oligomeric compound of any of embodiments 1-17, wherein each nucleobase of the 5′-region is independently selected from among thymine, uracil, guanine, cytosine, 5-methylcytosine, and adenine.

19. The oligomeric compound of any of embodiments 1-18, wherein each internucleoside linkage of the 5′-region is selected from among phosphodiester and phosophorothioate internucleoside linkages.

20. The oligomeric compound of any of embodiments 1-19, wherein the 3′-region consists of 2-4 linked nucleosides.

21. The oligomeric compound of any of embodiments 1-19, wherein the 3′-region consists of 1 nucleoside.

22. The oligomeric compound of any of embodiments 1-19, wherein the 3′-region consists of 2 linked nucleosides.

23. The oligomeric compound of any of embodiments 1-19, wherein the 3′-region consists of 3 linked nucleosides.

24. The oligomeric compound of any of embodiments 1-19, wherein the 3′-region consists of 4 linked nucleosides.

25. The oligomeric compound of any of embodiments 1-19, wherein the 3′-region consists of 5 linked nucleosides.

26. The oligomeric compound of any of embodiments 1-25, wherein each nucleoside of the 3′-region comprises a 2′-modified ribosyl sugar moiety.

27. The oligomeric compound of any of embodiments 1-26, wherein at least one nucleoside of the 3′-region comprises a bicyclic furanosyl sugar moiety.

28. The oligomeric compound of any of embodiments 1-27, wherein each nucleoside of the 3′-region comprises a bicyclic furanosyl sugar moiety.

29. The oligomeric compound of any of embodiments 1-27, wherein at least one nucleoside of the 3′-region comprises a non-bicyclic sugar moiety.

30. The oligomeric compound of embodiment 29, wherein the non-bicyclic sugar moiety of the at least one nucleoside of the 3′-region is a 2′-substituted ribosyl sugar moiety.

31. The oligomeric compound of any of embodiments 1-26 or 29-30, wherein each nucleoside of the 3′-region comprises a non-bicyclic sugar moiety.

32. The oligomeric compound of embodiment 31, wherein each nucleoside of the 3′-region comprises a 2′-substituted ribosyl sugar moiety.

33. The oligomeric compound of any of embodiments 1-26, wherein each nucleoside of the 3′-region comprises a 2′-modified furanosyl sugar moiety independently selected from a bicyclic sugar moiety and a non-bicyclic sugar moiety, 2′-substituted ribosyl sugar moiety.

34. The oligomeric compound of any of embodiments 27-30 or 33, wherein each bicyclic sugar moiety of the 3′-region is selected from among cEt, LNA, and ENA.

35. The oligomeric compound of any of embodiments 29-33, wherein each nonbicyclic sugar moiety of the 3′-region has a 2′-substituent selected from among 2′-MOE, 2′-OMe, and 2′-NMA.

36. The oligomeric compound of any of embodiments 1-35, wherein none of the nucleosides of the 3′-region comprise a sugar moiety having a 2′-F substituent.

37. The oligomeric compound of any of embodiments 1-36, wherein each nucleobase of the 3′-region is independently selected from among thymine, uracil, guanine, cytosine, 5-methylcytosine, and adenine.

38. The oligomeric compound of any of embodiments 1-37, wherein each internucleoside linkage of the 3′-region is selected from among phosphodiester and phosophorothioate internucleoside linkages.

39. The oligomeric compound of any of embodiments 1-38, wherein the central region consists of 7 linked nucleosides.

40. The oligomeric compound of any of embodiments 1-38, wherein the central region consists of 8 linked nucleosides.

41. The oligomeric compound of any of embodiments 1-38, wherein the central region consists of 9 linked nucleosides.

42. The oligomeric compound of any of embodiments 1-38, wherein the central region consists of 10 linked nucleosides.

43. The oligomeric compound of any of embodiments 1-42, wherein each of the two internucleoside linkages connecting the central region to the 5′-region and 3′-region are independently selected from among phosphosdiester and phosphorothioate internucleoside linkages.

44. The oligomeric compound of any of embodiments 1-43, wherein the modified oligonucleotide consists of the gapmer.

45. The oligomeric compound of any of embodiments 1-43, comprising a conjugate group.

46. The oligomeric compound of any of embodiments 1-43 or 45, wherein the modified oligonucleotide comprises 1-3 linker nucleosides.

47. The oligomeric compound of embodiment 46, wherein the linker nucleosides are linked to the 5′-end or the 3′-end of the gapmer.

48. The oligomeric compound of any of embodiments 45-47, wherein the conjugate group comprises GalNAc.

49. The oligomeric compound of any of embodiments 45-47, comprising LICA-1.

50. The oligomeric compound of any of embodiments 1-49, wherein the central region comprises one, and no more than one, modified sugar moiety.

51. The oligomeric compound of embodiment 50, wherein the each internucleoside linkage within the central region is selected from among phosphodiester and phosophorothioate internucleoside linkages.

52. The oligomeric compound of any of embodiments 50-51, wherein each nucleobase of the central region is independently selected from among thymine, uracil, guanine, cytosine, 5-methylcytosine, and adenine.

53. The oligomeric compound of any of embodiments 1-50 or 52, wherein the central region comprises one, and no more than one, modified internucleoside linkage other than phosphorothioate.

54. The oligomeric compound of embodiment 53, wherein the modified internucleoside linkage other than phosphorothioate contains phosphorus.

55. The oligomeric compound of any of embodiments 53-54, wherein the modified internucleoside linkage other than phosphorothioate is a neutral internucleoside linkage.

56. The oligomeric compound of any of embodiments 1-50 or 52, wherein the central region comprises two, and no more than two, modified internucleoside linkages other than phosphorothioate.

57. The oligomeric compound of embodiment 56, wherein the two modified internucleoside linkages other than phosphorothioate each contain phosphorus.

58. The oligomeric compound of any of embodiments 56-57, wherein at least one of the modified internucleoside linkages other than phosphorothioate is a neutral internucleoside linkage.

59. The oligomeric compound of any of embodiments 56-57, wherein the two modified internucleoside linkages other than phosphorothioate are neutral internucleoside linkages.

60. The oligomeric compound of any of embodiments 1-51 or 53-59, wherein the central region comprises one, and no more than one, modified nucleobase other than 5-methylcytosine.

61. The oligomeric compound of any of embodiments 1-60, wherein each of the unmodified sugar moieties of the central region are 2′-β-D-deoxyribosyl sugar moieties.

62. The oligomeric compound of any of embodiments 50-61, wherein the one modified sugar moiety of the central region is at one of positions 2-9 of the central region.

63. The oligomeric compound of any of embodiments 50-61, wherein the one modified sugar moiety of the central region is at one of positions 1-6 of the central region.

64. The oligomeric compound of any of embodiments 50-61, wherein the one modified sugar moiety of the central region is at one of positions 1˜4 of the central region.

65. The oligomeric compound of any of embodiments 50-61, wherein the one modified sugar moiety of the central region is at one of positions 2-4 of the central region.

66. The oligomeric compound of any of embodiments 50-61, wherein the one modified sugar moiety of the central region is at one of positions 3-4 of the central region.

67. The oligomeric compound of any of embodiments 50-66, wherein the one modified sugar moiety of the central region is a sugar surrogate, a bicyclic furanosyl sugar moiety, a non-bicyclic 2′-modified furanosyl sugar moiety, a non-bicyclic 4′-modified furanosyl sugar moiety, a non-bicyclic 5′-modified furanosyl sugar moiety, or a modified 2′-deoxyfuranosyl sugar moiety.

68. The oligomeric compound of embodiment 67, wherein the one modified sugar moiety of the central region is a bicyclic ribosyl sugar moiety, a non-bicyclic 2′-modified ribosyl sugar moiety, a non-bicyclic 4′-modified 2′-deoxyribosyl sugar moiety, a non-bicyclic 5′-modified 2′-deoxyribosyl sugar moiety, or a modified 2′-deoxyfuranosyl sugar moiety.

69. The oligomeric compound of embodiment 68, wherein the one modified sugar moiety of the central region is a bicyclic ribosyl sugar moiety, a non-bicyclic 2′-substituted ribosyl sugar moiety, a non-bicyclic 4′-substituted 2′-deoxyribosyl sugar moiety, a non-bicyclic 5′-substituted 2′-deoxyribosyl sugar moiety, or a modified, unsubstituted 2′-deoxyfuranosyl sugar moiety.

70. The oligomeric compound of any of embodiments 67-69, wherein the one modified sugar moiety of the central region is a 2′-substituted ribosyl sugar moiety.

71. The oligomeric compound of embodiment 70, wherein the 2′-substituted ribosyl sugar moiety is a 2′-F, 2′-MOE, or 2′-O-methyl substituted sugar moiety.

72. The oligomeric compound of any of embodiments 67-69, wherein the one modified sugar moiety of the central region is a 4′-alkyl substituted 2′-deoxyribosyl sugar moiety.

73. The oligomeric compound of embodiment 72, wherein the 4′-alkyl substituted ribosyl sugar moiety is a 4′-methyl substituted 2′-deoxyribosyl sugar moiety.

74. The oligomeric compound of any of embodiments 67-69, wherein the one modified sugar moiety of the central region is a 5′-alkyl substituted 2′-deoxyribosyl sugar moiety.

75. The oligomeric compound of embodiment 74, wherein the 5′-alkyl substituted ribosyl sugar moiety is a 5′-methyl, 5′-ethyl, or 5′-allyl substituted 2′-deoxyribosyl sugar moiety.

76. The oligomeric compound of any of embodiments 67-69, wherein the one modified sugar moiety of the central region is a modified, unsubstituted 2′-deoxyfuranosyl sugar moiety.

77. The oligomeric compound of embodiment 76, wherein the modified, unsubstituted 2′-deoxyfuranosyl sugar moiety is an unsubstituted α-D-2′-deoxyribosyl, α-L-2′-deoxyribosyl, β-L-2′-deoxyribosyl, or β-D-2′-deoxyxylosyl sugar moiety.

78. The oligomeric compound of any of embodiments 67-69, wherein the one modified sugar moiety of the central region is a bicyclic ribosyl sugar moiety.

79. The oligomeric compound of embodiment 78, wherein the bicyclic ribosyl sugar moiety is cEt, LNA, or ENA.

80. The oligomeric compound of any of embodiments 67-69, wherein the one modified sugar moiety of the central region is a morpholino, cEt, 2′-F, 2′-MOE, 4′-Methyl, 5′-Methyl, 5′-allyl, 5′-ethyl, β-L-2′-deoxyribosyl, α-D-2′-deoxyribosyl, β-D-2′-deoxyxylosyl, or α-L-2′-deoxyribosyl sugar moiety.

81. The oligomeric compound of embodiment 62, wherein the one modified sugar moiety of the central region is a 2′-O-Methyl substituted ribosyl, unsubstituted α-D-2′-deoxyribosyl, unsubstituted α-L-2′-deoxyribosyl, or unsubstituted β-L-2′-deoxyribosyl sugar moiety.

82. The oligomeric compound of embodiment 81, wherein the one modified sugar moiety of the central region is a 2′-O-Methyl substituted ribosyl or unsubstituted β-L-2′-deoxyribosyl sugar moiety.

83. The oligomeric compound of embodiment 63, wherein the one modified sugar moiety of the central region is a morpholino, 2′-O-Methyl substituted ribosyl, unsubstituted α-D-2′-deoxyribosyl, or unsubstituted β-L-2′-deoxyribosyl sugar moiety sugar moiety.

84. The oligomeric compound of embodiment 64, wherein the one modified sugar moiety of the central region is a morpholino, unsubstituted α-D-2′-deoxyribosyl, or unsubstituted β-L-2′-deoxyribosyl sugar moiety sugar moiety.

85. The oligomeric compound of embodiment 65, wherein the one modified sugar moiety of the central region is a 2′-F substituted ribosyl, 2′-MOE substituted ribosyl, 2′-O-Methyl substituted ribosyl, 5′-(S)-Methyl substituted 2′-deoxyribosyl, 5′-allyl substituted 2′-deoxyribosyl, unsubstituted α-D-2′-deoxyribosyl, or cEt bicyclic sugar moiety.

86. The oligomeric compound of embodiment 85, wherein the one modified sugar moiety of the central region is a 2′-MOE substituted ribosyl, 2′-O-Methyl substituted ribosyl, or 5′-allyl substituted 2′-deoxyribosyl sugar moiety.

87. The oligomeric compound of embodiment 85 or 86, wherein the 5′-allyl substituted ribosyl sugar moiety is stereorandom at the 5′-position of the modified sugar moiety.

88. The oligomeric compound of embodiment 66, wherein the one modified sugar moiety of the central region is a 2′-F substituted ribosyl, 2′-MOE substituted ribosyl, 2′-O-Methyl substituted ribosyl, 4′-Methyl substituted 2′-deoxyribosyl, 5′-(S)-Methyl substituted 2′-deoxyribosyl, 5′-(R)-Methyl substituted 2′-deoxyribosyl, 5′-stereorandom Methyl substituted 2′-deoxyribosyl, 5′-(S)-Ethyl substituted 2′-deoxyribosyl, 5′-(R)-Ethyl substituted 2′-deoxyribosyl, 5′-stereorandom Ethyl 2′-deoxyribosyl, 5′-(S)-Allyl substituted 2′-deoxyribosyl, 5′-(R)-Allyl substituted 2′-deoxyribosyl, 5′-stereorandom allyl substituted 2′-deoxyribosyl, unsubstituted α-D-2′-deoxyribosyl, unsubstituted α-L-2′-deoxyribosyl, unsubstituted β-L-2′-deoxyribosyl, cEt, or morpholino sugar moiety.

89. The oligomeric compound of embodiment 88, wherein the one modified sugar moiety of the central region is a 2′-F substituted ribosyl, 2′-MOE substituted ribosyl, 2′-O-Methyl substituted ribosyl, 4′-Methyl substituted 2′-deoxyribosyl, 5′-(R)-Methyl substituted 2′-deoxyribosyl, 5′-(S)-Ethyl substituted 2′-deoxyribosyl, 5′-(R)-Ethyl substituted 2′-deoxyribosyl, 5′-(S)-Allyl substituted 2′-deoxyribosyl, 5′-(R)-Allyl substituted 2′-deoxyribosyl, 5′-stereorandom allyl substituted 2′-deoxyribosyl, unsubstituted β-L-2′-deoxyribosyl, cEt, or morpholino sugar moiety.

90. The oligomeric compound of any of embodiments 50-61 or 67-69, wherein the one modified sugar moiety of the central region is at position 1 of the central region.

91. The oligomeric compound of embodiment 90, wherein the one modified sugar moiety of the central region is a morpholino, unsubstituted β-L-2′-deoxyribosyl, or unsubstituted α-D-2′-deoxyribosyl sugar moiety.

92. The oligomeric compound of embodiment 90, wherein the one modified sugar moiety of the central region is a morpholino or unsubstituted α-D-2′-deoxyribosyl sugar moiety.

93. The oligomeric compound of any of embodiments 50-61 or 67-69, wherein the one modified sugar moiety of the central region is at position 2 of the central region.

94. The oligomeric compound of embodiment 93, wherein the one modified sugar moiety of the central region is a 2′-F substituted ribosyl, 2′-MOE substituted ribosyl, 2′-O-Methyl substituted ribosyl, 5′-(S)-Methyl substituted 2′-deoxyribosyl, 5′-Allyl substituted 2′-deoxyribosyl, unsubstituted α-D-2′-deoxyribosyl, or cEt sugar moiety.

95. The oligomeric compound of embodiment 93, wherein the one modified sugar moiety of the central region is a 2′-MOE substituted ribosyl, 2′-O-Methyl substituted ribosyl, 5′-(S)-Methyl substituted 2′-deoxyribosyl, 5′-Allyl substituted 2′-deoxyribosyl, or unsubstituted α-D-2′-deoxyribosyl sugar moiety.

96. The oligomeric compound of embodiment 94 or 95, wherein the 5′-allyl substituted 2′-deoxyribosyl sugar moiety is stereorandom at the 5′-position of the modified sugar moiety.

97. The oligomeric compound of any of embodiments 50-61 or 67-69, wherein the one modified sugar moiety of the central region is at position 3 of the central region.

98. The oligomeric compound of embodiment 97, wherein the one modified sugar moiety of the central region is a 2′-F substituted ribosyl, 2′-MOE substituted ribosyl, 2′-O-Methyl substituted ribosyl, 4′-Methyl substituted 2′-deoxyribosyl, 5′-(R)-Methyl substituted 2′-deoxyribosyl, 5′-(S)-Methyl substituted 2′-deoxyribosyl, 5′-(S)-Ethyl substituted 2′-deoxyribosyl, 5′-(R)-Ethyl substituted 2′-deoxyribosyl, 5′-(S)-Allyl substituted 2′-deoxyribosyl, 5′-(R)-Allyl substituted 2′-deoxyribosyl, 5′-stereorandom allyl substituted 2′-deoxyribosyl, unsubstituted β-L-2′-deoxyribosyl, unsubstituted β-D-2′-deoxyxylosyl, unsubstituted α-L-2′-deoxyribosyl, unsubstituted α-D-2′-deoxyribosyl, cEt, or morpholino sugar moiety.

99. The oligomeric compound of embodiment 97, wherein the one modified sugar moiety of the central region is a 2′-F substituted ribosyl, 2′-MOE substituted ribosyl, 2′-O-Methyl substituted ribosyl, 4′-Methyl substituted 2′-deoxyribosyl, 5′-(R)-Methyl substituted 2′-deoxyribosyl, 5′-(S)-Ethyl substituted 2′-deoxyribosyl, 5′-(R)-Ethyl substituted 2′-deoxyribosyl, 5′-(S)-Allyl substituted 2′-deoxyribosyl, 5′-(R)-Allyl substituted 2′-deoxyribosyl, 5′-stereorandom allyl substituted 2′-deoxyribosyl, unsubstituted β-L-2′-deoxyribosyl, unsubstituted β-D-2′-deoxyxylosyl, cEt, or morpholino sugar moiety.

100. The oligomeric compound of any of embodiments 50-61 or 67-69, wherein the one modified sugar moiety of the central region is at position 4 of the central region.

101. The oligomeric compound of embodiment 100, wherein the one modified sugar moiety of the central region is a 2′-F substituted ribosyl, 2′-MOE substituted ribosyl, 2′-O-Methyl substituted ribosyl, 4′-Methyl substituted 2′-deoxyribosyl, 5′-(R)-Methyl substituted 2′-deoxyribosyl, 5′-(S)-Methyl substituted 2′-deoxyribosyl, 5′-(S)-Ethyl substituted 2′-deoxyribosyl, 5′-(R)-Ethyl substituted 2′-deoxyribosyl, 5′-(S)-Allyl substituted 2′-deoxyribosyl, 5′-(R)-Allyl substituted 2′-deoxyribosyl, 5′-stereorandom allyl substituted 2′-deoxyribosyl, unsubstituted β-L-2′-deoxyribosyl, unsubstituted α-L-2′-deoxyribosyl, unsubstituted α-D-2′-deoxyribosyl, cEt, or morpholino sugar moiety.

102. The oligomeric compound of embodiment 100, wherein the one modified sugar moiety of the central region is a 2′-F substituted ribosyl, 2′-MOE substituted ribosyl, 2′-O-Methyl substituted ribosyl, 4′-Methyl substituted 2′-deoxyribosyl, 5′-(R)-Methyl substituted 2′-deoxyribosyl, 5′-(S)-Ethyl substituted 2′-deoxyribosyl, 5′-(R)-Ethyl substituted 2′-deoxyribosyl, 5′-(S)-Allyl substituted 2′-deoxyribosyl, 5′-(R)-Allyl substituted 2′-deoxyribosyl, 5′-stereorandom allyl substituted 2′-deoxyribosyl, unsubstituted L-2′-deoxyribosyl, unsubstituted α-L-2′-deoxyribosyl, unsubstituted α-D-2′-deoxyribosyl, cEt, or morpholino sugar moiety.

103. The oligomeric compound of any of embodiments 50-61 or 67-69, wherein the one modified sugar moiety of the central region is at position 5 of the central region.

104. The oligomeric compound of embodiment 103, wherein the one modified sugar moiety of the central region is a 2′-O-Methyl substituted ribosyl or unsubstituted β-L-2′-deoxyribosyl sugar moiety.

105. The oligomeric compound of embodiment 103, wherein the one modified sugar moiety of the central region is an unsubstituted β-L-2′-deoxyribosyl sugar moiety.

106. The oligomeric compound of any of embodiments 50-61 or 67-69, wherein the one modified sugar moiety of the central region is at position 6 of the central region.

107. The oligomeric compound of embodiment 106, wherein the one modified sugar moiety of the central region is a 2′-O-Methyl substituted ribosyl, unsubstituted β-L-2′-deoxyribosyl, unsubstituted α-D-2′-deoxyribosyl, or morpholino sugar moiety.

108. The oligomeric compound of any of embodiments 50-61 or 67-69, wherein the one modified sugar moiety of the central region is at position 7 of the central region.

109. The oligomeric compound of embodiment 108, wherein the one modified sugar moiety of the central region is a 2′-O-Methyl substituted ribosyl, unsubstituted β-L-2′-deoxyribosyl, or unsubstituted α-D-2′-deoxyribosyl sugar moiety.

110. The oligomeric compound of any of embodiments 50-61 or 67-69, wherein the one modified sugar moiety of the central region is at position 8 of the central region.

111. The oligomeric compound of embodiment 110, wherein the one modified sugar moiety of the central region is a 2′-O-Methyl substituted ribosyl, unsubstituted β-L-2′-deoxyribosyl, or unsubstituted α-D-2′-deoxyribosyl sugar moiety.

112. The oligomeric compound of any of embodiments 50-61 or 67-69, wherein the one modified sugar moiety of the central region is at position 9 of the central region.

113. The oligomeric compound of embodiment 112, wherein the one modified sugar moiety of the central region is a 2′-O-Methyl substituted ribosyl or unsubstituted β-L-2′-deoxyribosyl sugar moiety.

114. The oligomeric compound of any of embodiments 50-61 or 67-69, wherein the one modified sugar moiety of the central region is at position 10 of the central region.

115. The oligomeric compound of any of embodiments 50-61 or 67-69, wherein the one modified sugar moiety of the central region is a morpholino modified sugar moiety at position 1 of the central region.

116. The oligomeric compound of any of embodiments 50-61 or 67-69, wherein the one modified sugar moiety of the central region is a modified, unsubstituted 2′-deoxyfuranosyl sugar moiety at position 1 of the central region.

117. The oligomeric compound of embodiment 116, wherein the one modified sugar moiety of the central region is an unsubstituted β-L-2′-deoxyribosyl sugar moiety at position 1 of the central region.

118. The oligomeric compound of embodiment 116, wherein the one modified sugar moiety of the central region is an unsubstituted α-D-2′-deoxyribosyl sugar moiety 119. The oligomeric compound of any of embodiments 50-61 or 67-69, wherein the one modified sugar moiety of the central region is a 2′-substituted ribosyl sugar moiety at position 2 of the central region.

120. The oligomeric compound of embodiment 119, wherein the 2′-substituted ribosyl sugar moiety at position 2 of the central region is a 2′-F ribosyl sugar moiety.

121. The oligomeric compound of embodiment 119, wherein the 2′-substituted ribosyl sugar moiety at position 2 of the central region is a 2′-MOE ribosyl sugar moiety.

122. The oligomeric compound of embodiment 119, wherein the 2′-substituted ribosyl sugar moiety at position 2 of the central region is a 2′-O-methyl ribosyl sugar moiety.

123. The oligomeric compound of any of embodiments 50-61 or 67-69, wherein the one modified sugar moiety of the central region is a 5′-alkyl substituted 2′-deoxyribosyl sugar moiety at position 2 of the central region.

124. The oligomeric compound of embodiment 123, wherein the 5′-alkyl substituted 2′-deoxyribosyl sugar moiety at position 2 of the central region is a 5′-(S)Me 2′-deoxyribosyl sugar moiety.

125. The oligomeric compound of embodiment 123, wherein the 5′-alkyl substituted 2′-deoxyribosyl sugar moiety at position 2 of the central region is a 5′-allyl 2′-deoxyribosyl sugar moiety.

126. The oligomeric compound of embodiment 125, wherein the 5′-allyl 2′-deoxyribosyl sugar moiety is stereorandom at the 5′-position of the 5′-allyl 2′-deoxyribosyl sugar moiety.

127. The oligomeric compound of any of embodiments 50-61 or 67-69, wherein the one modified sugar moiety of the central region is a modified, unsubstituted 2′-deoxyfuranosyl sugar moiety at position 2 of the central region.

128. The oligomeric compound of embodiment 127, wherein the modified, unsubstituted 2′-deoxyfuranosyl sugar moiety at position 2 of the central region is a α-D-2′-deoxyribosyl modified sugar moiety.

129. The oligomeric compound of any of embodiments 50-61 or 67-69, wherein the one modified sugar moiety of the central region is a cEt or LNA sugar moiety at position 2 of the central region.

130. The oligomeric compound of any of embodiments 50-61 or 67-69, wherein the one modified sugar moiety of the central region is a 2′-substituted ribosyl sugar moiety at position 3 of the central region.

131. The oligomeric compound of embodiment 130, wherein the 2′-substituted ribosyl sugar moiety at position 3 of the central region is a 2′-F ribosyl sugar moiety.

132. The oligomeric compound of embodiment 130, wherein the 2′-substituted ribosyl sugar moiety at position 3 of the central region is a 2′-MOE ribosyl sugar moiety.

133. The oligomeric compound of embodiment 130, wherein the 2′-substituted ribosyl sugar moiety at position 3 of the central region is a 2′-O-methyl ribosyl sugar moiety.

134. The oligomeric compound of any of embodiments 50-61 or 67-69, wherein the one modified sugar moiety of the central region is a 4′-alkyl substituted 2′-deoxyribosyl sugar moiety at position 3 of the central region.

135. The oligomeric compound of embodiment 134, wherein the 4′-substituted 2′-deoxyribosyl sugar moiety at position 3 of the central region is a 4′-methyl 2′-deoxyribosyl sugar moiety.

136. The oligomeric compound of any of embodiments 50-61 or 67-69, wherein the one modified sugar moiety of the central region is a 5′-alkyl substituted 2′-deoxyribosyl sugar moiety at position 3 of the central region.

137. The oligomeric compound of embodiment 136, wherein the 5′-alkyl substituted 2′-deoxyribosyl sugar moiety at position 3 of the central region is a 5′-(R)-methyl 2′-deoxyribosyl sugar moiety.

138. The oligomeric compound of embodiment 136, wherein the 5′-alkyl substituted 2′-deoxyribosyl sugar moiety at position 3 of the central region is a 5′-(S)-methyl 2′-deoxyribosyl sugar moiety.

139. The oligomeric compound of embodiment 136, wherein the 5′-alkyl substituted 2′-deoxyribosyl sugar moiety at position 3 of the central region is a 5′-stereorandom methyl 2′-deoxyribosyl sugar moiety.

140. The oligomeric compound of embodiment 136, wherein the 5′-alkyl substituted 2′-deoxyribosyl sugar moiety at position 3 of the central region is a 5′-(R)-ethyl 2′-deoxyribosyl sugar moiety.

141. The oligomeric compound of embodiment 136, wherein the 5′-alkyl substituted 2′-deoxyribosyl sugar moiety at position 3 of the central region is a 5′-(S)-ethyl 2′-deoxyribosyl sugar moiety.

142. The oligomeric compound of embodiment 136, wherein the 5′-alkyl substituted 2′-deoxyribosyl sugar moiety at position 3 of the central region is a 5′-stereorandom ethyl 2′-deoxyribosyl sugar moiety.

143. The oligomeric compound of embodiment 136, wherein the 5′-alkyl substituted 2′-deoxyribosyl sugar moiety at position 3 of the central region is a 5′-(R)-allyl 2′-deoxyribosyl sugar moiety.

144. The oligomeric compound of embodiment 136, wherein the 5′-alkyl substituted 2′-deoxyribosyl sugar moiety at position 3 of the central region is a 5′-(S)-allyl 2′-deoxyribosyl sugar moiety.

145. The oligomeric compound of embodiment 136, wherein the 5′-alkyl substituted 2′-deoxyribosyl sugar moiety at position 3 of the central region is a 5′-stereorandom allyl 2′-deoxyribosyl sugar moiety.

146. The oligomeric compound of any of embodiments 50-61 or 67-69, wherein the one modified sugar moiety of the central region is a modified, unsubstituted 2′-deoxyfuranosyl sugar moiety at position 3 of the central region.

147. The oligomeric compound of embodiment 146, wherein the modified, unsubstituted 2′-deoxyfuranosyl sugar moiety at position 3 of the central region is an α-D-2′-deoxyribosyl modified sugar moiety.

148. The oligomeric compound of embodiment 146, wherein the modified, unsubstituted 2′-deoxyfuranosyl sugar moiety at position 3 of the central region is an α-L-2′-deoxyribosyl modified sugar moiety.

149. The oligomeric compound of embodiment 146, wherein the modified, unsubstituted 2′-deoxyfuranosyl sugar moiety at position 3 of the central region is an β-L-2′-deoxyribosyl modified sugar moiety.

150. The oligomeric compound of embodiment 146, wherein the modified, unsubstituted 2′-deoxyfuranosyl sugar moiety at position 3 of the central region is an β-D-2′-deoxyxylosyl modified sugar moiety.

151. The oligomeric compound of any of embodiments 50-61 or 67-69, wherein the one modified sugar moiety of the central region is a bicyclic ribosyl sugar moiety at position 3 of the central region.

152. The oligomeric compound of embodiment 151, wherein the bicyclic ribosyl sugar moiety at position 3 of the central region is a cEt or LNA sugar moiety.

153. The oligomeric compound of embodiment 151, wherein the bicyclic ribosyl sugar moiety at position 3 of the central region is a cEt sugar moiety.

154. The oligomeric compound of embodiment 151, wherein the bicyclic ribosyl sugar moiety at position 3 of the central region is a LNA sugar moiety.

155. The oligomeric compound of any of embodiments 50-61 or 67-69, wherein the one modified sugar moiety of the central region is a morpholino sugar moiety at position 3 of the central region.

156. The oligomeric compound of any of embodiments 50-61 or 67-69, wherein the one modified sugar moiety of the central region is a 2′-substituted ribosyl sugar moiety at position 4 of the central region.

157. The oligomeric compound of embodiment 156, wherein the 2′-substituted ribosyl sugar moiety at position 4 of the central region is a 2′-F ribosyl sugar moiety.

158. The oligomeric compound of embodiment 156, wherein the 2′-substituted ribosyl sugar moiety at position 4 of the central region is a 2′-MOE ribosyl sugar moiety.

159. The oligomeric compound of embodiment 156, wherein the 2′-substituted ribosyl sugar moiety at position 4 of the central region is a 2′-O-methyl ribosyl sugar moiety.

160. The oligomeric compound of any of embodiments 50-61 or 67-69, wherein the one modified sugar moiety of the central region is a 4′-alkyl substituted 2′-deoxyribosyl sugar moiety at position 4 of the central region.

161. The oligomeric compound of embodiment 160, wherein the 4′-substituted 2′-deoxyribosyl sugar moiety at position 4 of the central region is a 4′-methyl 2′-deoxyribosyl sugar moiety.

162. The oligomeric compound of any of embodiments 50-61 or 67-69, wherein the one modified sugar moiety of the central region is a 5′-alkyl substituted 2′-deoxyribosyl sugar moiety at position 4 of the central region.

163. The oligomeric compound of embodiment 162, wherein the 5′-alkyl substituted 2′-deoxyribosyl sugar moiety at position 4 of the central region is a 5′-(R)-methyl 2′-deoxyribosyl sugar moiety.

164. The oligomeric compound of embodiment 162, wherein the 5′-alkyl substituted 2′-deoxyribosyl sugar moiety at position 4 of the central region is a 5′-(S)-methyl 2′-deoxyribosyl sugar moiety.

165. The oligomeric compound of embodiment 162, wherein the 5′-alkyl substituted 2′-deoxyribosyl sugar moiety at position 4 of the central region is a 5′-stereorandom methyl 2′-deoxyribosyl sugar moiety.

166. The oligomeric compound of embodiment 162, wherein the 5′-alkyl substituted 2′-deoxyribosyl sugar moiety at position 4 of the central region is a 5′-(R)-ethyl 2′-deoxyribosyl sugar moiety.

167. The oligomeric compound of embodiment 162, wherein the 5′-alkyl substituted 2′-deoxyribosyl sugar moiety at position 4 of the central region is a 5′-(S)-ethyl 2′-deoxyribosyl sugar moiety.

168. The oligomeric compound of embodiment 162, wherein the 5′-alkyl substituted 2′-deoxyribosyl sugar moiety at position 4 of the central region is a 5′-stereorandom ethyl 2′-deoxyribosyl sugar moiety.

169. The oligomeric compound of embodiment 162, wherein the 5′-alkyl substituted 2′-deoxyribosyl sugar moiety at position 4 of the central region is a 5′-(R)-allyl 2′-deoxyribosyl sugar moiety.

170. The oligomeric compound of embodiment 162, wherein the 5′-alkyl substituted 2′-deoxyribosyl sugar moiety at position 4 of the central region is a 5′-(S)-allyl 2′-deoxyribosyl sugar moiety.

171. The oligomeric compound of embodiment 162, wherein the 5′-alkyl substituted 2′-deoxyribosyl sugar moiety at position 4 of the central region is a 5′-stereorandom allyl 2′-deoxyribosyl sugar moiety.

172. The oligomeric compound of any of embodiments 50-61 or 67-69, wherein the one modified sugar moiety of the central region is a modified, unsubstituted 2′-deoxyfuranosyl sugar moiety at position 4 of the central region.

173. The oligomeric compound of embodiment 172, wherein the modified, unsubstituted 2′-deoxyfuranosyl sugar moiety at position 4 of the central region is an α-D-2′-deoxyribosyl modified sugar moiety.

174. The oligomeric compound of embodiment 172, wherein the modified, unsubstituted 2′-deoxyfuranosyl sugar moiety at position 4 of the central region is an α-L-2′-deoxyribosyl modified sugar moiety.

175. The oligomeric compound of embodiment 172, wherein the modified, unsubstituted 2′-deoxyfuranosyl sugar moiety at position 4 of the central region is an β-L-2′-deoxyribosyl modified sugar moiety.

176. The oligomeric compound of any of embodiments 50-61 or 67-69, wherein the one modified sugar moiety of the central region is a bicyclic ribosyl sugar moiety at position 4 of the central region.

177. The oligomeric compound of embodiment 176, wherein the bicyclic ribosyl sugar moiety at position 4 of the central region is a cEt or LNA sugar moiety.

178. The oligomeric compound of embodiment 176, wherein the bicyclic ribosyl sugar moiety at position 4 of the central region is a cEt sugar moiety.

179. The oligomeric compound of embodiment 176, wherein the bicyclic ribosyl sugar moiety at position 4 of the central region is a LNA sugar moiety.

180. The oligomeric compound of any of embodiments 50-61 or 67-69, wherein the one modified sugar moiety of the central region is a morpholino sugar moiety at position 4 of the central region.

181. The oligomeric compound of any of embodiments 50-61 or 67-69, wherein the one modified sugar moiety of the central region is a 2′-O-methyl substituted ribosyl sugar moiety at position 5 of the central region.

182. The oligomeric compound of any of embodiments 50-61 or 67-69, wherein the one modified sugar moiety of the central region is a modified, unsubstituted 2′-deoxyfuranosyl sugar moiety at position 5 of the central region.

183. The oligomeric compound of embodiment 182, wherein the modified, unsubstituted 2′-deoxyfuranosyl sugar moiety at position 5 of the central region is a β-L-2′-deoxyribosyl sugar moiety.

184. The oligomeric compound of any of embodiments 50-61 or 67-69, wherein the one modified sugar moiety of the central region is a morpholino sugar moiety at position 6 of the central region.

185. The oligomeric compound of any of embodiments 50-61 or 67-69, wherein the one modified sugar moiety of the central region is a 2′-O-methyl substituted ribosyl sugar moiety at position 6 of the central region.

186. The oligomeric compound of any of embodiments 50-61 or 67-69, wherein the one modified sugar moiety of the central region is a modified, unsubstituted 2′-deoxyfuranosyl sugar moiety at position 6 of the central region.

187. The oligomeric compound of embodiment 186, wherein the modified, unsubstituted 2′-deoxyfuranosyl sugar moiety at position 6 of the central region is a β-L-2′-deoxyribosyl sugar moiety.

188. The oligomeric compound of embodiment 186, wherein the modified, unsubstituted 2′-deoxyfuranosyl sugar moiety at position 6 of the central region is an α-D-2′-deoxyribosyl sugar moiety.

189. The oligomeric compound of any of embodiments 50-61 or 67-69, wherein the one modified sugar moiety of the central region is a 2′-O-methyl substituted ribosyl sugar moiety at position 7 of the central region.

190. The oligomeric compound of any of embodiments 50-61 or 67-69, wherein the one modified sugar moiety of the central region is a modified, unsubstituted 2′-deoxyfuranosyl sugar moiety at position 7 of the central region.

191. The oligomeric compound of embodiment 190, wherein the modified, unsubstituted 2′-deoxyfuranosyl sugar moiety at position 7 of the central region is a β-L-2′-deoxyribosyl sugar moiety.

192. The oligomeric compound of embodiment 190, wherein the modified, unsubstituted 2′-deoxyfuranosyl sugar moiety at position 7 of the central region is an α-D-2′-deoxyribosyl sugar moiety.

193. The oligomeric compound of any of embodiments 50-61 or 67-69, wherein the one modified sugar moiety of the central region is a 2′-O-methyl substituted ribosyl sugar moiety at position 8 of the central region.

194. The oligomeric compound of any of embodiments 50-61 or 67-69, wherein the one modified sugar moiety of the central region is a modified, unsubstituted 2′-deoxyfuranosyl sugar moiety at position 8 of the central region.

195. The oligomeric compound of embodiment 194, wherein the modified, unsubstituted 2′-deoxyfuranosyl sugar moiety at position 8 of the central region is a β-L-2′-deoxyribosyl sugar moiety.

196. The oligomeric compound of embodiment 194, wherein the modified, unsubstituted 2′-deoxyfuranosyl sugar moiety at position 8 of the central region is an α-D-2′-deoxyribosyl sugar moiety.

197. The oligomeric compound of any of embodiments 50-61 or 67-69, wherein the one modified sugar moiety of the central region is a 2′-O-methyl substituted ribosyl sugar moiety at position 9 of the central region.

198. The oligomeric compound of any of embodiments 50-61 or 67-69, wherein the one modified sugar moiety of the central region is a modified, unsubstituted 2′-deoxyfuranosyl sugar moiety at position 9 of the central region.

199. The oligomeric compound of embodiment 198, wherein the modified, unsubstituted 2′-deoxyfuranosyl sugar moiety at position 9 of the central region is a β-L-2′-deoxyribosyl sugar moiety.

200. The oligomeric compound of any of embodiments 50-61 or 67-69, wherein the one modified sugar moiety of the central region is a 2′-O-methyl substituted ribosyl sugar moiety at position 2, 3, 4, 5, 6, 7, 8, or 9 of the central region.

201. The oligomeric compound of any of embodiments 50-61 or 67-69, wherein the one modified sugar moiety of the central region is a 2′-O-methyl substituted ribosyl sugar moiety at position 2, 3, 4, 8, or 9 of the central region.

202. The oligomeric compound of any of embodiments 50-61 or 67-69, wherein the one modified sugar moiety of the central region is a 2′-F substituted ribosyl sugar moiety at position 2, 3, or 4 of the central region.

203. The oligomeric compound of any of embodiments 50-61 or 67-69, wherein the one modified sugar moiety of the central region is a 2′-F substituted ribosyl sugar moiety at position 3 or 4 of the central region.

204. The oligomeric compound of any of embodiments 50-61 or 67-69, wherein the one modified sugar moiety of the central region is a 2′-MOE substituted ribosyl sugar moiety at position 2, 3, or 4 of the central region.

205. The oligomeric compound of any of embodiments 50-61 or 67-69, wherein the one modified sugar moiety of the central region is a 4′-methyl substituted 2′-deoxyribosyl sugar moiety at position 3 or 4 of the central region.

206. The oligomeric compound of any of embodiments 50-61 or 67-69, wherein the one modified sugar moiety of the central region is a 5′-(R)-methyl substituted 2′-deoxyribosyl sugar moiety at position 3 or 4 of the central region.

207. The oligomeric compound of any of embodiments 50-61 or 67-69, wherein the one modified sugar moiety of the central region is a 5′-(S)-methyl substituted 2′-deoxyribosyl sugar moiety at position 2, 3, or 4 of the central region.

208. The oligomeric compound of any of embodiments 50-61 or 67-69, wherein the one modified sugar moiety of the central region is a 5′-(R)-ethyl substituted 2′-deoxyribosyl sugar moiety at position 3 or 4 of the central region.

209. The oligomeric compound of any of embodiments 50-61 or 67-69, wherein the one modified sugar moiety of the central region is a 5′-(S)-ethyl substituted 2′-deoxyribosyl sugar moiety at position 3 or 4 of the central region.

210. The oligomeric compound of any of embodiments 50-61 or 67-69, wherein the one modified sugar moiety of the central region is a 5′-(R)-allyl substituted 2′-deoxyribosyl sugar moiety at position 3 or 4 of the central region.

211. The oligomeric compound of any of embodiments 50-61 or 67-69, wherein the one modified sugar moiety of the central region is a 5′-(S)-allyl substituted 2′-deoxyribosyl sugar moiety at position 3 or 4 of the central region.

212. The oligomeric compound of any of embodiments 50-61 or 67-69, wherein the one modified sugar moiety of the central region is a 5′-stereorandom allyl substituted 2′-deoxyribosyl sugar moiety at position 2, 3, or 4 of the central region.

213. The oligomeric compound of any of embodiments 50-61 or 67-69, wherein the one modified sugar moiety of the central region is a cEt ribosyl sugar moiety at position 2, 3, or 4 of the central region.

214. The oligomeric compound of any of embodiments 50-61 or 67-69, wherein the one modified sugar moiety of the central region is a cEt ribosyl sugar moiety at position 3 or 4 of the central region.

215. The oligomeric compound of any of embodiments 50-61 or 67-69, wherein the one modified sugar moiety of the central region is a LNA ribosyl sugar moiety at position 2, 3, or 4 of the central region.

216. The oligomeric compound of any of embodiments 50-61 or 67-69, wherein the one modified sugar moiety of the central region is a LNA ribosyl sugar moiety at position 3 or 4 of the central region.

217. The oligomeric compound of any of embodiments 50-61 or 67-69, wherein the one modified sugar moiety of the central region is a morpholino sugar moiety at position 1, 3, 4, or 6 of the central region.

218. The oligomeric compound of any of embodiments 50-61 or 67-69, wherein the one modified sugar moiety of the central region is a morpholino sugar moiety at position 1, 3, or 4 of the central region.

219. The oligomeric compound of any of embodiments 50-61 or 67-69, wherein the one modified sugar moiety of the central region is a modified, unsubstituted 2′-deoxyfuranosyl sugar moiety.

220. The oligomeric compound of any of embodiments 50-61 or 67-69, wherein the one modified sugar moiety of the central region is a modified, unsubstituted 2′-deoxyfuranosyl sugar moiety at position 1, 2, 3, 4, 5, 6, 7, 8, or 9 of the central region.

221. The oligomeric compound of any of embodiments 50-61 or 67-69, wherein the one modified sugar moiety of the central region is a modified, unsubstituted 2′-deoxyfuranosyl sugar moiety at position 1, 2, 3, 4, 5, or 9 of the central region.

222. The oligomeric compound of any of embodiments 50-61 or 67-69, wherein the one modified sugar moiety of the central region is an unsubstituted α-D-2′-deoxyribosyl sugar moiety.

223. The oligomeric compound of any of embodiments 50-61 or 67-69, wherein the one modified sugar moiety of the central region is an unsubstituted α-D-2′-deoxyribosyl sugar moiety at position 1, 2, 3, 4, 6, or 8 of the central region.

224. The oligomeric compound of any of embodiments 50-61 or 67-69, wherein the one modified sugar moiety of the central region is an unsubstituted α-D-2′-deoxyribosyl sugar moiety at position 1, 2, or 4 of the central region.

225. The oligomeric compound of any of embodiments 50-61 or 67-69, wherein the one modified sugar moiety of the central region is an unsubstituted α-L-2′-deoxyribosyl sugar moiety.

226. The oligomeric compound of any of embodiments 50-61 or 67-69, wherein the one modified sugar moiety of the central region is an unsubstituted α-L-2′-deoxyribosyl sugar moiety at position 3, 4, or 7 of the central region.

227. The oligomeric compound of any of embodiments 50-61 or 67-69, wherein the one modified sugar moiety of the central region is an unsubstituted β-L-2′-deoxyribosyl sugar moiety.

228. The oligomeric compound of any of embodiments 50-61 or 67-69, wherein the one modified sugar moiety of the central region is an unsubstituted β-L-2′-deoxyribosyl sugar moiety at position 1, 3, 4, 5, 6, 7, 8, or 9 of the central region.

229. The oligomeric compound of any of embodiments 50-61 or 67-69, wherein the one modified sugar moiety of the central region is an unsubstituted β-L-2′-deoxyribosyl sugar moiety at position 3, 4, 5, or 9 of the central region.

230. The oligomeric compound of any of embodiments 50-61 or 67-69, wherein the one modified sugar moiety of the central region is an unsubstituted β-D-2′-deoxyxylosyl sugar moiety.

231. The oligomeric compound of any of embodiments 53-55 or 60-230, wherein the one modified internucleoside linkage of the central region other than phosphorothioate is a phosphonate or phosphotriester internucleoside linkage.

232. The oligomeric compound of embodiment 231, wherein the one modified internucleoside linkage of the central region other than phosphorothioate is an alkyl phosphonate or alkoxy phosphonate internucleoside linkage.

233. The oligomeric compound of embodiment 232, wherein the one modified internucleoside linkage of the central region other than phosphorothioate is a methoxypropyl internucleoside linkage.

234. The oligomeric compound of embodiment 232, wherein the one modified internucleoside linkage of the central region other than phosphorothioate is a methyl phosphonate internucleoside linkage.

235. The oligomeric compound of embodiment 232, wherein the one modified internucleoside linkage of the central region other than phosphorothioate is an isopropyl phosphonate internucleoside linkage.

236. The oligomeric compound of embodiment 232, wherein the one modified internucleoside linkage of the central region other than phosphorothioate is an isobutyl phosphonate internucleoside linkage.

237. The oligomeric compound of embodiment 231, wherein the one modified internucleoside linkage of the central region other than phosphorothioate is a phosphonoacetate internucleoside linkage.

238. The oligomeric compound of embodiment 231, wherein the one modified internucleoside linkage of the central region other than phosphorothioate is an isopropyl phosphotriester internucleoside linkage.

239. The oligomeric compound of embodiment 231, wherein the one modified internucleoside linkage of the central region other than phosphorothioate is a tetrahydropyran phosphotriester internucleoside linkage.

240. The oligomeric compound of any of embodiments 53, 55, or 60-230, wherein the one modified internucleoside linkage of the central region other than phosphorothioate is a formacetal internucleoside linkage.

241. The oligomeric compound of any of embodiments 53, 55, or 60-230, wherein the one modified internucleoside linkage of the central region other than phosphorothioate is an acetamide internucleoside linkage.

242. The oligomeric compound of any of embodiments 53, 55, or 60-230, wherein the one modified internucleoside linkage of the central region other than phosphorothioate is a thioacetamide internucleoside linkage.

243. The oligomeric compound of any of embodiments 231-242, wherein the one modified internucleoside linkage of the central region other than phosphorothioate is between the nucleosides at positions 1 and 2 of the central region.

244. The oligomeric compound of any of embodiments 231-242, wherein the one modified internucleoside linkage of the central region other than phosphorothioate is between the nucleosides at positions 2 and 3 of the central region.

245. The oligomeric compound of any of embodiments 231-242, wherein the one modified internucleoside linkage of the central region other than phosphorothioate is between the nucleosides at positions 3 and 4 of the central region.

246. The oligomeric compound of any of embodiments 231-242, wherein the one modified internucleoside linkage of the central region other than phosphorothioate is between the nucleosides at positions 4 and 5 of the central region.

247. The oligomeric compound of any of embodiments 231-246, wherein the one modified internucleoside linkage of the central region other than phosphorothioate is directly linked to a nucleoside comprising a modified sugar moiety.

248. The oligomeric compound of any of embodiments 56-230, wherein the two neutral internucleoside linkages of the central region are independently selected from a phosphonate internucleoside linkage, phosphotriester internucleoside linkage, and a neutral internucleoside linkage that does not contain phosphorus.

249. The oligomeric compound of embodiment 248, wherein at least one of the modified internucleoside linkages of the central region other than phosphorothioate is an alkyl phosphonate or alkoxy phosphonate internucleoside linkage.

250. The oligomeric compound of embodiment 248, wherein at least one of the modified internucleoside linkages of the central region other than phosphorothioate is a methoxypropyl internucleoside linkage.

251. The oligomeric compound of embodiment 248, wherein at least one of the modified internucleoside linkages of the central region other than phosphorothioate is a methyl phosphonate internucleoside linkage.

252. The oligomeric compound of embodiment 248, wherein at least one of the modified internucleoside linkages of the central region other than phosphorothioate is an isopropyl phosphonate internucleoside linkage.

253. The oligomeric compound of embodiment 248, wherein at least one of the modified internucleoside linkages of the central region other than phosphorothioate is an isobutyl phosphonate internucleoside linkage.

254. The oligomeric compound of embodiment 248, wherein at least one of the modified internucleoside linkages of the central region other than phosphorothioate is a phosphonoacetate internucleoside linkage.

255. The oligomeric compound of embodiment 248, wherein at least one of the modified internucleoside linkages of the central region other than phosphorothioate is an isopropyl phosphotriester internucleoside linkage.

256. The oligomeric compound of embodiment 248, wherein at least one of the modified internucleoside linkages of the central region other than phosphorothioate is a tetrahydropyran phosphotriester internucleoside linkage.

257. The oligomeric compound of embodiment 248, wherein at least one of the modified internucleoside linkages of the central region other than phosphorothioate is a formacetal internucleoside linkage.

258. The oligomeric compound of embodiment 248, wherein at least one of the modified internucleoside linkages of the central region other than phosphorothioate is an acetamide internucleoside linkage.

259. The oligomeric compound of embodiment 248, wherein at least one of the modified internucleoside linkages of the central region other than phosphorothioate is a thioacetamide internucleoside linkage.

260. The oligomeric compound of any of embodiments 248-259, wherein the two modified internucleoside linkages other than phosphorothioate of the central region are adjacent to each other.

261. The oligomeric compound of any of claims 248-260, wherein the two modified internucleoside linkages other than phosphorothioate of the central region are the same as one another.

262. The oligomeric compound of any of embodiments 248-261, wherein one of the modified internucleoside linkages of the central region other than phosphorothioate is between the nucleosides at positions 1 and 2 of the central region.

263. The oligomeric compound of any of embodiments 248-261, wherein one of the modified internucleoside linkages of the central region other than phosphorothioate is between the nucleosides at positions 2 and 3 of the central region.

264. The oligomeric compound of any of embodiments 248-261, wherein one of the modified internucleoside linkages of the central region other than phosphorothioate is between the nucleosides at positions 3 and 4 of the central region.

265. The oligomeric compound of any of embodiments 248-261, wherein one of the modified internucleoside linkages of the central region other than phosphorothioate is between the nucleosides at positions 4 and 5 of the central region.

266. The oligomeric compound of any of embodiments 248-261, wherein one of the modified internucleoside linkages of the central region other than phosphorothioate is directly linked to a nucleoside comprising a modified sugar moiety.

267. The oligomeric compound of any of embodiments 60-266, wherein the one modified nucleobase other than 5-methylcytosine of the central region is 2-thiothymine, 6-methyladenine, inosine, or pseudouracil.

268. The oligomeric compound of embodiment 267, wherein the one modified nucleobase other than 5-methylcytosine is at position 1, 2, 3, or 4 of the central region.

269. The oligomeric compound of embodiment 267, wherein the one modified nucleobase other than 5-methylcytosine is at position 2, 3, or 4 of the central region.

270. The oligomeric compound of embodiment 267, wherein the one modified nucleobase other than 5-methylcytosine is at position 1 of the central region.

271. The oligomeric compound of embodiment 267, wherein the one modified nucleobase other than 5-methylcytosine is at position 2 of the central region.

272. The oligomeric compound of embodiment 267, wherein the one modified nucleobase other than 5-methylcytosine is at position 3 of the central region.

273. The oligomeric compound of embodiment 267, wherein the one modified nucleobase other than 5-methylcytosine is at position 4 of the central region.

274. The oligomeric compound of any of embodiments 267 or 270, wherein the one modified nucleobase other than 5-methylcytosine is 2-thiothymine.

275. The oligomeric compound of any of embodiments 267 or 271, wherein the one modified nucleobase other than 5-methylcytosine is 6-methyladenine.

276. The oligomeric compound of any of embodiments 267 or 271, wherein the one modified nucleobase other than 5-methylcytosine is inosine.

277. The oligomeric compound of any of embodiments 267-273, wherein the one modified nucleobase other than 5-methylcytosine is pseudouracil.

278. The oligomeric compound of embodiment 277, wherein the nucleoside comprising the pseudouracil nucleobase comprises an unmodified ribosyl sugar moiety.

279. The oligomeric compound of any of embodiments 1-52, 60-230, or 267-278, wherein each internucleoside linkage of the central region is independently selected from among a phosphodiester or a phosphorothioate internucleoside linkage.

280. The oligomeric compound of embodiment 279, wherein each internucleoside of the central region is a phosphorothioate internucleoside linkage.

281. The oligomeric compound of any of embodiments 1-279, wherein the central region does not comprise any phosphodiester internucleoside linkages.

282. The oligomeric compound of any of embodiments 1-281, wherein each phosphorothioate internucleoside linkage of the oligomeric compound is stereorandom.

283. The oligomeric compound of any of embodiments 1-281, wherein at least one phosphorothioate internucleoside linkage of the oligomeric compound is in the Rp configuration.

284. The oligomeric compound of any of embodiments 1-281, wherein at least one phosphorothioate internucleoside linkage of the oligomeric compound is in the Sp configuration.

285. The oligomeric compound of any of embodiments 1-284, wherein the nucleobase sequence of the modified oligonucleotide is complementary to a target RNA.

286. The oligomeric compound of embodiment 285, wherein the nucleobase sequence of the modified oligonucleotide is at least 75% complementary to the target RNA.

287. The oligomeric compound of embodiment 285, wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to the target RNA.

288. The oligomeric compound of embodiment 285, wherein the nucleobase sequence of the modified oligonucleotide is at least 85% complementary to the target RNA.

289. The oligomeric compound of embodiment 285, wherein the nucleobase sequence of the modified oligonucleotide is at least 90% complementary to the target RNA.

290. The oligomeric compound of embodiment 285, wherein the nucleobase sequence of the modified oligonucleotide is at least 95% complementary to the target RNA.

291. The oligomeric compound of embodiment 285, wherein the nucleobase sequence of the modified oligonucleotide is 100% complementary to the target RNA.

292. The oligomeric compound of any of embodiments 285-291, wherein the target RNA is a target mRNA or a target pre-mRNA.

293. The oligomeric compound of embodiment 292, wherein the target mRNA or target pre-mRNA is not a mouse, rat, monkey, or human PTEN RNA.

294. The oligomeric compound of embodiment 292 or 293, wherein the target mRNA or target pre-mRNA is not a mouse, rat, monkey, or human SRB-1 RNA.

295. The oligomeric compound of any of embodiments 292-294, wherein the target mRNA or target pre-mRNA is not a mouse, rat, monkey, or human MYD88 RNA.

296. The oligomeric compound of any of embodiments 292-295, wherein the target mRNA or target pre-mRNA is not a mouse, rat, monkey, or human HTT RNA, is not a mouse, rat, monkey, or human SOD1 RNA, and is not a mouse, rat, monkey, or human alpha-synuclein RNA.

297. The oligomeric compound of any of embodiments 285-296, wherein the target RNA is a human RNA.

298. The oligomeric compound of any of embodiments 285-297, wherein the target RNA is expressed in the liver.

299. The oligomeric compound of any of embodiments 285-298, wherein the target RNA is a liver target.

300. The oligomeric compound of any of embodiments 285-297, wherein the target RNA is not expressed in the liver.

301. The oligomeric compound of any of embodiments 285-298 or 300, wherein the target RNA is not a liver target.

302. The oligomeric compound of any of embodiments 285-299, wherein modulation of the expression of the target RNA in the liver is associated with treating a disorder or condition.

303. The oligomeric compound of embodiment 302, wherein the disorder or condition is a liver disorder or condition.

304. The oligomeric compound of any of embodiments 285-303, wherein the target RNA is expressed in the central nervous system.

305. The oligomeric compound of any of embodiments 285-303, wherein the target RNA is not expressed in the central nervous system.

306. The oligomeric compound of any of embodiments 285-298, 300, 301, or 304, wherein the target RNA is a central nervous system target.

307. The oligomeric compound of any of embodiments 285-305, wherein the target RNA is not a central nervous system target.

308. The oligomeric compound of any of embodiments 285-298, 300-301, 304, or 306, wherein the target RNA is a MeCP2, DUX4, HDAC2, APP, Ataxin 1, Ataxin 2, Ataxin 3, Ataxin 6, Ataxin 7, C9ORF72, UBE3A, Prion, PMP22, Tau, LRRK2, LINGO2, GYS1, KCNT1, IRF8, Progranulin, or GFAP RNA.

309. The oligomeric compound of any of embodiments 285-297, 300-301, 304, or 306, wherein the target RNA is a HTT RNA.

310. The oligomeric compound of embodiment 308, wherein the target RNA is a MeCP2 RNA.

311. The oligomeric compound of embodiment 308, wherein the target RNA is a DUX4 RNA.

312. The oligomeric compound of embodiment 308, wherein the target RNA is a HDAC2 RNA.

313. The oligomeric compound of embodiment 308, wherein the target RNA is a Ataxin 1 RNA.

314. The oligomeric compound of embodiment 308, wherein the target RNA is a Ataxin 2 RNA.

315. The oligomeric compound of embodiment 308, wherein the target RNA is a Ataxin 3 RNA.

316. The oligomeric compound of embodiment 308, wherein the target RNA is a Ataxin 6 RNA.

317. The oligomeric compound of embodiment 308, wherein the target RNA is a Ataxin 7 RNA.

318. The oligomeric compound of embodiment 308, wherein the target RNA is a C9ORF72 RNA.

319. The oligomeric compound of embodiment 285-297, 300-301, 304, or 306, wherein the target RNA is an alpha-synuclein RNA.

320. The oligomeric compound of embodiment 308, wherein the target RNA is an UBE3A RNA.

321. The oligomeric compound of embodiment 285-297, 300-301, 304, or 306, wherein the target RNA is a SOD1 RNA.

322. The oligomeric compound of embodiment 308, wherein the target RNA is a Prion RNA.

323. The oligomeric compound of embodiment 308, wherein the target RNA is a PMP22 RNA.

324. The oligomeric compound of embodiment 308, wherein the target RNA is a Tau RNA.

325. The oligomeric compound of embodiment 308, wherein the target RNA is a LRRK2 RNA.

326. The oligomeric compound of embodiment 308, wherein the target RNA is an APP RNA.

327. The oligomeric compound of embodiment 308, wherein the target RNA is a LINGO2 RNA.

328. The oligomeric compound of embodiment 308, wherein the target RNA is a GYS1 RNA.

329. The oligomeric compound of embodiment 308, wherein the target RNA is a KCNT1 RNA.

330. The oligomeric compound of embodiment 308, wherein the target RNA is a IRF8 RNA.

331. The oligomeric compound of embodiment 308, wherein the target RNA is a Progranulin RNA.

332. The oligomeric compound of embodiment 308, wherein the target RNA is a GFAP RNA.

333. The oligomeric compound of any of embodiments 304, 306, or 308-332, wherein modulation of the expression of the target RNA in the central nervous system is associated with treating a disorder or condition.

334. The oligomeric compound of embodiment 333, wherein the disorder or condition is a neurological disorder or condition.

335. The oligomeric compound of embodiment 333 or 334, wherein the disorder or condition alters the function of sensory or motor neurons.

336. The oligomeric compound of any of embodiments 333-335, wherein the disorder or condition alters the function of sensory neurons.

337. The oligomeric compound of any of embodiments 333-336, wherein the disorder or condition alters the function of motor neurons.

338. The oligomeric compound of any of embodiments 333-337, wherein the disorder or condition alters the function of glial cells.

339. The oligomeric compound of embodiment 338, wherein the disorder or condition alters the function of astrocytes.

340. The oligomeric compound of embodiment 338, wherein the disorder or condition alters the function of oligodendrocytes.

341. The oligomeric compound of embodiment 338, wherein the disorder or condition alters the function of microglia.

342. The oligomeric compound of embodiment 338, wherein the disorder or condition alters the function of ependymal cells.

343. The oligomeric compound of any of embodiments 333-342, wherein the disorder or condition is Alzheimer's Disease, Amyotrophic Lateral Sclerosis, Parkinson's Disease, a Spinocerebellar ataxia, Angelman Syndrome, Alexander's Disease, Lafora Disease, Charcot-Marie Tooth Disease, Prion Disease, a dementia, neurodegeneration, MeCP2 Duplication Syndrome, encephalopathy, neuroinflammation, or multiple sclerosis.

344. The oligomeric compound of embodiment 343, wherein the disorder or condition is Alzheimer's Disease.

345. The oligomeric compound of embodiment 343, wherein the disorder or condition is Amyotrophic Lateral Sclerosis.

346. The oligomeric compound of embodiment 343, wherein the disorder or condition is Parkinson's Disease.

347. The oligomeric compound of embodiment 343, wherein the disorder or condition is a Spinocerebellar ataxia.

348. The oligomeric compound of embodiment 343, wherein the disorder or condition is Angelman Syndrome.

349. The oligomeric compound of embodiment 343, wherein the disorder or condition is Alexander's Disease.

350. The oligomeric compound of embodiment 343, wherein the disorder or condition is Lafora Disease.

351. The oligomeric compound of embodiment 343, wherein the disorder or condition is Charcot-Marie Tooth Disease.

352. The oligomeric compound of embodiment 343, wherein the disorder or condition is Prion Disease.

353. The oligomeric compound of embodiment 343, wherein the disorder or condition is a dementia.

354. The oligomeric compound of embodiment 343, wherein the disorder or condition is neurodegeneration.

355. The oligomeric compound of embodiment 343, wherein the disorder or condition is MeCP2 Duplication Syndrome.

356. The oligomeric compound of embodiment 343, wherein the disorder or condition is encephalopathy.

357. The oligomeric compound of embodiment 343, wherein the disorder or condition is neuroinflammation.

358. The oligomeric compound of embodiment 343, wherein the disorder or condition is multiple sclerosis.

359. The oligomeric compound of any of embodiments 1-358, wherein the parent oligomeric compound of the oligomeric compound of any of embodiments 1-358 is cytotoxic in vitro.

360. The oligomeric compound of embodiment 359, wherein the parent oligomeric compound is cytotoxic in a standard in vitro cytotoxicity assay.

361. The oligomeric compound of any of embodiments 1-360, wherein administration to a mouse of the parent oligomeric compound of the oligomeric compound of any of embodiments 1-360 is hepatotoxic to the mouse.

362. The oligomeric compound of embodiment 361, wherein the administration of the parent oligomeric compound to the mouse is systemic administration.

363. The oligomeric compound of embodiment 362, wherein the systemic administration is subcutaneous administration.

364. The oligomeric compound of any of embodiments 361-363, wherein the mouse is a CD-1 mouse.

365. The oligomeric compound of any of embodiments 361-363, wherein the mouse is a C57BL/6 mouse.

366. The oligomeric compound of any of embodiments 361-363, wherein the mouse is a BALB/c mouse.

367. The oligomeric compound of any of embodiments 361-366, wherein the plasma ALT level in the mouse is higher than 500 units per liter following the administration of the parent oligomeric compound.

368. The oligomeric compound of any of embodiments 361-366, wherein the plasma AST level in the mouse is higher than 500 units per liter following the administration of the parent oligomeric compound.

369. The oligomeric compound of any of embodiments 361-366, wherein the plasma ALT level in the mouse is higher than 1000 units per liter following the administration of the parent oligomeric compound.

370. The oligomeric compound of any of embodiments 361-366, wherein the plasma AST level in the mouse is higher than 1000 units per liter following the administration of the parent oligomeric compound.

371. The oligomeric compound of any of embodiments 361-370, wherein the hepatotoxicity is measured 24-48 hours following the administration of the parent oligomeric compound.

372. The oligomeric compound of any of embodiments 361-370, wherein the hepatotoxicity is measured 72 hours following the administration of the parent oligomeric compound.

373. The oligomeric compound of any of embodiments 361-370, wherein the hepatotoxicity is measured 3 days following the administration of the parent oligomeric compound.

374. The oligomeric compound of any of embodiments 361-370, wherein the hepatotoxicity is measured 5 days following the administration of the parent oligomeric compound.

375. The oligomeric compound of any of embodiments 361-370, wherein the hepatotoxicity is measured 7 days following the administration of the parent oligomeric compound.

376. The oligomeric compound of any of embodiments 361-370, wherein the hepatotoxicity is measured 10 days following the administration of the parent oligomeric compound.

377. The oligomeric compound of any of embodiments 361-370, wherein the hepatotoxicity is measured 14 days following the administration of the parent oligomeric compound.

378. The oligomeric compound of any of embodiments 361-377, wherein 1-10 mg/kg of the parent oligomeric compound is administered to the mouse.

379. The oligomeric compound of any of embodiments 361-377, wherein 10-25 mg/kg of the parent oligomeric compound is administered to the mouse.

380. The oligomeric compound of any of embodiments 361-377, wherein 25-50 mg/kg of the parent oligomeric compound is administered to the mouse.

381. The oligomeric compound of any of embodiments 361-377, wherein 50-100 mg/kg of the parent oligomeric compound is administered to the mouse.

382. The oligomeric compound of any of embodiments 361-377, wherein 100-150 mg/kg of the parent oligomeric compound is administered to the mouse.

383. The oligomeric compound of any of embodiments 361-363, 366-370, 372, or 382, wherein the mouse is a BALB/c mouse, wherein 150 mg/kg of the parent oligomeric compound is administered to the mouse, and wherein the plasma ALT level in the mouse is measured 72 hours following the administration of the parent oligomeric compound.

384. The oligomeric compound of any of embodiments 1-383, wherein administration of 50 mg/kg of the oligomeric compound of any of embodiments 1-383 to a mouse is not hepatotoxic to the mouse.

385. The oligomeric compound of embodiment 384, wherein plasma ALT level in the mouse is lower than 100 units per liter following the administration of the oligomeric compound of embodiment 384.

386. The oligomeric compound of embodiment 384 or 385, wherein plasma ALT level in the mouse is at least 10-fold lower than plasma ALT level in a mouse administered the parent oligomeric compound of the oligomeric compound of embodiment 384 or 385, wherein the administrations and plasma ALT measurements of both the oligomeric compound of embodiment 384 or 385 and the parent oligomeric compound are completed in the same way.

387. The oligomeric compound of embodiment 386, wherein the plasma ALT level in the mouse is at least 100-fold lower than the plasma ALT level in the mouse administered the parent oligomeric compound.

388. The oligomeric compound of embodiment 386, wherein the plasma ALT level in the mouse is at least 500-fold lower than the plasma ALT level in the mouse administered the parent oligomeric compound.

389. The oligomeric compound of any of embodiments 359-388, wherein the therapeutic index in a mouse of the oligomeric compound of any of embodiments 359-388 is increased relative to the therapeutic index of the parent oligomeric compound.

390. The oligomeric compound of embodiment 389, wherein the therapeutic index in a mouse of the oligomeric compound of embodiment 365 is at least two-fold greater than the therapeutic index of the parent oligomeric compound.

391. The oligomeric compound of any of embodiments 1-390, wherein an otherwise identical oligomeric compound lacking the at least one modified internucleoside linkage other than phosphorothioate and/or at least one modified nucleoside comprising a modified nucleobase other than 5-methylcytosine and/or a modified sugar moiety in the central region is hepatotoxic following administration to a mouse;

and wherein the otherwise identical oligomeric compound has a central region consisting of phosphorothioate internucleoside linkages, unmodified 2′β-D-deoxyribosyl sugar moieties, and nucleobases selected from thymine, uracil, adenine, guanine, cytosine, and 5-methylcytosine.

392. The oligomeric compound of embodiment 391, wherein the at least one modified internucleoside linkage other than phosphorothioate and/or at least one modified nucleoside comprising a modified nucleobase other than 5-methylcytosine and/or a modified sugar moiety in the central region is a 2′-O-methyl modified sugar moiety.

393. The oligomeric compound of embodiment 392, wherein the 2′-O-methyl modified sugar moiety is at position 2 of the central region.

394. The oligomeric compound of embodiment 392 or 393, wherein the otherwise identical oligomeric compound lacks a 2′-O-methyl modified sugar moiety, and wherein the otherwise identical oligomeric compound comprises an unmodified 2′β-D-deoxyribosyl sugar moiety in place of the 2′-O-methyl modified sugar moiety.

395. The oligomeric compound of any of embodiments 391-394, wherein the nucleobase sequence of the otherwise identical oligomeric compound is 100% complementary to the target RNA.

396. The oligomeric compound of any of embodiments 391-395, wherein the otherwise identical oligomeric compound is a parent oligomeric compound of the oligomeric compound of any of embodiments 391-395.

397. The oligomeric compound of any of embodiments 285-396, wherein the oligomeric compound inhibits the target RNA with an IC 50 lower than 100 nM in a standard in vitro activity assay.

398. The oligomeric compound of any of embodiments 285-397, wherein the parent oligomeric compound of the oligomeric compound of any of embodiments 285-397 inhibits the target RNA with an IC 50 lower than 100 nM in a standard in vitro activity assay.

399. The oligomeric compound of any of embodiments 285-398, wherein the difference between the IC 50 of the parent oligomeric compound measured in a standard in vitro activity assay and the IC 50 of the oligomeric compound of any of embodiments 285-398 measured in a standard in vitro activity assay is less than 4-fold.

400. The oligomeric compound of any of embodiments 285-398, wherein the difference between the IC 50 of the parent oligomeric compound measured in a standard in vitro activity assay and the IC 50 of the oligomeric compound of any of embodiments 285-398 measured in a standard in vitro activity assay is less than 3-fold.

401. The oligomeric compound of any of embodiments 285-398, wherein the difference between the IC 50 of the parent oligomeric compound measured in a standard in vitro activity assay and the IC 50 of the oligomeric compound of any of embodiments 285-398 measured in a standard in vitro activity assay is less than 2-fold.

402. The oligomeric compound of any of embodiments 359-390 or 396-401, wherein each sugar moiety of the central region of the parent oligomeric compound is an unmodified 2′-β-D-deoxyribosyl sugar moiety, and wherein each internucleoside linkage of the central region of the parent oligomeric compound is a phosphorothioate internucleoside linkage.

403. The oligomeric compound of any of embodiments 359-390 or 396-402, wherein the nucleobase sequence of the parent oligomeric compound is 100% complementary to the target RNA.

404. The oligomeric compound of any of embodiments 1-403, wherein administration of 10-50 mg of the oligomeric compound to a human is not hepatotoxic to the human.

405. The oligomeric compound of any of embodiments 1-403, wherein administration of 50-100 mg of the oligomeric compound to a human is not hepatotoxic to the human.

406. The oligomeric compound of any of embodiments 1-403, wherein administration of 100-300 mg of the oligomeric compound to a human is not hepatotoxic to the human.

407. The oligomeric compound of any of embodiments 404-406, wherein the administration is systemic administration.

408. A composition comprising the oligomeric compound of any of embodiments 1-407 and a second oligomeric compound, wherein the second oligomeric compound is complementary to the oligomeric compound of any of embodiments 1-407.

409. The composition of embodiment 408, wherein the second oligomeric compound comprises at least 14 contiguous linked nucleosides that are at least 90% complementary to the oligomeric compound of any of embodiments 1-407.

410. The composition of embodiment 408, wherein the second oligomeric compound comprises at least 14 contiguous linked nucleosides that are 100% complementary to the oligomeric compound of any of embodiments 1-407.

411. A pharmaceutical composition comprising the oligomeric compound of any of embodiments 1-407 or the composition of any of embodiments 408-410, comprising a pharmaceutically acceptable carrier or diluent.

412. A method comprising administering the oligomeric compound or composition of any of embodiments 1-411 to a human subject.

413. A method of treating a disease or disorder comprising administering the oligomeric compound or composition of any of embodiments 1-411 to a human subject.

414. A method of modulating the amount or activity of a target RNA in a human subject comprising administering the oligomeric compound or composition of any of embodiments 1-411 to the human subject; and thereby modulating the amount or activity of the target RNA in the human subject.

415. A method of treating a disease or disorder in a human subject comprising administering the oligomeric compound or composition of any of embodiments 1-411 to the human subject having the disease or disorder; and thereby treating the disease or disorder in the human subject.

416. The method of embodiment 413 or 415, wherein the disease or disorder is a liver disease, and wherein the oligomeric compound modulates the amount or activity of a liver target RNA.

417. The method of embodiment 413 or 415, wherein the disease or disorder is a central nervous system disease, and wherein the oligomeric compound modulates the amount or activity of a central nervous system target RNA.

418. The method of any of embodiments 413 or 415-417, wherein the disease or disorder is a cancer, a neurodegenerative disease, a cardiovascular disease, an immunological disease, a hereditary disease, a repeat expansion disease, a muscle-wasting disease, or a metabolic disease.

419. The method of any of embodiments 412-418, wherein the plasma ALT level of the human subject after the administration is not more than three times higher than it was prior to the administration.

420. The method of any of embodiments 412-418, wherein the plasma ALT level of the human subject after the administration is not more than 150 units per liter.

421. The method of any of embodiments 412-416 or 418-420, wherein the human subject is susceptible to liver damage.

422. The method of any of embodiments 412-416 or 418-420, wherein the human subject is susceptible to liver degeneration.

423. The method of any of embodiments 412-416 or 418-420, wherein the human subject is susceptible to elevated apoptosis in the liver.

424. The method of any of embodiments 412-416 or 418-423, wherein the human subject has a liver disease.

425. The method of any of embodiments 412-424, comprising administering the parent oligomeric compound of the oligomeric compound of any of embodiments 1-407 to a mouse.

426. The method of any of embodiments 412-424, comprising contacting a cell with the parent oligomeric compound of the oligomeric compound of any of embodiments 1-407.

427. The method of embodiment 425 or 426, wherein each sugar moiety of the central region of the parent oligomeric compound is an unmodified 2′β-D-deoxyribosyl sugar moiety, and wherein each internucleoside linkage of the central region of the parent oligomeric compound is a phosphorothioate internucleoside linkage.

428. A method of designing an oligomeric compound comprising starting with a parent oligomeric compound and changing the design of that compound in order to arrive at an oligomeric compound of any one of embodiments 1-407.

429. A method of designing an oligomeric compound comprising identifying a parent oligomeric compound and changing the design of that parent oligomeric compound to arrive at a second oligomeric compound, wherein the second oligomeric compound is an oligomeric compound of any one of embodiments 1-407.

430. A method of improving hepatotoxicity of an oligomeric compound comprising the steps of (i) identifying a parent oligomeric compound that has plasma ALT levels above 300 units per liter in a mouse, and (ii) providing an oligomeric compound according to any one of embodiments 1-407.

431. The method of embodiment 428, wherein the method designs an oligomeric compound with improved therapeutic index relative to the parent oligomeric compound.

432. The method of embodiment 428 or 431, wherein the method designs an oligomeric compound with lower hepatotoxicity relative to the parent oligomeric compound.

433. The method of embodiment 429, wherein the second oligomeric compound has an improved therapeutic index relative to the parent oligomeric compound.

434. The method of embodiment 429 or 433, wherein the second oligomeric compound has reduced hepatotoxicity in a mouse relative to the parent oligomeric compound.

435. The method of embodiment 430, wherein the oligomeric compound according to any one of embodiments 1-407 has reduced hepatotoxicity relative to the parent oligomeric compound.

436. A method comprising administering an oligomeric compound of any of embodiments 1-407 to a mouse and separately administering the parent oligomeric compound of the oligomeric compound of any of embodiments 1-407 to a second mouse, wherein the therapeutic index of the oligomeric compound of any of embodiments 1-407 is improved relative to the therapeutic index of the parent oligomeric compound.

437. The method of any of embodiments 412-436, wherein the level of p21 RNA is measured in the mouse, the cell, and/or the human subject.

438. A method comprising administering an oligomeric compound to a subject and measuring the level of p21 RNA in the subject.

439. A method comprising administering an oligomeric compound of any of embodiments 1-407 to a subject and measuring the level of p21 RNA in the subject.

440. The method of embodiment 438 or 439, wherein the subject is a mouse.

441. The method of embodiment 438 or 439, wherein the subject is a human.

442. The method of any of embodiments 437-441, wherein the p21 RNA level is measured within 24 hours of the administration.

443. The method of any of embodiments 437-441, wherein the p21 RNA level is measured 24-48 hours following the administration.

444. An oligomeric compound or composition of any one of embodiments 1-411, for use in medical therapy.

445. A method comprising contacting a cell with an oligomeric compound and detecting the cellular localization of p54nrb protein in the cell.

446. The method of embodiment 445, comprising determining the relative amount of p54nrb protein in the nucleolus relative to other cells contacted with different oligomeric compounds.

447. The method of embodiment 445 or 446, comprising determining the relative amount of p54nrb in the nucleolus relative to the amount of p54nrb in the rest of the cell.

448. The method of any of embodiments 445-447, wherein the cell is in a plate containing at least 96 wells.

449. The method of any of embodiments 445-448, wherein the detection of the cellular localization of p54nrb comprises contacting the cell with a p54nrb antibody.

450. A method of screening for a tolerable oligomeric compound comprising any of the methods of embodiments 445-449.

451. The method of any of embodiments 445-450, wherein the oligomeric compound is the oligomeric compound of any of embodiments 1-407.

452. An oligomeric compound comprising a modified oligonucleotide consisting of 12-23 linked nucleosides, wherein the modified oligonucleotide comprises a 5′-region, a central region, and a 3′-region wherein:

the 5′-region consists of 1-5 linked modified nucleosides; the 3′-region consists of 1-5 linked modified nucleosides; and the central region consists of 7-11 linked nucleosides and has the formula:

(N d1 )(N x )(N y )(N z )(N d ) q

wherein one of N x , N y , and N z , is a safety enhancing nucleoside; the other two of N x , N y , and N z are independently selected from an unmodified 2′β-D-deoxyribosyl, a DNA isomer, and a DNA mimic; N d1 and each N d is independently selected from an unmodified 2′-β-D-deoxyribosyl, a DNA isomer, and a DNA mimic; and wherein q is 2-7.

453. The oligomeric compound of embodiment 1, wherein the safety enhancing nucleoside is N x or N y .

454. The oligomeric compound of embodiment 1, wherein the safety enhancing nucleoside is N x .

455. The oligomeric compound of embodiment 1, wherein the safety enhancing nucleoside is N y .

456. The oligomeric compound of embodiment 1, wherein the safety enhancing nucleoside is N z .

457. The oligomeric compound of any of embodiments 452-456, wherein the safety enhancing nucleoside has a sugar moiety selected from among a sugar surrogate, a bicyclic furanosyl sugar moiety, a non-bicyclic 2′-modified furanosyl sugar moiety, a non-bicyclic 4′-modified furanosyl sugar moiety, or a non-bicyclic 5′-modified furanosyl sugar moiety.

458. The oligomeric compound of any of embodiments 452-457, wherein the safety-enhancing nucleoside has a sugar moiety selected from among a morpholino, a 2′-O-methyl-2′β-D-deoxyribosy sugar moiety, a cEt bicyclic sugar moiety, a LNA sugar moiety, an ENA sugar moiety, a 5′-methyl substituted 2′-deoxyribosyl sugar moiety, 5′-ethyl substituted 2′-deoxyribosyl sugar moiety, a 5′-allyl substituted 2′-deoxyribosyl sugar moiety and a 2′β-L-deoxyxylosyl sugar moiety.

459. The oligomeric compound of any of embodiments 452-458, wherein the safety-enhancing nucleoside has a sugar moiety selected from among a 2′-O-methyl-modified sugar moiety and a 5′-modified sugar moiety.

460. The oligomeric compound of embodiment 459, wherein the safety-enhancing nucleoside has a 2′-O-methyl substituted ribosyl sugar moiety.

461. The oligomeric compound of any of embodiments 452-457, wherein the safety-enhancing nucleoside is a sugar surrogate.

462. The oligomeric compound of embodiment 461, wherein the sugar surrogate is selected from among a morpholino, a modified morpholino, and F-HNA.

463. The oligomeric compound of any of embodiments 452-462, wherein N d1 is an unmodified 2′-β-D-deoxyribosyl sugar moiety.

464. The oligomeric compound of any of embodiments 452-462, wherein N d1 is a DNA isomer.

465. The oligomeric compound of any of embodiments 452-462, wherein N d1 is a DNA mimic.

466. The oligomeric compound of any of embodiments 452-465, wherein no more than 3 of the central region nucleosides comprise a sugar moiety other than 2′β-D-deoxyribosyl.

467. The oligomeric compound of any of embodiments 452-466, wherein each DNA isomer has a sugar moiety independently selected from among 2′β-D-deoxyxylosyl, 2′-α-L-deoxyribosyl, 2′-β-L-deoxyribosyl, 2′-α-D-deoxyxylosyl, 1, 2′-α-L-deoxyxylosyl, and 2′-β-L-deoxyxylosyl.

468. The oligomeric compound of any of embodiments 452-467, wherein each DNA mimic has a sugar moiety is independently selected from among 5′-methyl-2′-β-D-deoxyribosyl and 5′-ethyl-2′-β-D-deoxyribosyl.

469. The oligomeric compound of any of embodiments 452-463, wherein each nucleoside of the central region other than the safety-enhancing nucleoside has a 2′β-D-deoxyribosyl sugar moiety.

470. The oligomeric compound of any of 452-469, wherein at least one internucleoside linkage is a phosphorothioate linkage.

471. The oligomeric compound of any of embodiments 452-470, wherein at least 4 internucleoside linkages are phosphorothioate linkages.

472. The oligomeric compound of any of embodiments 452-471, wherein at least one internucleoside linkage is a neutral internucleoside linkage.

473. The oligomeric compound of any of embodiments 452-472, wherein at least one neutral internucleoside linkage is a phosphonate internucleoside linkage.

474. The oligomeric compound of any of embodiments 452-474, wherein at least one neutral internucleoside linkage is a methoxypropyl internucleoside linkage.

475. The oligomeric compound of any of embodiments 452-475, wherein at least one internucleoside linkage of the central region selected from among: the internucleoside Nd1 to Nx, Nx to Ny, Ny to Nz, or Nz to the adjacent Nd is a neutral internucleoside linkage.

476. The oligomeric compound of embodiment 475, wherein the modified oligonucleotide comprises one neutral linkage and the other internucleoside linkages are each independently selected from phosphodiester and phosphorothioate.

477. The oligomeric compound of any of embodiments 542-454 or embodiments 457-476, wherein the safety enhancing nucleoside is N x and is a 2′O-methyl-substituted nucleoside.

478. The oligomeric compound of any of embodiments 2-453, 455, or embodiments 457-476, wherein the safety enhancing nucleoside is N y and is a 2′O-methyl-substituted nucleoside.

479. The oligomeric compound of any of embodiments 452-453, 455, or embodiments 457-476, wherein the safety enhancing nucleoside is N y and has a 5′-substituted 2′-deoxyribosyl sugar moiety.

480. The oligomeric compound of any of embodiments 452 or embodiments 457-476, wherein the safety enhancing nucleoside is N z and has a 5′-substituted 2′-deoxyribosyl sugar moiety.

481. The oligomeric compound of embodiments 479 or 480, wherein the 5′-substituted ribosyl sugar moiety is a 5′-methyl, 5′-ethyl, or 5′-allyl substituted 2′-deoxyribosyl sugar moiety.

482. The oligomeric compound of embodiments 477-481, wherein at least one nucleoside of the 5′-region comprises a bicyclic furanosyl sugar moiety.

483. The oligomeric compound of any of embodiments 477-482, wherein each nucleoside of the 5′-region comprises a bicyclic furanosyl sugar moiety.

484. The oligomeric compound of any of embodiments 482 or 483, wherein each bicyclic sugar moiety of the 5′-region is selected from among cEt, LNA, and ENA.

485. The oligomeric compound of any of embodiments 452-482 or 484, wherein at least one nucleoside of the 5′-region comprises a non-bicyclic sugar moiety.

486. The oligomeric compound of embodiment 485, wherein the non-bicyclic sugar moiety of the at least one nucleoside of the 5′-region is a 2′-substituted ribosyl sugar moiety.

487. The oligomeric compound of any of embodiments 485-487, wherein each non-bicyclic sugar moiety of the 5′-region has a 2′-substituent selected from among 2′-MOE, 2′-OMe, and 2′-NMA.

488. The oligomeric compound of any of embodiments 477-480, wherein the 5′-region comprises a 2′-MOE modified nucleoside and an LNA modified nucleoside.

489. The oligomeric compound of any of embodiments 477-480, wherein the 5′-region comprises a 2′-MOE modified nucleoside and a cEt modified nucleoside.

490. The oligomeric compound of embodiments 477-489, wherein at least one nucleoside of the 3′-region comprises a bicyclic furanosyl sugar moiety.

491. The oligomeric compound of any of embodiments 477-490, wherein each nucleoside of the 3′-region comprises a bicyclic furanosyl sugar moiety.

492. The oligomeric compound of any of embodiments 490 or 491, wherein each bicyclic sugar moiety of the 3′-region is selected from among cEt, LNA, and ENA.

493. The oligomeric compound of any of embodiments 490 or 492, wherein at least one nucleoside of the 3′-region comprises a non-bicyclic sugar moiety.

494. The oligomeric compound of embodiment 493, wherein the non-bicyclic sugar moiety of the at least one nucleoside of the 3′-region is a 2′-substituted ribosyl sugar moiety.

495. The oligomeric compound of any of embodiments 490 or 492-494, wherein each non-bicyclic sugar moiety of the 3′-region has a 2′-substituent selected from among 2′-MOE, 2′-OMe, and 2′-NMA.

496. The oligomeric compound of any of embodiments 477-490 or 492-495, wherein the 3′-region comprises a 2′-MOE modified nucleoside and an LNA modified nucleoside.

497. The oligomeric compound of any of embodiments 477-490 or 492-495, wherein the 3′-region comprises a 2′-MOE modified nucleoside and a cEt modified nucleoside.

498. The oligomeric compound of any of embodiments 477-480, wherein each nucleoside of the 5′-region comprises a bicyclic furanosyl sugar moiety and each nucleoside of the 3′-region comprises a non-bicyclic sugar moiety.

499. The oligomeric compound of any of embodiments 477-480, wherein each nucleoside of the 5′-region comprises an LNA sugar moiety and each nucleoside of the 3′-region comprises a 2′MOE sugar moiety.

500. The oligomeric compound of any of embodiments 477-480, wherein each nucleoside of the 5′-region comprises cEt sugar moiety and each nucleoside of the 3′-region comprises a 2′MOE sugar moiety.

501. The oligomeric compound of any of embodiments 452-500, wherein the modified oligonucleotide has a nucleobase sequence complementary to a target RNA; wherein the target RNA is a mRNA or pre-mRNA.

502. The oligomeric compound of embodiment 501, wherein the target RNA encodes a protein that is expressed in the liver.

503. The oligomeric compound of embodiment 502, wherein the target RNA encodes a protein that is expressed in the CNS.

504. The oligomeric compound of any of embodiments 452-503, wherein the oligomeric compound is not toxic.

505. The oligomeric compound of any of embodiment 452-504, wherein a comparator compound is toxic;

wherein the comparator compound is identical to the oligomeric compound except that each nucleoside of the central region of the comparator compound is a nucleoside comprising 2′-β-D-deoxyribosyl sugar moiety.

506. The oligomeric compound of embodiment 505, wherein administering a dose of the oligomeric compound to an animal results in a circulating ALT level that is at least 3-fold lower than the ALT level that results from administering the same dose of the comparator compound to an animal for at least one matched dose.

507. The oligomeric compound of embodiment 505 or 506, wherein the lowest dose of the oligomeric compound that raises circulating ALT to over 300 units per liter is at least three-fold higher than the lowest dose of the comparator compound that raises circulating ALT to over 300 units per liter.

508. The oligomeric compound of any of embodiments 502-507, wherein the oligomeric compound is capable of reducing the target RNA in a cell.

509. The oligomeric compound of embodiment 508, wherein the oligomeric compound has RNA-reducing activity comparable to a comparator compound, wherein the comparator compound is identical to the oligomeric compound except that each nucleoside of the central region of the comparator compound is a nucleoside comprising 2′-β-D-deoxyribosyl sugar moiety.

510. The oligomeric compound of embodiment 509 having RNA-reducing activity that is no more than 2-fold worse than the RNA-reducing activity of the comparator compound.

511. An oligomeric compound comprising a modified oligonucleotide consisting of 12-23 linked nucleosides, wherein the modified oligonucleotide comprises a 5′-region, a central region, and a 3′-region wherein:

the 5′-region consists of 1-5 linked nucleosides; wherein at least one 5′-region nucleoside is modified; the 3′-region consists of 1-5 linked nucleosides; wherein at least one 3′-region nucleoside is modified; and the central region consists of 7-11 linked nucleosides, and has the formula:

(N d1 ) L1 (N d2 ) L2 (N d3 ) L3 (N d4 ) L4 (N d ) q ;

wherein N d1 , N d2 , N d3 , N d4 , and each N d are independently selected from among a nucleoside comprising an unmodified 2′-β-D-deoxyribosyl sugar moiety, a DNA isomer sugar moiety, or a DNA mimic sugar moiety;

wherein each L1, L2, L3, and L4 is an internucleoside linkage; and wherein at least one of L1, L2, L3, and L4 is a neutral internucleoside linkage.

512. The oligomeric compound of embodiment 511, wherein L1 is a neutral internucleoside linkage.

513. The oligomeric compound of embodiment 511, wherein L2 is a neutral internucleoside linkage.

514. The oligomeric compound of embodiment 511, wherein L3 is a neutral internucleoside linkage.

515. The oligomeric compound of any of embodiments 511-514, wherein the neutral linkage is a phosphonate internucleoside linkage.

516. The oligomeric compound of any of embodiments 511-515, wherein the neutral linkage is a methoxypropyl internucleoside linkage.

517. The oligomeric compound of any of embodiments 511-516, wherein each remaining internucleoside linkage is a phosphodiester or phosphorothioate internucleoside linkage.

518. A method comprising administering the oligomeric compound or composition of any of embodiments 452-517 to a human subject.

519. A method of treating a disease or disorder comprising administering the oligomeric compound or composition of any of embodiments 452-517 to a human subject.

520. A method of modulating the amount or activity of a target RNA in a human subject comprising administering the oligomeric compound or composition of any of embodiments 452-517 to the human subject; and thereby modulating the amount or activity of the target RNA in the human subject.

521. A method of treating a disease or disorder in a human subject comprising administering the oligomeric compound or composition of any of embodiments 452-517 to the human subject having the disease or disorder; and thereby treating the disease or disorder in the human subject.

522. The method of embodiment 520 or 521, wherein the disease or disorder is a liver disease, and wherein the oligomeric compound modulates the amount or activity of a liver target RNA.

523. The method of embodiment 520 or 521, wherein the disease or disorder is a central nervous system disease, and wherein the oligomeric compound modulates the amount or activity of a central nervous system target RNA.

524. The method of any of embodiments 519-523, wherein the disease or disorder is a cancer, a neurodegenerative disease, a cardiovascular disease, an immunological disease, a hereditary disease, a repeat expansion disease, a muscle-wasting disease, or a metabolic disease.

525. The method of any of embodiments 518-524, wherein the plasma ALT level of the human subject after the administration is not more than three times higher than it was prior to the administration.

526. The method of any of embodiments 518-525, wherein the plasma ALT level of the human subject after the administration is not more than 150 units per liter.

527. The method of any of embodiments 518-526, wherein the human subject is susceptible to liver damage.

528. The method of any of embodiments 518-527, wherein the human subject is susceptible to liver degeneration.

529. The method of any of embodiments 518-528, wherein the human subject is susceptible to elevated apoptosis in the liver.

530. The method of any of embodiments 518-529, wherein the human subject has a liver disease.

531. The method of any of embodiments 518-530, comprising administering the parent oligomeric compound of the oligomeric compound of any of embodiments 452-517 to a mouse.

532. The method of any of embodiments 518-531, comprising contacting a cell with the parent oligomeric compound of the oligomeric compound of any of embodiments 452-517.

533. The method of embodiment 518-532, wherein each sugar moiety of the central region of the parent oligomeric compound is an unmodified 2′-β-D-deoxyribosyl sugar moiety, and wherein each internucleoside linkage of the central region of the parent oligomeric compound is a phosphorothioate internucleoside linkage.

534. A method of designing an oligomeric compound comprising starting with a parent oligomeric compound and changing the design of that compound in order to arrive at an oligomeric compound of any one of embodiments 452-517.

535. A method of designing an oligomeric compound comprising identifying a parent oligomeric compound and changing the design of that parent oligomeric compound to arrive at a second oligomeric compound, wherein the second oligomeric compound is an oligomeric compound of any one of embodiments 452-517.

536. A method of improving hepatotoxicity of an oligomeric compound comprising the steps of (i) identifying a parent oligomeric compound that has plasma ALT levels above 300 units per liter in a mouse, and (ii) providing an oligomeric compound according to any one of embodiments 452-517.

537. The method of embodiment 536, wherein the method designs an oligomeric compound with improved therapeutic index relative to the parent oligomeric compound.

538. The method of embodiment 534-537, wherein the method designs an oligomeric compound with lower hepatotoxicity relative to the parent oligomeric compound.

539. The method of embodiment 535-538, wherein the second oligomeric compound has an improved therapeutic index relative to the parent oligomeric compound.

540. The method of embodiment 535-539, wherein the second oligomeric compound has reduced hepatotoxicity in a mouse relative to the parent oligomeric compound.

541. The method of embodiment 540, wherein the oligomeric compound according to any one of embodiments 452-517 has reduced hepatotoxicity relative to the parent oligomeric compound.

542. A method comprising administering an oligomeric compound of any of embodiments 452-517 to a mouse and separately administering the parent oligomeric compound of the oligomeric compound of any of embodiments 452-517 to a second mouse, wherein the therapeutic index of the oligomeric compound of any of embodiments 452-517 is improved relative to the therapeutic index of the parent oligomeric compound.

543. The method of any of embodiments 518-542, wherein the level of p21 RNA is measured in the mouse, the cell, and/or the human subject.

544. A method comprising administering an oligomeric compound of any of embodiments 452-517 to a subject and measuring the level of p21 RNA in the subject.

545. The method of embodiment 543 or 544, wherein the subject is a mouse.

546. The method of embodiment 543 or 544, wherein the subject is a human.

547. The method of any of embodiments 543-546, wherein the p21 RNA level is measured within 24 hours of the administration.

548. The method of any of embodiments 437-441, wherein the p21 RNA level is measured 24-48 hours following the administration.

549. An oligomeric compound or composition of any one of embodiments 452-517, for use in medical therapy.

550. The method of any of embodiments 445-449, wherein the oligomeric compound is the oligomeric compound of any of embodiments 452-517.

551. An oligomeric compound comprising a modified oligonucleotide consisting of 12-21 linked nucleosides, wherein the modified oligonucleotide has the formula A-B-C, wherein A is a 5′-region, B is a central region, and C is a 3′-region; wherein:

the 5′-region consists of 1-5 linked nucleosides, wherein at least one nucleoside of the 5′-region is a modified nucleoside comprising a modified sugar; the 3′-region consists of 1-5 linked nucleosides wherein at least one nucleoside of the 3′-region is a modified nucleoside comprising a modified sugar; and the central region consists of 7-11 linked nucleosides, wherein the 5′-most portion of the central region has the following formula:

(N da )(N x )(N y )(N z )(N db )

wherein one of N x , N y , and N z , is a safety-enhancing nucleoside; the other two of N x , N y , and N z are independently selected from a DNA nucleoside, a DNA isomer, a modified DNA isomer, and a DNA mimic; and N da and N db are each independently selected from a DNA nucleoside, a DNA isomer, a modified DNA isomer, and a DNA mimic.

552. The oligomeric compound of embodiment 551, wherein the 5′-region consists of one nucleoside.

553. The oligomeric compound of embodiment 551, wherein the 5′-region consists of 2-5 linked nucleosides.

554. The oligomeric compound of embodiment 551, wherein the 5′-region consists of 2-4 linked nucleosides.

555. The oligomeric compound of embodiment 551, wherein the 5′-region consists of 2 linked nucleosides.

556. The oligomeric compound of embodiment 551, wherein the 5′-region consists of 3 linked nucleosides.

557. The oligomeric compound of embodiment 551, wherein the 5′-region consists of 4 linked nucleosides.

558. The oligomeric compound of embodiment 551, wherein the 5′-region consists of 5 linked nucleosides.

559. The oligomeric compound of any of embodiments 551-558, wherein each nucleoside of the 5′-region is a modified nucleoside.

560. The oligomeric compound of any of embodiments 551-559, wherein each nucleoside of the 5′-region is a modified nucleoside comprising a modified sugar.

561. The oligomeric compound of any of embodiments 551-560, wherein each modified nucleoside of the 5′-region has the same modification.

562. The oligomeric compound of and of embodiments 551-560, wherein at least two nucleosides of the 5′-region are modified nucleosides having different modifications.

563. The oligomeric compound of any of embodiments 551-562, wherein each nucleoside of the 5′-region comprises a 2′-modified ribosyl sugar moiety.

564. The oligomeric compound of any of embodiments 551-563, wherein at least one nucleoside of the 5′-region comprises a bicyclic furanosyl sugar moiety.

565. The oligomeric compound of any of embodiments 551-564, wherein each nucleoside of the 5′-region comprises a bicyclic furanosyl sugar moiety.

566. The oligomeric compound of any of embodiments 551-565, wherein at least one nucleoside of the 5′-region comprises a non-bicyclic sugar moiety.

567. The oligomeric compound of embodiment 566, wherein the non-bicyclic sugar moiety of the at least one nucleoside of the 5′-region is a 2′-substituted ribosyl sugar moiety.

568. The oligomeric compound of any of embodiments 551-567, wherein each nucleoside of the 5′-region comprises a non-bicyclic sugar moiety.

569. The oligomeric compound of embodiment 568, wherein each nucleoside of the 5′-region comprises a 2′-substituted furanosyl sugar moiety.

570. The oligomeric compound of any of embodiments 551-569, wherein each nucleoside of the 5′-region comprises a 2′-modified furanosyl sugar moiety independently selected from a bicyclic sugar moiety and a non-bicyclic 2′-substituted ribosyl sugar moiety.

571. The oligomeric compound of any of embodiments 551-570, wherein each nucleoside of the 5′-region comprises a bicyclic sugar moiety.

572. The oligomeric compound of any of embodiments 551-571, wherein each nucleoside of the 5′-region comprises a non-bicyclic 2′-substituted ribosyl sugar moiety.

573. The oligomeric compound of any of embodiments 551-572, wherein each bicyclic sugar moiety of the 5′-region is selected from among cEt, LNA, and ENA.

574. The oligomeric compound of any of embodiments 551-573, wherein each bicyclic sugar moiety of the 5′-region is a cEt sugar moiety.

575. The oligomeric compound of any of embodiments 551-574, wherein each bicyclic sugar moiety of the 5′-region is an LNA sugar moiety.

576. The oligomeric compound of any of embodiments 551-575, wherein each non-bicyclic sugar moiety of the 5′-region has a 2′-substituent selected from among 2′-MOE, 2′-OMe, and 2′-NMA.

577. The oligomeric compound of any of embodiments 551-576, wherein none of the nucleosides of the 5′-region comprise a sugar moiety having a 2′-F substituent.

578. The oligomeric compound of any of embodiments 551-577, wherein none of the nucleosides of the 5′-region comprise a sugar moiety having a 2′-MOE substituent.

579. The oligomeric compound of any of embodiments 551-578, wherein none of the nucleosides of the 5′-region comprise a sugar moiety having a 2′-OMe substituent.

580. The oligomeric compound of any of embodiments 551-579, wherein none of the nucleosides of the 5′-region comprise a cEt sugar moiety.

581. The oligomeric compound of any of embodiments 551-580, wherein none of the nucleosides of the 5′-region comprise a LNA sugar moiety.

582. The oligomeric compound of any of embodiments 551-581, wherein each nucleobase of the 5′-region is independently selected from among thymine, uracil, guanine, cytosine, 5-methylcytosine, and adenine.

583. The oligomeric compound of any of embodiments 551-582, wherein each internucleoside linkage of the 5′-region is selected from among phosphodiester and phosphorothioate internucleoside linkages.

584. The oligomeric compound of any of embodiments 551-583, wherein the 3′-region consists of one nucleoside.

585. The oligomeric compound of any of embodiments 551-583, wherein the 3′-region consists of 2-5 linked nucleosides.

586. The oligomeric compound of any of embodiments 551-583, wherein the 3′-region consists of 2-4 linked nucleosides.

587. The oligomeric compound of any of embodiments 551-583, wherein the 3′-region consists of 2 linked nucleosides.

588. The oligomeric compound of any of embodiments 551-583, wherein the 3′-region consists of 3 linked nucleosides.

589. The oligomeric compound of any of embodiments 551-583, wherein the 3′-region consists of 4 linked nucleosides.

590. The oligomeric compound of any of embodiments 551-583, wherein the 3′-region consists of 5 linked nucleosides.

591. The oligomeric compound of any of embodiments 551-590, wherein each nucleoside of the 3′-region is a modified nucleoside.

592. The oligomeric compound of any of embodiments 551-591, wherein each nucleoside of the 3′-region is a modified nucleoside comprising a modified sugar moiety.

593. The oligomeric compound of any of embodiments 551-592, wherein each modified nucleoside of the 3′-region has the same modification.

594. The oligomeric compound of and of embodiments 551-592, wherein at least two nucleosides of the 3′-region are modified nucleosides having different modifications.

595. The oligomeric compound of any of embodiments 551-594, wherein each nucleoside of the 3′-region comprises a 2′-modified ribosyl sugar moiety.

596. The oligomeric compound of any of embodiments 551-595, wherein at least one nucleoside of the 3′-region comprises a bicyclic furanosyl sugar moiety.

597. The oligomeric compound of any of embodiments 551-596, wherein each nucleoside of the 3′-region comprises a bicyclic furanosyl sugar moiety.

598. The oligomeric compound of any of embodiments 551-597, wherein at least one nucleoside of the 3′-region comprises a non-bicyclic sugar moiety.

599. The oligomeric compound of embodiment 598, wherein the non-bicyclic sugar moiety of the at least one nucleoside of the 3′-region is a 2′-substituted ribosyl sugar moiety.

600. The oligomeric compound of any of embodiments 551-599, wherein each nucleoside of the 3′-region comprises a non-bicyclic sugar moiety.

601. The oligomeric compound of embodiment 600, wherein each nucleoside of the 3′-region comprises a 2′-substituted furanosyl sugar moiety.

602. The oligomeric compound of any of embodiments 551-601, wherein each nucleoside of the 3′-region comprises a 2′-modified furanosyl sugar moiety independently selected from a bicyclic sugar moiety and a non-bicyclic 2′-substituted ribosyl sugar moiety.

603. The oligomeric compound of any of embodiments 551-602, wherein each nucleoside of the 3′-region comprises a bicyclic sugar moiety.

604. The oligomeric compound of any of embodiments 551-602, wherein each nucleoside of the 3′-region comprises a non-bicyclic 2′-substituted ribosyl sugar moiety.

605. The oligomeric compound of any of embodiments 551-603, wherein each bicyclic sugar moiety of the 3′-region is selected from among cEt, LNA, and ENA.

606. The oligomeric compound of any of embodiments 551-605, wherein each bicyclic sugar moiety of the 3′-region is a cEt sugar moiety.

607. The oligomeric compound of any of embodiments 551-606, wherein each bicyclic sugar moiety of the 3′-region is an LNA sugar moiety.

608. The oligomeric compound of any of embodiments 551-607, wherein each non-bicyclic sugar moiety of the 3′-region has a 2′-substituent selected from among 2′-MOE, 2′-OMe, and 2′-NMA.

609. The oligomeric compound of any of embodiments 551-608, wherein none of the nucleosides of the 3′-region comprise a sugar moiety having a 2′-F substituent.

610. The oligomeric compound of any of embodiments 551-609, wherein none of the nucleosides of the 3′-region comprise a sugar moiety having a 2′-MOE substituent.

611. The oligomeric compound of any of embodiments 551-610, wherein none of the nucleosides of the 3′-region comprise a sugar moiety having a 2′-OMe substituent.

612. The oligomeric compound of any of embodiments 551-611, wherein none of the nucleosides of the 3′-region comprise a cEt sugar moiety.

613. The oligomeric compound of any of embodiments 551-612, wherein none of the nucleosides of the 3′-region comprise a LNA sugar moiety.

614. The oligomeric compound of any of embodiments 551-613, wherein each nucleobase of the 3′-region is independently selected from among thymine, uracil, guanine, cytosine, 5-methylcytosine, and adenine.

615. The oligomeric compound of any of embodiments 551-614, wherein each internucleoside linkage of the 3′-region is selected from among phosphodiester and phosphorothioate internucleoside linkages.

616. The oligomeric compound of any of embodiments 551-615, wherein the modified nucleosides of the 5′-region have the same modifications as the modifications of the modified nucleosides of the 3′-region.

617. The oligomeric compound of any of embodiments 551-615, wherein at least one modified nucleoside of the 5′-region and one modified nucleoside of the 3′-region comprise modifications that differ from one another.

618. The oligomeric compound of any of embodiments 551-617, wherein the 5′-region and the 3′-region together include at least one non-bicyclic 2′-substituted modified nucleoside and at least one bicyclic nucleoside.

619. The oligomeric compound of any of embodiment 618, where the bicyclic nucleoside is a cEt nucleoside.

620. The oligomeric compound of embodiment 618, where the bicyclic nucleoside is an LNA nucleoside.

621. The oligomeric compound of any of embodiments 618-620, wherein the non-bicyclic 2′-modified nucleoside is a 2′-MOE nucleoside.

622. The oligomeric compound of any of embodiments 618-620, wherein the non-bicyclic 2′-modified nucleoside is a 2′-OMe nucleoside.

623. The oligomeric compound of any of embodiments 618-622, wherein at least one nucleoside of the 5′-region or the 3′-region is an unmodified DNA nucleoside.

624. The oligomeric compound of any of embodiments 551-623, wherein the central region has the formula:

(N da )(N x )(N y )(N z )(N db )(N dc ) q

wherein each N dc is independently selected from an unmodified DNA nucleoside, a DNA isomer, a 2′-modified DNA isomer, and a DNA mimic; and q is 2-6.

625. The oligomeric compound of any of embodiments 551-624, wherein the central region consists of 7 linked nucleosides.

626. The oligomeric compound of any of embodiments 551-624, wherein the central region consists of 8 linked nucleosides.

627. The oligomeric compound of any of embodiments 551-624, wherein the central region consists of 9 linked nucleosides.

628. The oligomeric compound of any of embodiments 551-624, wherein the central region consists of 10 linked nucleosides.

629. The oligomeric compound of any of embodiments 551-624, wherein the central region consists of 11 linked nucleosides.

630. The oligomeric compound of any of embodiments 551-629, wherein Nx is the safety-enhancing nucleoside.

631. The oligomeric compound of any of embodiments 551-629, wherein Ny is the safety-enhancing nucleoside.

632. The oligomeric compound of any of embodiments 551-629, wherein Nz is the safety-enhancing nucleoside.

633. The oligomeric compound of any of embodiments 551-632, wherein the safety enhancing nucleoside is a DNA isomer or a modified DNA isomer, or a modified nucleoside comprising either a sugar surrogate, a bicyclic furanosyl sugar moiety, or a non-bicyclic modified furanosyl sugar moiety.

634. The oligomeric compound of any of embodiments 551-33, wherein the safety enhancing nucleoside is a DNA isomer or a modified DNA isomer, or comprises either a sugar surrogate, a bicyclic furanosyl sugar moiety, a non-bicyclic, 2′-modified furanosyl sugar moiety, a non-bicyclic 3′-modified furanosyl sugar moiety, a non-bicyclic, 4′-modified furanosyl sugar moiety, or a non-bicyclic 5′-modified furanosyl sugar moiety.

635. The oligomeric compound of any of embodiments 551-634, wherein the safety enhancing nucleoside comprises a sugar surrogate selected from a morpholino, a modified morpholino, a modified cyclohexenyl, or a modified tetrahydropyran.

636. The oligomeric compound of any of embodiments 551-634, wherein the safety enhancing nucleoside comprises a sugar surrogate selected from a morpholino, a modified morpholino, CeNA, F-CeNA, HNA, OMe-HNA or F-HNA.

637. The oligomeric compound of any of embodiments 551-634, wherein the safety enhancing nucleoside is a DNA isomer comprising a sugar moiety selected from among 2′-β-D-deoxyxylosyl, 2′-α-L-deoxyribosyl, 2′-β-L-deoxyribosyl, 2′-α-D-deoxyxylosyl, 2′-α-D-deoxyribosyl, 2′-α-L-deoxyxylosyl, and 2′-β-L-deoxyxylosyl.

638. The oligomeric compound of any of embodiments 551-634, wherein the safety enhancing nucleoside is a DNA isomer comprising a sugar moiety selected from among 2′-β-D-deoxyxylosyl, 2′-α-L-deoxyribosyl, and 2′-O-L-deoxyribosyl.

639. The oligomeric compound of any of embodiments 551-634, wherein the safety enhancing nucleoside is a modified DNA isomer comprising a 2′-modified sugar moiety, wherein the sugar moiety has the conformation 2′-β-D-deoxyxylosyl, 2′-α-L-deoxyribosyl, 2′-β-L-deoxyribosyl, 2′-α-D-deoxyxylosyl, 1, 2′-α-L-deoxyxylosyl, and 2′-β-L-deoxyxylosyl and the 2′ position is further substituted with a hydroxyl, a fluoro, or O—C 1 -C 10 alkoxy substituent.

640. The oligomeric compound of any of embodiments 551-634, wherein the safety enhancing nucleoside is a modified DNA isomer comprising a 2′-modified sugar moiety, wherein the sugar moiety has the conformation 2′-β-D-deoxyxylosyl, 2′-α-L-deoxyribosyl, 2′-β-L-deoxyribosyl, 2′-α-D-deoxyxylosyl, 1, 2′-α-L-deoxyxylosyl, and 2′-β-L-deoxyxylosyl and the 2′ position is further substituted with a hydroxyl, a fluoro, or OMe substituent.

641. The oligomeric compound of any of embodiments 551-634, wherein the safety enhancing nucleoside is a modified DNA isomer comprising a 2′-modified sugar moiety, wherein the sugar moiety has the conformation 2′-β-D-deoxyxylosyl, 2′-α-L-deoxyribosyl, 2′-β-L-deoxyribosyl, 2′-α-D-deoxyxylosyl, 1, 2′-α-L-deoxyxylosyl, and 2′-β-L-deoxyxylosyl and the 2′ position is further substituted with a fluoro or OMe substituent.

642. The oligomeric compound of any of embodiments 551-634, wherein the safety enhancing nucleoside is a modified DNA isomer comprising a sugar moiety selected from among 2′-β-D-deoxyxylosyl, 2′-α-L-deoxyribosyl, and 2′-β-L-deoxyribosyl and the 2′ position is further substituted with a hydroxyl, fluoro, or OMe substituent.

643. The oligomeric compound of any of embodiments 551-634, wherein the safety enhancing nucleoside is a modified nucleoside comprising a bicyclic furanosyl sugar moiety 644. The oligomeric compound of any of embodiments 551-634, wherein the safety enhancing nucleoside is selected from among cEt, LNA, α-L-LNA, and ENA.

645. The oligomeric compound of any of embodiments 551-634, wherein the safety enhancing nucleoside comprises a 2′-substituted furanosyl sugar moiety.

646. The oligomeric compound of embodiment 645, wherein the 2′-substituted furanosyl sugar moiety of the safety enhancing nucleoside has a 2′ substituent selected from: halo, allyl, amino, azido, SH, CN, OCN, CF 3 , OCF 3 , O—C 1 -C 10 alkoxy, O-C1-C10 substituted alkoxy, C 1 -C 10 alkyl, C 1 -C 10 substituted alkyl, S-alkyl, N(R m )-alkyl, O-alkenyl, S-alkenyl, N(R m )-alkenyl, O-alkynyl, S-alkynyl, N(R m )-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH 2 ) 2 SCH 3 , O(CH 2 ) 2 ON(R m )(R n ) or OCH 2 C(═O)—N(R m )(R n ), where each R m and R n is, independently, H, an amino protecting group, or substituted or unsubstituted C 1 -C 10 alkyl.

647. The oligomeric compound of embodiment 645, wherein the 2′-substituted furanosyl sugar moiety of the safety enhancing nucleoside has a 2′ substituent selected from: halo, O—C 1 -C 10 alkoxy, O—C 1 -C 10 substituted alkoxy, C 1 -C 10 alkyl, C 1 -C 10 substituted alkyl, S-alkyl, N(R m )-alkyl, O(CH 2 ) 2 ON(R m )(R n ) or OCH 2 C(═O)—N(R m )(R n ), where each R m and R n is, independently, H, an amino protecting group, or substituted or unsubstituted C 1 -C 10 alkyl.

648. The oligomeric compound of embodiment 645, wherein the 2′-substituted furanosyl sugar moiety of the safety enhancing nucleoside has a 2′ substituent selected from: fluoro, OMe, MOE, NMA.

649. The oligomeric compound of any of embodiments 551-648, wherein the safety enhancing nucleoside comprises a 2′-substituted furanosyl sugar moiety comprising a 2′-OMe or 2′-MOE.

650. The oligomeric compound of any of embodiments 551-649, wherein the safety enhancing nucleoside comprises a 2′-substituted furanosyl sugar moiety comprising a 2′-OMe.

651. The oligomeric compound of any of embodiments 551-650, wherein the safety enhancing nucleoside comprises a 2′-OMe modified 2′-β-D-deoxyribosyl sugar moiety.

652. The oligomeric compound of any of embodiments 551-634, wherein the safety enhancing nucleoside comprises a 3′-modified furanosyl sugar moiety having a 3′ substituent selected from: halo, allyl, amino, azido, SH, CN, CF 3 , OCF 3 , C 1 -C 10 alkyl, C 1 -C 10 substituted alkyl, S-alkyl, N(R m )-alkyl, N(R m )-alkenyl, N(R m )-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, or aralkyl.

653. The oligomeric compound of any of embodiments 551-634 or embodiment 652, wherein the safety enhancing nucleoside comprises a 3′-modified furanosyl sugar moiety having a 3′ substituent selected from: C 1 -C 10 alkyl, or C 1 -C 10 substituted alkyl.

654. The oligomeric compound of any of embodiments 551-634 or 652-653, wherein the safety enhancing nucleoside comprises a 3′-methyl furanosyl sugar moiety.

655. The oligomeric compound of any of embodiments 551-634, wherein the safety enhancing nucleoside comprises a 4′-modified furanosyl sugar moiety having a 4′ substituent selected from: halo, allyl, amino, azido, SH, CN, OCN, CF 3 , OCF 3 , O—C 1 -C 10 alkoxy, O—C 1 -C 10 substituted alkoxy, C 1 -C 10 alkyl, C 1 -C 10 substituted alkyl, S-alkyl, N(R m )-alkyl, O-alkenyl, S-alkenyl, N(R m )-alkenyl, O-alkynyl, S-alkynyl, N(R m )-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH 2 ) 2 SCH 3 , O(CH 2 ) 2 ON(R m )(R n ) or OCH 2 C(═O)—N(R m )(R n ), where each R m and Rn is, independently, H, an amino protecting group, or substituted or unsubstituted C 1 -C 10 alkyl.

656. The oligomeric compound of any of embodiments 551-634 or 655, wherein the safety enhancing nucleoside comprises a 4′-modified furanosyl sugar moiety having a 4′-methyl.

657. The oligomeric compound of any of embodiments 551-634, wherein the safety enhancing nucleoside has the structure shown below, wherein R represents an optional 2′ substituent group and Bx is a heterocyclic base moiety:

658. The oligomeric compound of embodiment 657, wherein in R is selected from among H, OH, OMe, F, or MOE.

659. The oligomeric compound of any of embodiments 551-634, wherein the safety enhancing nucleoside comprises a 5′-modified furanosyl sugar moiety having a 5′ substituent selected from: halo, allyl, amino, azido, SH, CN, OCN, CF 3 , OCF 3 , O—C 1 -C 10 alkoxy, O—C 1 -C 10 substituted alkoxy, C 1 -C 10 alkyl, C 1 -C 10 substituted alkyl, S-alkyl, N(R m )-alkyl, O-alkenyl, S-alkenyl, N(R m )-alkenyl, O-alkynyl, S-alkynyl, N(R m )-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH 2 ) 2 SCH 3 , O(CH 2 ) 2 ON(R m )(R n ) or OCH 2 C(═O)—N(R m )(R n ), where each R m and R n is, independently, H, an amino protecting group, or substituted or unsubstituted C 1 -C 10 alkyl.

660. The oligomeric compound of any of embodiments 551-634 or 659, wherein the safety enhancing nucleoside comprises a 5′-modified furanosyl sugar moiety with a 5′ substituent selected from: 5′-methyl, 5′-ethyl or a 5′-allyl.

661. The oligomeric compound of any of embodiments 551-634 or 659-660, wherein the safety enhancing nucleoside comprises a 5′-modified furanosyl sugar moiety with a 5′ substituent selected from: 5′-(R)-methyl- or 5′-(R)-ethyl.

662. The oligomeric compound of any of embodiments 551-634 or 659-661, wherein the safety enhancing nucleoside comprises a 5′-(R)-methyl-2′-β-D-deoxyribosyl sugar moiety.

663. The oligomeric compound of any of embodiments 551-634 or 659-662, wherein the safety enhancing nucleoside comprises a 5′-(R)-ethyl-2′-β-D-deoxyribosyl sugar moiety.

664. The oligomeric compound of any of embodiments 551-663, wherein the safety enhancing nucleoside does not comprise a 2′-F modified sugar moiety.

665. The oligomeric compound of any of embodiments 551-664, wherein the safety enhancing nucleoside does not comprise a cEt modified sugar moiety.

666. The oligomeric compound of any of embodiments 551-665, wherein the safety enhancing nucleoside does not comprise a 2′-MOE modified sugar moiety.

667. The oligomeric compound of any of embodiments 551-666, wherein the safety enhancing nucleoside comprises a hypoxanthine nucleobase.

668. The oligomeric compound of any of embodiments 551-667, wherein the safety enhancing nucleoside comprises a nucleobase selected from among A, T, G, C, m C, and U.

669. The oligomeric compound of any of embodiments 551-668, wherein the safety enhancing nucleoside is a modified nucleoside other than cEt, MOE, LNA, or FANA.

670. The oligomeric compound of any of embodiments 551-669, wherein each Nd is independently selected from among a DNA nucleoside, a DNA isomer, a modified DNA isomer, and a DNA mimic.

671. The oligomeric compound of embodiment 670, wherein each DNA isomer comprises a sugar moiety selected from among 2′-β-D-deoxyxylosyl, 2′-α-L-deoxyribosyl, 2′-β-L-deoxyribosyl, 2′-α-D-deoxyxylosyl, 2′-α-D-deoxyribosyl, 2′-α-L-deoxyxylosyl, and 2′-β-L-deoxyxylosyl.

672. The oligomeric compound of embodiment 671, wherein each DNA isomer comprises a sugar moiety selected from among 2′-β-D-deoxyxylosyl, 2′-α-L-deoxyribosyl, and 2′-β-L-deoxyribosyl.

673. The oligomeric compound of embodiment 670, wherein each modified DNA isomer comprises a 2′-modified sugar moiety, wherein the sugar moiety has the conformation 2′-β-D-deoxyxylosyl, 2′-α-L-deoxyribosyl, 2′-β-L-deoxyribosyl, 2′-α-D-deoxyxylosyl, 1, 2′-α-L-deoxyxylosyl, and 2′-β-L-deoxyxylosyl and the 2′ position is further substituted with a hydroxyl, a fluoro, or O—C 1 -C 10 alkoxy substituent.

674. The oligomeric compound of embodiment 673, wherein each modified DNA isomer comprises a 2′-modified sugar moiety, wherein the sugar moiety has the conformation 2′β-D-deoxyxylosyl, 2′-α-L-deoxyribosyl, 2′β-L-deoxyribosyl, 2′-α-D-deoxyxylosyl, 1, 2′-α-L-deoxyxylosyl, and 2′-β-L-deoxyxylosyl and the 2′ position is further substituted with a hydroxyl, a fluoro, or OMe substituent.

675. The oligomeric compound of embodiment 674, wherein each modified DNA isomer comprises a 2′-modified sugar moiety, wherein the sugar moiety has the conformation 2′β-D-deoxyxylosyl, 2′-α-L-deoxyribosyl, 2′β-L-deoxyribosyl, 2′-α-D-deoxyxylosyl, 1, 2′-α-L-deoxyxylosyl, and 2′-β-L-deoxyxylosyl and the 2′ position is further substituted with a fluoro or OMe substituent.

676. The oligomeric compound of embodiment 675, wherein each modified DNA isomer comprises a 2′-modified sugar moiety, wherein the sugar moiety is selected from among 2′β-D-deoxyxylosyl, 2′-α-L-deoxyribosyl, and 2′-β-L-deoxyribosyl and the 2′ position is further substituted with a hydroxyl, fluoro, or OMe substituent.

677. The oligomeric compound of embodiment 670, wherein each DNA mimic comprises a structure represented by one of the formulas below:

wherein X is O or S and Bx represents a heterocylic base moiety.

678. The oligomeric compound of embodiment 670, wherein each DNA mimic comprises a structure represented by one of the formulas below:

wherein X is O or S, Bx represents a heterocyclic base moiety, and R1 is selected from among H, OH, halo, allyl, amino, azido, SH, CN, OCN, CF 3 , OCF 3 , O—C 1 -C 10 alkoxy, O—C 1 -C 10 substituted alkoxy, C 1 -C 10 alkyl, C 1 -C 10 substituted alkyl, S-alkyl, N(R m )-alkyl, O-alkenyl, S-alkenyl, N(R m )-alkenyl, O-alkynyl, S-alkynyl, N(R m )-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH 2 ) 2 SCH 3 , O(CH 2 ) 2 ON(R m )(R n ) or OCH 2 C(═O)—N(R m )(R n ), where each R m and R n is, independently, H, an amino protecting group, or substituted or unsubstituted C 1 -C 10 alkyl.

679. The oligomeric compound of embodiment 678, wherein R1 is H, OH, OMe, or F.

680. The oligomeric compound of embodiment 678, wherein R1 is not F.

681. The oligomeric compound of embodiment 670, wherein each DNA mimic comprises a structure represented by the formula below:

wherein X is O, Bx represents a heterocyclic base moiety, and R1 is H.

682. The oligomeric compound of embodiment 670, wherein DNA mimic has a sugar moiety selected from among: 5′-methyl-2′-β-D-deoxyribosyl, 5′-ethyl-2′-β-D-deoxyribosyl, and 5′-allyl-2′-β-D-deoxyribosyl.

683. The oligomeric compound of embodiment 670, wherein DNA mimic comprises a 2′-fluoro-β-D-arabinofuranosyl sugar moiety

684. The oligomeric compound of embodiment 670, wherein the DNA mimic does not comprise a 2′-fluoro-β-D-arabinofuranosyl sugar moiety.

685. The oligomeric compound of any of embodiments 551-684, wherein each Nd is a DNA nucleoside.

686. The oligomeric compound of any of embodiments 551-685, wherein the central region comprises no more than four nucleosides selected from among DNA isomers, modified DNA isomers, and DNA mimics.

687. The oligomeric compound of any of embodiments 551-685, wherein the central region comprises no more than three nucleosides selected from among DNA isomers, modified DNA isomers, and DNA mimics.

688. The oligomeric compound of any of embodiments 551-685, wherein the central region comprises no more than two nucleosides selected from among DNA isomers, modified DNA isomers, and DNA mimics.

689. The oligomeric compound of any of embodiments 551-685, wherein the central region comprises no more than one nucleoside selected from among DNA isomers, modified DNA isomers, and DNA mimics.

690. The oligomeric compound of any of embodiments 551-689, wherein the central region contains exactly one safety enhancing nucleoside and the remainder of nucleosides in the central region are DNA nucleosides.

691. The oligomeric compound of any of embodiments 551-690, wherein at least one internucleoside linkage of the central region selected from among: the internucleoside Nda to Nx, Nx to Ny, Ny to Nz, or Nz to the adjacent Ndb is a neutral internucleoside linkage.

692. The oligomeric compound of embodiments 691, wherein the neutral linkage is a phosphonate internucleoside linkage.

693. The oligomeric compound of embodiments 691, wherein the neutral linkage is a methoxypropyl internucleoside linkage.

694. The oligomeric compound of embodiments 691, wherein each remaining internucleoside linkage is a phosphodiester or phosphorothioate internucleoside linkage.

695. A chirally enriched population of modified oligonucleotides of any of embodiments 551-690, wherein the central region has at least one particular phorphorothioate internucleoside linkage having a particular stereochemical configuration.

696. The chirally enriched population of embodiment 695, wherein the central region has at least one phorphorothioate internucleoside linkage having the (Sp) configuration.

697. The chirally enriched population of embodiment 695, wherein central region has at least one phorphorothioate internucleoside linkage having the (Rp) configuration.

698. The chirally enriched population of embodiment 695, wherein the central region has a particular, independently selected stereochemical configuration at each phosphorothioate internucleoside linkage.

699. The chirally enriched population of embodiment 698, wherein the each phosphorothioate internucleoside linkage of the central region has the (Sp) configuration.

700. The chirally enriched population of embodiment 698, wherein the central region has one phosphorothioate internucleoside linkage having the (Rp) configuration and wherein each remaining central region phosphorothioate internucleoside linkage has the (Sp) configuration.

701. The chirally enriched population of embodiment 695, wherein the central region has an (Rp) phosphorothioate internucleoside linkage adjacent to an (Sp) phosphorothioate internucleoside linkage.

702. The chirally enriched population of embodiment 695, wherein the central region has an (Rp) phosphorothioate internucleoside linkage adjacent to a second (Rp) phosphorothioate internucleoside linkage.

703. The chirally enriched population of embodiment 695, wherein the central region has an (Rp) phosphorothioate internucleoside linkage adjacent to a second (Rp) phosphorothioate internucleoside linkage, and wherein each remaining central region phosphorothioate internucleoside linkage has the (Sp) configuration.

704. The chirally enriched population of any of embodiments 696, 697, 701, or 702 wherein each phosphorothioate internucleoside linkage that does not have the (Rp) or (Sp) configuration is stereorandom.

705. The oligomeric compound of any of embodiments 551-704 comprising a conjugate group.

706. The oligomeric compound of embodiment 705, wherein the conjugate group comprises a linking group attaching the remainder of the conjugate group to the modified oligonucleotide, wherein the linking group comprises 1-5 nucleosides.

707. The oligomeric compound of any of embodiments 1-705, wherein the oligomeric compound does not comprise additional nucleosides beyond those of the modified oligonucleotide.

708. The oligomeric compound of any of embodiments 551-707, wherein the nucleobase sequence of the modified oligonucleotide is complementary to a target RNA.

709. The oligomeric compound of embodiment 708, wherein the nucleobase sequence of the modified oligonucleotide is at least 85% complementary to the target RNA.

710. The oligomeric compound of embodiment 708, wherein the nucleobase sequence of the modified oligonucleotide is at least 90% complementary to the target RNA.

711. The oligomeric compound of embodiment 708, wherein the nucleobase sequence of the modified oligonucleotide is at least 95% complementary to the target RNA.

712. The oligomeric compound of embodiment 711, wherein the nucleobase sequence of the modified oligonucleotide is 100% complementary to the target RNA.

713. The oligomeric compound of any of embodiments 708-712, wherein the target RNA is a target mRNA or a target pre-mRNA.

714. The oligomeric compound of embodiment 713, wherein the target mRNA or target pre-mRNA is not a mouse, rat, monkey, or human PTEN RNA.

715. The oligomeric compound of embodiment 713 or 714, wherein the target mRNA or target pre-mRNA is not a mouse, rat, monkey, or human SRB-1 RNA.

716. The oligomeric compound of any of embodiments 713-715, wherein the target mRNA or target pre-mRNA is not a mouse, rat, monkey, or human MYD88 RNA.

717. The oligomeric compound of any of embodiments 713-716, wherein the target mRNA or target pre-mRNA is not a mouse, rat, monkey, or human HTT RNA, is not a mouse, rat, monkey, or human SOD1 RNA, and is not a mouse, rat, monkey, or human alpha-synuclein RNA.

718. The oligomeric compound of any of embodiments 708-717, wherein the target RNA is a human RNA.

719. The oligomeric compound of any of embodiments 708-718, wherein the target RNA is expressed in the liver.

720. The oligomeric compound of any of embodiments 708-719, wherein the target RNA is a liver target.

721. The oligomeric compound of any of embodiments 708-718, wherein the target RNA is not expressed in the liver.

722. The oligomeric compound of any of embodiments 708-718 or 721, wherein the target RNA is not a liver target.

723. The oligomeric compound of any of embodiments 708-722, wherein modulation of the expression of the target RNA in the liver is associated with treating a disorder or condition.

724. The oligomeric compound of embodiment 723, wherein the disorder or condition is a liver disorder or condition.

725. The oligomeric compound of any of embodiments 708-724, wherein the target RNA is expressed in the central nervous system.

726. The oligomeric compound of any of embodiments 708-724, wherein the target RNA is not expressed in the central nervous system.

727. The oligomeric compound of any of embodiments 708-725, wherein the target RNA is a central nervous system target.

728. The oligomeric compound of any of embodiments 708-726, wherein the target RNA is not a central nervous system target.

729. The oligomeric compound of any of embodiments 708-727, wherein the target RNA is a MeCP2, DUX4, HDAC2, APP, Ataxin 1, Ataxin 2, Ataxin 3, Ataxin 6, Ataxin 7, C9ORF72, UBE3A, Prion, PMP22, Tau, LRRK2, LINGO2, GYS1, KCNT1, IRF8, Progranulin, or GFAP RNA.

730. The oligomeric compound of any of embodiments 708-729, wherein the target RNA is a HTT RNA.

731. The oligomeric compound of embodiment 729, wherein the target RNA is a MeCP2 RNA.

732. The oligomeric compound of embodiment 729, wherein the target RNA is a DUX4 RNA.

733. The oligomeric compound of embodiment 729, wherein the target RNA is a HDAC2 RNA.

734. The oligomeric compound of embodiment 729, wherein the target RNA is a Ataxin 1 RNA.

735. The oligomeric compound of embodiment 729, wherein the target RNA is a Ataxin 2 RNA.

736. The oligomeric compound of embodiment 729, wherein the target RNA is a Ataxin 3 RNA.

737. The oligomeric compound of embodiment 729, wherein the target RNA is a Ataxin 6 RNA.

738. The oligomeric compound of embodiment 729, wherein the target RNA is a Ataxin 7 RNA.

739. The oligomeric compound of embodiment 729, wherein the target RNA is a C9ORF72 RNA.

740. The oligomeric compound of embodiment 708-727, wherein the target RNA is an alpha-synuclein RNA.

741. The oligomeric compound of embodiment 729, wherein the target RNA is an UBE3A RNA.

742. The oligomeric compound of any of embodiments 708-727, wherein the target RNA is a SOD1 RNA.

743. The oligomeric compound of any of embodiments 708-727, wherein the target RNA is a Prion RNA.

744. The oligomeric compound of any of embodiments 708-727, wherein the target RNA is a PMP22 RNA.

745. The oligomeric compound of any of embodiments 708-727, wherein the target RNA is a Tau RNA.

746. The oligomeric compound of any of embodiments 708-727, wherein the target RNA is a LRRK2 RNA.

747. The oligomeric compound of any of embodiments 708-727, wherein the target RNA is an APP RNA.

748. The oligomeric compound of any of embodiments 708-727, wherein the target RNA is a LINGO2 RNA.

749. The oligomeric compound of any of embodiments 708-727, wherein the target RNA is a GYS1 RNA.

750. The oligomeric compound of any of embodiments 708-727, wherein the target RNA is a KCNT1 RNA.

751. The oligomeric compound of any of embodiments 708-727, wherein the target RNA is a IRF8 RNA.

752. The oligomeric compound of any of embodiments 708-727, wherein the target RNA is a Progranulin RNA.

753. The oligomeric compound of any of embodiments 708-727, wherein the target RNA is a GFAP RNA.

754. The oligomeric compound of any of embodiments 725-753, wherein modulation of the expression of the target RNA in the central nervous system is associated with treating a disorder or condition.

755. The oligomeric compound of embodiment 754, wherein the disorder or condition is a neurological disorder or condition.

756. The oligomeric compound of embodiment 754-755, wherein the disorder or condition alters the function of sensory or motor neurons.

757. The oligomeric compound of any of embodiments 754-756, wherein the disorder or condition alters the function of sensory neurons.

758. The oligomeric compound of any of embodiments 754-757, wherein the disorder or condition alters the function of motor neurons.

759. The oligomeric compound of any of embodiments 754-758, wherein the disorder or condition alters the function of glial cells.

760. The oligomeric compound of any of embodiments 754-759, wherein the disorder or condition alters the function of astrocytes.

761. The oligomeric compound of any of embodiments 754-760, wherein the disorder or condition alters the function of oligodendrocytes.

762. The oligomeric compound of any of embodiments 754-761, wherein the disorder or condition alters the function of microglia.

763. The oligomeric compound of any of embodiments 754-762, wherein the disorder or condition alters the function of ependymal cells.

764. The oligomeric compound of any of embodiments 754-763, wherein the disorder or condition is Alzheimer's Disease, Amyotrophic Lateral Sclerosis, Parkinson's Disease, a Spinocerebellar ataxia, Angelman Syndrome, Alexander's Disease, Lafora Disease, Charcot-Marie Tooth Disease, Prion Disease, a dementia, neurodegeneration, MeCP2 Duplication Syndrome, encephalopathy, neuroinflammation, or multiple sclerosis.

765. The oligomeric compound of embodiment 764, wherein the disorder or condition is Alzheimer's Disease.

766. The oligomeric compound of embodiment 764, wherein the disorder or condition is Amyotrophic Lateral Sclerosis.

767. The oligomeric compound of embodiment 764, wherein the disorder or condition is Parkinson's Disease.

768. The oligomeric compound of embodiment 764, wherein the disorder or condition is a Spinocerebellar ataxia.

769. The oligomeric compound of embodiment 764, wherein the disorder or condition is Angelman Syndrome.

770. The oligomeric compound of embodiment 764, wherein the disorder or condition is Alexander's Disease.

771. The oligomeric compound of embodiment 764, wherein the disorder or condition is Lafora Disease.

772. The oligomeric compound of embodiment 764, wherein the disorder or condition is Charcot-Marie Tooth Disease.

773. The oligomeric compound of embodiment 764, wherein the disorder or condition is Prion Disease.

774. The oligomeric compound of embodiment 764, wherein the disorder or condition is a dementia.

775. The oligomeric compound of embodiment 764, wherein the disorder or condition is neurodegeneration.

776. The oligomeric compound of embodiment 764, wherein the disorder or condition is MeCP2 Duplication Syndrome.

777. The oligomeric compound of embodiment 764, wherein the disorder or condition is encephalopathy.

778. The oligomeric compound of embodiment 764, wherein the disorder or condition is neuroinflammation.

779. The oligomeric compound of embodiment 764, wherein the disorder or condition is multiple sclerosis.

780. The oligomeric compound of any of embodiments 551-779, wherein the parent oligomeric compound of the oligomeric compound of any of embodiments 551-779 is cytotoxic in vitro.

781. The oligomeric compound of embodiment 780, wherein the parent oligomeric compound is cytotoxic in a standard in vitro cytotoxicity assay.

782. The oligomeric compound of any of embodiments 551-781 wherein administration to a mouse of the parent oligomeric compound of the oligomeric compound of any of embodiments 551-781 is hepatotoxic to the mouse.

783. The oligomeric compound of embodiment 782, wherein the administration of the parent oligomeric compound to the mouse is systemic administration.

784. The oligomeric compound of embodiment 783, wherein the systemic administration is subcutaneous administration.

785. The oligomeric compound of any of embodiments 782-784, wherein the mouse is a CD-1 mouse.

786. The oligomeric compound of any of embodiments 782-784, wherein the mouse is a C 57 BL/6 mouse.

787. The oligomeric compound of any of embodiments 782-784, wherein the mouse is a BALB/c mouse.

788. The oligomeric compound of any of embodiments 782-784, wherein the plasma ALT level in the mouse is higher than 500 units per liter following the administration of the parent oligomeric compound.

789. The oligomeric compound of any of embodiments 782-788, wherein the plasma AST level in the mouse is higher than 500 units per liter following the administration of the parent oligomeric compound.

790. The oligomeric compound of any of embodiments 782-789, wherein the plasma ALT level in the mouse is higher than 1000 units per liter following the administration of the parent oligomeric compound.

791. The oligomeric compound of any of embodiments 782-790, wherein the plasma AST level in the mouse is higher than 1000 units per liter following the administration of the parent oligomeric compound.

792. The oligomeric compound of any of embodiments 782-791, wherein the hepatotoxicity is measured 24-48 hours following the administration of the parent oligomeric compound.

793. The oligomeric compound of any of embodiments 782-791, wherein the hepatotoxicity is measured 72 hours following the administration of the parent oligomeric compound.

794. The oligomeric compound of any of embodiments 782-791, wherein the hepatotoxicity is measured 3 days following the administration of the parent oligomeric compound.

795. The oligomeric compound of any of embodiments 782-791, wherein the hepatotoxicity is measured 5 days following the administration of the parent oligomeric compound.

796. The oligomeric compound of any of embodiments 782-791, wherein the hepatotoxicity is measured 7 days following the administration of the parent oligomeric compound.

797. The oligomeric compound of any of embodiments 782-791, wherein the hepatotoxicity is measured 10 days following the administration of the parent oligomeric compound.

798. The oligomeric compound of any of embodiments 782-791, wherein the hepatotoxicity is measured 14 days following the administration of the parent oligomeric compound.

799. The oligomeric compound of any of embodiments 782-791, wherein 1-10 mg/kg of the parent oligomeric compound is administered to the mouse.

800. The oligomeric compound of any of embodiments 782-791, wherein 10-25 mg/kg of the parent oligomeric compound is administered to the mouse.

801. The oligomeric compound of any of embodiments 782-791, wherein 25-50 mg/kg of the parent oligomeric compound is administered to the mouse.

802. The oligomeric compound of any of embodiments 782-791, wherein 50-100 mg/kg of the parent oligomeric compound is administered to the mouse.

803. The oligomeric compound of any of embodiments 782-791, wherein 100-150 mg/kg of the parent oligomeric compound is administered to the mouse.

804. The oligomeric compound of any of embodiments 782-791, wherein the mouse is a BALB/c mouse, wherein 150 mg/kg of the parent oligomeric compound is administered to the mouse, and wherein the plasma ALT level in the mouse is measured 72 hours following the administration of the parent oligomeric compound.

805. The oligomeric compound of any of embodiments 551-804, wherein administration of 50 mg/kg of the oligomeric compound of any of embodiments 551-804 to a mouse is not hepatotoxic to the mouse.

806. The oligomeric compound of embodiment 805, wherein plasma ALT level in the mouse is lower than 100 units per liter following the administration of the oligomeric compound of embodiment 805.

807. The oligomeric compound of embodiment 805 or 806, wherein plasma ALT level in the mouse is at least 10-fold lower than plasma ALT level in a mouse administered the parent oligomeric compound of the oligomeric compound of embodiment 384 or 385, wherein the administrations and plasma ALT measurements of both the oligomeric compound of embodiment 384 or 385 and the parent oligomeric compound are completed in the same way.

808. The oligomeric compound of embodiment 807, wherein the plasma ALT level in the mouse is at least 100-fold lower than the plasma ALT level in the mouse administered the parent oligomeric compound.

809. The oligomeric compound of embodiment 807, wherein the plasma ALT level in the mouse is at least 500-fold lower than the plasma ALT level in the mouse administered the parent oligomeric compound.

810. The oligomeric compound of any of embodiments 782-809, wherein the therapeutic index in a mouse of the oligomeric compound of any of embodiments 782-809 is increased relative to the therapeutic index of the parent oligomeric compound.

811. The oligomeric compound of embodiment 810, wherein the therapeutic index in a mouse of the oligomeric compound of embodiment 365 is at least two-fold greater than the therapeutic index of the parent oligomeric compound.

812. The oligomeric compound of any of embodiments 551-811, wherein an otherwise identical oligomeric compound lacking the at least one modified internucleoside linkage other than phosphorothioate and/or at least one modified nucleoside comprising a modified nucleobase other than 5-methylcytosine and/or a modified sugar moiety in the central region is hepatotoxic following administration to a mouse; and wherein the otherwise identical oligomeric compound has a central region consisting of phosphorothioate internucleoside linkages, unmodified 2′β-D-deoxyribosyl sugar moieties, and nucleobases selected from thymine, uracil, adenine, guanine, cytosine, and 5-methylcytosine.

813. The oligomeric compound of embodiment 812, wherein the at least one modified internucleoside linkage other than phosphorothioate and/or at least one modified nucleoside comprising a modified nucleobase other than 5-methylcytosine and/or a modified sugar moiety in the central region is a 2′-O-methyl modified sugar moiety.

814. The oligomeric compound of embodiment 813, wherein the 2′-O-methyl modified sugar moiety is at position 2 of the central region.

815. The oligomeric compound of embodiment 812-814, wherein the otherwise identical oligomeric compound lacks a 2′-O-methyl modified sugar moiety, and wherein the otherwise identical oligomeric compound comprises an unmodified 2′β-D-deoxyribosyl sugar moiety in place of the 2′-O-methyl modified sugar moiety.

816. The oligomeric compound of any of embodiments 812-815, wherein the nucleobase sequence of the otherwise identical oligomeric compound is 100% complementary to the target RNA.

817. The oligomeric compound of any of embodiments 812-816, wherein the otherwise identical oligomeric compound is a parent oligomeric compound of the oligomeric compound of any of embodiments 812-816.

818. The oligomeric compound of any of embodiments 708-817, wherein the oligomeric compound inhibits the target RNA with an IC 50 lower than 100 nM in a standard in vitro activity assay.

819. The oligomeric compound of any of embodiments 708-818, wherein the parent oligomeric compound of the oligomeric compound of any of embodiments 708-818 inhibits the target RNA with an IC 50 lower than 100 nM in a standard in vitro activity assay.

820. The oligomeric compound of any of embodiments 708-819, wherein the difference between the IC 50 of the parent oligomeric compound measured in a standard in vitro activity assay and the IC 50 of the oligomeric compound of any of embodiments 708-819 measured in a standard in vitro activity assay is less than 4-fold.

821. The oligomeric compound of any of embodiments 708-820, wherein the difference between the IC 50 of the parent oligomeric compound measured in a standard in vitro activity assay and the IC 50 of the oligomeric compound of any of embodiments 708-820 measured in a standard in vitro activity assay is less than 3-fold.

822. The oligomeric compound of any of embodiments 708-821, wherein the difference between the IC 50 of the parent oligomeric compound measured in a standard in vitro activity assay and the IC 50 of the oligomeric compound of any of embodiments 708-821 measured in a standard in vitro activity assay is less than 2-fold.

823. The oligomeric compound of any of embodiments 708-822, wherein each sugar moiety of the central region of the parent oligomeric compound is an unmodified 2′-β-D-deoxyribosyl sugar moiety, and wherein each internucleoside linkage of the central region of the parent oligomeric compound is a phosphorothioate internucleoside linkage.

824. The oligomeric compound of any of embodiments 708-823, wherein the nucleobase sequence of the parent oligomeric compound is 100% complementary to the target RNA.

825. The oligomeric compound of any of embodiments 551-824, wherein administration of 10-50 mg of the oligomeric compound to a human is not hepatotoxic to the human.

826. The oligomeric compound of any of embodiments 551-824, wherein administration of 50-100 mg of the oligomeric compound to a human is not hepatotoxic to the human.

827. The oligomeric compound of any of embodiments 551-824, wherein administration of 100-300 mg of the oligomeric compound to a human is not hepatotoxic to the human.

828. The oligomeric compound of any of embodiments 825-827, wherein the administration is systemic administration.

829. A composition comprising the oligomeric compound of any of embodiments 551-828 and a second oligomeric compound, wherein the second oligomeric compound is complementary to the oligomeric compound of any of embodiments 551-828.

830. The composition of embodiment 829, wherein the second oligomeric compound comprises at least 14 contiguous linked nucleosides that are at least 90% complementary to the oligomeric compound of any of embodiments 551-828.

831. The composition of embodiment 830, wherein the second oligomeric compound comprises at least 14 contiguous linked nucleosides that are 100% complementary to the oligomeric compound of any of embodiments 551-828.

832. A pharmaceutical composition comprising the oligomeric compound of any of embodiments 551-828 or the composition of any of embodiments 829-831, comprising a pharmaceutically acceptable carrier or diluent.

833. A method comprising administering the oligomeric compound or composition of any of embodiments 551-832 to a human subject.

834. A method of treating a disease or disorder comprising administering the oligomeric compound or composition of any of embodiments 551-832 to a human subject.

835. A method of modulating the amount or activity of a target RNA in a human subject comprising administering the oligomeric compound or composition of any of embodiments 551-832 to the human subject; and thereby modulating the amount or activity of the target RNA in the human subject.

836. A method of treating a disease or disorder in a human subject comprising administering the oligomeric compound or composition of any of embodiments 551-832 to the human subject having the disease or disorder; and thereby treating the disease or disorder in the human subject.

837. The method of embodiment 835-836, wherein the disease or disorder is a liver disease, and wherein the oligomeric compound modulates the amount or activity of a liver target RNA.

838. The method of embodiment 835-837, wherein the disease or disorder is a central nervous system disease, and wherein the oligomeric compound modulates the amount or activity of a central nervous system target RNA.

839. The method of any of embodiments 834-838, wherein the disease or disorder is a cancer, a neurodegenerative disease, a cardiovascular disease, an immunological disease, a hereditary disease, a repeat expansion disease, a muscle-wasting disease, or a metabolic disease.

840. The method of any of embodiments 834-839, wherein the plasma ALT level of the human subject after the administration is not more than three times higher than it was prior to the administration.

841. The method of any of embodiments 834-840, wherein the plasma ALT level of the human subject after the administration is not more than 150 units per liter.

842. The method of any of embodiments 834-841, wherein the human subject is susceptible to liver damage.

843. The method of any of embodiments 834-842, wherein the human subject is susceptible to liver degeneration.

844. The method of any of embodiments 834-843, wherein the human subject is susceptible to elevated apoptosis in the liver.

845. The method of any of embodiments 834-844, wherein the human subject has a liver disease.

846. The method of any of embodiments 834-841, comprising administering the parent oligomeric compound of the oligomeric compound of any of embodiments 551-832 to a mouse.

847. The method of any of embodiments 833-846, comprising contacting a cell with the parent oligomeric compound of the oligomeric compound of any of embodiments 551-832.

848. The method of embodiment 846-847, wherein each sugar moiety of the central region of the parent oligomeric compound is an unmodified 2′-β-D-deoxyribosyl sugar moiety, and wherein each internucleoside linkage of the central region of the parent oligomeric compound is a phosphorothioate internucleoside linkage.

849. A method of designing an oligomeric compound comprising starting with a parent oligomeric compound and changing the design of that compound in order to arrive at an oligomeric compound of any one of embodiments 551-833.

850. A method of designing an oligomeric compound comprising identifying a parent oligomeric compound and changing the design of that parent oligomeric compound to arrive at a second oligomeric compound, wherein the second oligomeric compound is an oligomeric compound of any one of embodiments 551-833.

851. A method of improving hepatotoxicity of an oligomeric compound comprising the steps of (i) identifying a parent oligomeric compound that has plasma ALT levels above 300 units per liter in a mouse, and (ii) providing an oligomeric compound according to any one of embodiments 551-833.

852. The method of embodiment 851, wherein the method designs an oligomeric compound with improved therapeutic index relative to the parent oligomeric compound.

853. The method of embodiment 851-852, wherein the method designs an oligomeric compound with lower hepatotoxicity relative to the parent oligomeric compound.

854. The method of embodiment 853, wherein the second oligomeric compound has an improved therapeutic index relative to the parent oligomeric compound.

855. The method of embodiment 851-852, wherein the second oligomeric compound has reduced hepatotoxicity in a mouse relative to the parent oligomeric compound.

856. The method of embodiment 855, wherein the oligomeric compound according to any one of embodiments 551-833 has reduced hepatotoxicity relative to the parent oligomeric compound.

857. A method comprising administering an oligomeric compound of any of embodiments 551-833 to a mouse and separately administering the parent oligomeric compound of the oligomeric compound of any of embodiments 551-833 to a second mouse, wherein the therapeutic index of the oligomeric compound of any of embodiments 551-833 is improved relative to the therapeutic index of the parent oligomeric compound.

858. The method of any of embodiments 833-857, wherein the level of p21 RNA is measured in the mouse, the cell, and/or the human subject.

859. A method comprising administering an oligomeric compound of any of embodiments 551-833 to a subject and measuring the level of p21 RNA in the subject.

860. The method of embodiment 858 or 859, wherein the subject is a mouse.

861. The method of embodiment 858 or 859, wherein the subject is a human.

862. The method of any of embodiments 858-861, wherein the p21 RNA level is measured within 24 hours of the administration.

863. The method of any of embodiments 858-862, wherein the p21 RNA level is measured 24-48 hours following the administration.

864. An oligomeric compound or composition of any one of embodiments 551-832, for use in medical therapy.

865. The oligomeric compound of any of embodiments 551-832, wherein the oligomeric compound is not toxic.

866. The oligomeric compound of any of embodiment 551-832, wherein a comparator compound is toxic;

wherein the comparator compound is identical to the oligomeric compound except that each nucleoside of the central region of the comparator compound is a nucleoside comprising 2′-β-D-deoxyribyl sugar moiety.

867. The oligomeric compound of embodiment 866, wherein administering a dose of the oligomeric compound to an animal results in a circulating ALT level that is at least 3-fold lower than the ALT level that results from administering the same dose of the comparator compound to an animal for at least one matched dose.

868. The oligomeric compound of embodiment 866 or 867, wherein the lowest dose of the oligomeric compound that raises circulating ALT to over 300 units per liter is at least three-fold higher than the lowest dose of the comparator compound that raises circulating ALT to over 300 units per liter.

869. The oligomeric compound of any of embodiments 865-868, wherein the oligomeric compound is capable of reducing the target RNA in a cell.

870. The oligomeric compound of embodiment 869, wherein the oligomeric compound has RNA-reducing activity comparable to a comparator compound, wherein the comparator compound is identical to the oligomeric compound except that each nucleoside of the central region of the comparator compound is a nucleoside comprising 2′-β-D-deoxyribosyl sugar moiety.

871. The oligomeric compound of embodiment 870 having RNA-reducing activity that is no more than 2-fold worse than the RNA-reducing activity of the comparator compound.

872. A method of modulating the amount or activity of a target RNA in a human subject comprising administering the oligomeric compound or composition of any of embodiments 551-832 to the human subject; and thereby modulating the amount or activity of the target RNA in the human subject.

873. A method of treating a disease or disorder in a human subject comprising administering the oligomeric compound or composition of any of embodiments 551-832 to the human subject having the disease or disorder; and thereby treating the disease or disorder in the human subject.

874. The method of embodiment 872-873, wherein the disease or disorder is a liver disease, and wherein the oligomeric compound modulates the amount or activity of a liver target RNA.

875. The method of embodiment 872-873, wherein the disease or disorder is a central nervous system disease, and wherein the oligomeric compound modulates the amount or activity of a central nervous system target RNA.

876. The method of any of embodiments 872-874, wherein the disease or disorder is a cancer, a neurodegenerative disease, a cardiovascular disease, an immunological disease, a hereditary disease, a repeat expansion disease, a muscle-wasting disease, or a metabolic disease.

877. The method of any of embodiments 872-876, wherein the plasma ALT level of the human subject after the administration is not more than three times higher than it was prior to the administration.

878. The method of any of embodiments 872-877, wherein the plasma ALT level of the human subject after the administration is not more than 150 units per liter.

879. A method of treating a disease or disorder in a human subject comprising administering the oligomeric compound or composition of any of embodiments 1-410, 452-518, 551-828, or 864-871 to the human subject having the disease or disorder; and thereby treating the disease or disorder in the human subject.

880. The method of embodiment 879, wherein the disease or disorder is not a CNS disease or disorder.

881. The method of embodiment 879, wherein the disease or disorder is a disease or disorder of the muscle.

882. The method of embodiment 879, wherein the disease or disorder is a disease or disorder of the lung.

883. The method of embodiment 879, wherein the disease or disorder is a disease or disorder of the kidney.

884. The method of embodiment 879, wherein the disease or disorder is a disease or disorder of the eye.

885. The method of embodiment 879, wherein the disease or disorder is a disease or disorder of the pancreas.

886. A method of screening a library of oligomeric compounds for activity against a target RNA, wherein the library of oligomeric compounds comprises a plurality of oligomeric compounds of any of embodiments 1-410, 452-218, 551-831, or 864-871.

887. An oligomeric compound comprising a modified oligonucleotide consisting of 12-21 linked nucleosides, wherein the modified oligonucleotide has the formula A-B-C, wherein A is a 5′-region, B is a central region, and C is a 3′-region; wherein:

the 5′-region consists of 1-5 linked nucleosides, wherein at least one nucleoside of the 5′-region is a modified nucleoside comprising a modified sugar; the 3′-region consists of 1-5 linked nucleosides wherein at least one nucleoside of the 3′-region is a modified nucleoside comprising a modified sugar; and the central region consists of 7-11 linked nucleosides, wherein

the 5′-most portion of the central region has the following formula:

(N da )(N x )(N y )(N z )(N db )

wherein one of N x , N y , and N z , is a safety-enhancing nucleoside; the other two of N x , N y , and N z are independently selected from a DNA nucleoside, a DNA isomer, a modified DNA isomer, and a DNA mimic; and N da and N db are each independently selected from a DNA nucleoside, a DNA isomer, a modified DNA isomer, and a DNA mimic.

888. The oligomeric compound of embodiment 887, wherein the 5′-region consists of one nucleoside.

889. The oligomeric compound of embodiment 887, wherein the 5′-region consists of 2-5 linked nucleosides.

890. The oligomeric compound of embodiment 887, wherein the 5′-region consists of 2-4 linked nucleosides.

891. The oligomeric compound of embodiment 887, wherein the 5′-region consists of 2 linked nucleosides.

892. The oligomeric compound of embodiment 887, wherein the 5′-region consists of 3 linked nucleosides.

893. The oligomeric compound of embodiment 887, wherein the 5′-region consists of 4 linked nucleosides.

894. The oligomeric compound of embodiment 887, wherein the 5′-region consists of 5 linked nucleosides.

895. The oligomeric compound of any of embodiments 887-894, wherein each nucleoside of the 5′-region is a modified nucleoside.

896. The oligomeric compound of any of embodiments 887-895, wherein each nucleoside of the 5′-region is a modified nucleoside comprising a modified sugar.

897. The oligomeric compound of any of embodiments 887-896, wherein each modified nucleoside of the 5′-region has the same modification.

898. The oligomeric compound of any of embodiments 887-896, wherein at least two nucleosides of the 5′-region are modified nucleosides having different modifications.

899. The oligomeric compound of any of embodiments 887-898, wherein each nucleoside of the 5′-region comprises a 2′-modified ribosyl sugar moiety.

900. The oligomeric compound of any of embodiments 887-899, wherein at least one nucleoside of the 5′-region comprises a bicyclic furanosyl sugar moiety.

901. The oligomeric compound of any of embodiments 887-900, wherein each nucleoside of the 5′-region comprises a bicyclic furanosyl sugar moiety.

902. The oligomeric compound of any of embodiments 887-900, wherein at least one nucleoside of the 5′-region comprises a non-bicyclic sugar moiety.

903. The oligomeric compound of embodiment 902, wherein the non-bicyclic sugar moiety of the at least one nucleoside of the 5′-region is a 2′-substituted ribosyl sugar moiety.

904. The oligomeric compound of any of embodiments 887-889 or 902-903, wherein each nucleoside of the 5′-region comprises a non-bicyclic sugar moiety.

905. The oligomeric compound of embodiment 904, wherein each nucleoside of the 5′-region comprises a 2′-substituted furanosyl sugar moiety.

906. The oligomeric compound of any of embodiments 887-905, wherein each nucleoside of the 5′-region comprises a 2′-modified furanosyl sugar moiety independently selected from a bicyclic sugar moiety and a non-bicyclic 2′-substituted ribosyl sugar moiety.

907. The oligomeric compound of any of embodiments 887-901 or 906, wherein each nucleoside of the 5′-region comprises a bicyclic sugar moiety.

908. The oligomeric compound of any of embodiments 887-889 or 902-906, wherein each nucleoside of the 5′-region comprises a non-bicyclic 2′-substituted ribosyl sugar moiety.

909. The oligomeric compound of any of embodiments 887-903 or 906-907, wherein each bicyclic sugar moiety of the 5′-region is selected from among cEt, LNA, and ENA.

910. The oligomeric compound of any of embodiments 887-903 or 906-909, wherein each bicyclic sugar moiety of the 5′-region is a cEt sugar moiety.

911. The oligomeric compound of any of embodiments 887-903, or 906-907 or 909 wherein each bicyclic sugar moiety of the 5′-region is an LNA sugar moiety.

912. The oligomeric compound of any of embodiments 887-900, 902-906, or 908-911, wherein each non-bicyclic sugar moiety of the 5′-region has a 2′-substituent selected from among 2′-MOE, 2′-OMe, and 2′-NMA.

913. The oligomeric compound of any of embodiments 887-912, wherein none of the nucleosides of the 5′-region comprise a sugar moiety having a 2′-F substituent.

914. The oligomeric compound of any of embodiments 887-913, wherein none of the nucleosides of the 5′-region comprise a sugar moiety having a 2′-MOE substituent.

915. The oligomeric compound of any of embodiments 887-914, wherein none of the nucleosides of the 5′-region comprise a sugar moiety having a 2′-OMe substituent.

916. The oligomeric compound of any of embodiments 887-915, wherein none of the nucleosides of the 5′-region comprise a cEt sugar moiety.

917. The oligomeric compound of any of embodiments 887-916, wherein none of the nucleosides of the 5′-region comprise a LNA sugar moiety.

918. The oligomeric compound of any of embodiments 887-917, wherein each nucleobase of the 5′-region is independently selected from among thymine, uracil, guanine, cytosine, 5-methylcytosine, and adenine.

919. The oligomeric compound of any of embodiments 887-918, wherein each internucleoside linkage of the 5′-region is independently selected from among phosphodiester and phosphorothioate internucleoside linkages.

920. The oligomeric compound of any of embodiments 887-919, wherein the 3′-region consists of one nucleoside.

921. The oligomeric compound of any of embodiments 887-919, wherein the 3′-region consists of 2-5 linked nucleosides.

922. The oligomeric compound of any of embodiments 887-919, wherein the 3′-region consists of 2-4 linked nucleosides.

923. The oligomeric compound of any of embodiments 887-919, wherein the 3′-region consists of 2 linked nucleosides.

924. The oligomeric compound of any of embodiments 887-919, wherein the 3′-region consists of 3 linked nucleosides.

925. The oligomeric compound of any of embodiments 887-919, wherein the 3′-region consists of 4 linked nucleosides.

926. The oligomeric compound of any of embodiments 887-919, wherein the 3′-region consists of 5 linked nucleosides.

927. The oligomeric compound of any of embodiments 887-926, wherein each nucleoside of the 3′-region is a modified nucleoside.

928. The oligomeric compound of any of embodiments 887-927, wherein each nucleoside of the 3′-region is a modified nucleoside comprising a modified sugar moiety.

929. The oligomeric compound of any of embodiments 887-928, wherein each modified nucleoside of the 3′-region has the same modification.

930. The oligomeric compound of and of embodiments 887-928, wherein at least two nucleosides of the 3′-region are modified nucleosides having different modifications.

931. The oligomeric compound of any of embodiments 887-930, wherein each nucleoside of the 3′-region comprises a 2′-modified ribosyl sugar moiety.

932. The oligomeric compound of any of embodiments 887-931, wherein at least one nucleoside of the 3′-region comprises a bicyclic furanosyl sugar moiety.

933. The oligomeric compound of any of embodiments 887-932, wherein each nucleoside of the 3′-region comprises a bicyclic furanosyl sugar moiety.

934. The oligomeric compound of any of embodiments 887-933, wherein at least one nucleoside of the 3′-region comprises a non-bicyclic sugar moiety.

935. The oligomeric compound of embodiment 934, wherein the non-bicyclic sugar moiety of the at least one nucleoside of the 3′-region is a 2′-substituted ribosyl sugar moiety.

936. The oligomeric compound of any of embodiments 887-935, wherein each nucleoside of the 3′-region comprises a non-bicyclic sugar moiety.

937. The oligomeric compound of embodiment 936, wherein each nucleoside of the 3′-region comprises a 2′-substituted furanosyl sugar moiety.

938. The oligomeric compound of any of embodiments 887-937, wherein each nucleoside of the 3′-region comprises a 2′-modified furanosyl sugar moiety independently selected from a bicyclic sugar moiety and a non-bicyclic 2′-substituted ribosyl sugar moiety.

939. The oligomeric compound of any of embodiments 887-935, or 938 wherein each nucleoside of the 3′-region comprises a bicyclic sugar moiety.

940. The oligomeric compound of any of embodiments 887-932 or 934-938, wherein each nucleoside of the 3′-region comprises a non-bicyclic 2′-substituted ribosyl sugar moiety.

941. The oligomeric compound of any of embodiments 887-935 or 938-939, wherein each bicyclic sugar moiety of the 3′-region is selected from among cEt, LNA, and ENA.

942. The oligomeric compound of any of embodiments 887-935, 938-939, or 941, wherein each bicyclic sugar moiety of the 3′-region is a cEt sugar moiety.

943. The oligomeric compound of any of embodiments 887-935, 938-939, or 941, wherein each bicyclic sugar moiety of the 3′-region is an LNA sugar moiety.

944. The oligomeric compound of any of embodiments 887-932, 934-938 or 940, wherein each non-bicyclic sugar moiety of the 3′-region has a 2′-substituent selected from among 2′-MOE, 2′-OMe, and 2′-NMA.

945. The oligomeric compound of any of embodiments 887-944, wherein none of the nucleosides of the 3′-region comprise a sugar moiety having a 2′-F substituent.

946. The oligomeric compound of any of embodiments 887-945, wherein none of the nucleosides of the 3′-region comprise a sugar moiety having a 2′-MOE substituent.

947. The oligomeric compound of any of embodiments 887-946, wherein none of the nucleosides of the 3′-region comprise a sugar moiety having a 2′-OMe substituent.

948. The oligomeric compound of any of embodiments 887-947, wherein none of the nucleosides of the 3′-region comprise a cEt sugar moiety.

949. The oligomeric compound of any of embodiments 887-948, wherein none of the nucleosides of the 3′-region comprise a LNA sugar moiety.

950. The oligomeric compound of any of embodiments 887-949, wherein each nucleobase of the 3′-region is independently selected from among thymine, uracil, guanine, cytosine, 5-methylcytosine, and adenine.

951. The oligomeric compound of any of embodiments 887-950, wherein each internucleoside linkage of the 3′-region is independently selected from among phosphodiester and phosphorothioate internucleoside linkages.

952. The oligomeric compound of any of embodiments 887-951, wherein the modified nucleosides of the 5′-region have the same modifications as the modifications of the modified nucleosides of the 3′-region.

953. The oligomeric compound of any of embodiments 887-951, wherein at least one modified nucleoside of the 5′-region and one modified nucleoside of the 3′-region comprise modifications that differ from one another.

954. The oligomeric compound of any of embodiments 887-898, 900, 902-903, 906, 909-932, 934-935, 938, 941-953, wherein the 5′-region and the 3′-region together include at least one non-bicyclic 2′-substituted modified nucleoside and at least one bicyclic nucleoside.

955. The oligomeric compound of embodiment 954, where the bicyclic nucleoside is a cEt nucleoside.

956. The oligomeric compound of embodiment 954, where the bicyclic nucleoside is an LNA nucleoside.

957. The oligomeric compound of any of embodiments 954-956, wherein the non-bicyclic 2′-modified nucleoside is a 2′-MOE nucleoside.

958. The oligomeric compound of any of embodiments 954-956, wherein the non-bicyclic 2′-modified nucleoside is a 2′-OMe nucleoside.

959. The oligomeric compound of any of embodiments 954-958, wherein at least one nucleoside of the 5′-region or the 3′-region is an unmodified DNA nucleoside.

960. The oligomeric compound of any of embodiments 887-959, wherein the central region has the formula:

(N da )(N x )(N y )(N z )(N db )(N dc ) q

wherein each N dc is independently selected from an unmodified DNA nucleoside, a DNA isomer, a modified DNA isomer, and a DNA mimic; and q is 2-6.

961. The oligomeric compound of any of embodiments 887-960, wherein the central region consists of 7 linked nucleosides.

962. The oligomeric compound of any of embodiments 887-960, wherein the central region consists of 8 linked nucleosides.

963. The oligomeric compound of any of embodiments 887-960, wherein the central region consists of 9 linked nucleosides.

964. The oligomeric compound of any of embodiments 887-960, wherein the central region consists of 10 linked nucleosides.

965. The oligomeric compound of any of embodiments 887-960, wherein the central region consists of 11 linked nucleosides.

966. The oligomeric compound of any of embodiments 887-965, wherein Nx is the safety-enhancing nucleoside.

967. The oligomeric compound of any of embodiments 887-965, wherein Ny is the safety-enhancing nucleoside.

968. The oligomeric compound of any of embodiments 887-965, wherein Nz is the safety-enhancing nucleoside.

969. The oligomeric compound of any of embodiments 887-968, wherein the safety enhancing nucleoside is a DNA isomer or a modified DNA isomer, or a modified nucleoside comprising either a sugar surrogate, a bicyclic furanosyl sugar moiety, or a non-bicyclic modified furanosyl sugar moiety.

970. The oligomeric compound of any of embodiments 887-969, wherein the safety enhancing nucleoside is a DNA isomer or a modified DNA isomer, or comprises either a sugar surrogate, a bicyclic furanosyl sugar moiety, a non-bicyclic, 2′-modified furanosyl sugar moiety, a non-bicyclic 3′-modified furanosyl sugar moiety, a non-bicyclic, 4′-modified furanosyl sugar moiety, or a non-bicyclic 5′-modified furanosyl sugar moiety.

971. The oligomeric compound of any of embodiments 887-970, wherein the safety enhancing nucleoside comprises a sugar surrogate selected from a morpholino, a modified morpholino, a modified cyclohexenyl, or a modified tetrahydropyran.

972. The oligomeric compound of any of embodiments 887-970, wherein the safety enhancing nucleoside comprises a sugar surrogate selected from a morpholino, a modified morpholino, CeNA, F-CeNA, HNA, OMe-HNA or F-HNA.

973. The oligomeric compound of any of embodiments 887-970, wherein the safety enhancing nucleoside is a DNA isomer comprising a sugar moiety selected from among 2′-β-D-deoxyxylosyl, 2′-α-L-deoxyribosyl, 2′-β-L-deoxyribosyl, 2′-α-D-deoxyxylosyl, 2′-α-D-deoxyribosyl, 2′-α-L-deoxyxylosyl, and 2′-O-L-deoxyxylosyl.

974. The oligomeric compound of any of embodiments 887-970 or 973, wherein the safety enhancing nucleoside is a DNA isomer comprising a sugar moiety selected from among 2′-β-D-deoxyxylosyl, 2′-α-L-deoxyribosyl, and 2′-β-L-deoxyribosyl.

975. The oligomeric compound of any of embodiments 887-970, wherein the safety enhancing nucleoside is a modified DNA isomer comprising a 2′-modified sugar moiety, wherein the sugar moiety has the conformation 2′-β-D-deoxyxylosyl, 2′-α-L-deoxyribosyl, 2′-β-L-deoxyribosyl, 2′-α-D-deoxyxylosyl, 1, 2′-α-L-deoxyxylosyl, and 2′-β-L-deoxyxylosyl and the 2′ position is further substituted with a hydroxyl, a fluoro, or O—C 1 -C 10 alkoxy substituent.

976. The oligomeric compound of any of embodiments 887-970 or 975, wherein the safety enhancing nucleoside is a modified DNA isomer comprising a 2′-modified sugar moiety, wherein the sugar moiety has the conformation 2′-β-D-deoxyxylosyl, 2′-α-L-deoxyribosyl, 2′-β-L-deoxyribosyl, 2′-α-D-deoxyxylosyl, 1, 2′-α-L-deoxyxylosyl, and 2′-β-L-deoxyxylosyl and the 2′ position is further substituted with a hydroxyl, a fluoro, or OMe substituent.

977. The oligomeric compound of any of embodiments 887-970 or 975-976, wherein the safety enhancing nucleoside is a modified DNA isomer comprising a 2′-modified sugar moiety, wherein the sugar moiety has the conformation 2′-β-D-deoxyxylosyl, 2′-α-L-deoxyribosyl, 2′-β-L-deoxyribosyl, 2′-α-D-deoxyxylosyl, 1, 2′-α-L-deoxyxylosyl, and 2′-β-L-deoxyxylosyl and the 2′ position is further substituted with a fluoro or OMe substituent.

978. The oligomeric compound of any of embodiments 887-970 or 975-977, wherein the safety enhancing nucleoside is a modified DNA isomer comprising a sugar moiety selected from among 2′-β-D-deoxyxylosyl, 2′-α-L-deoxyribosyl, and 2′-β-L-deoxyribosyl and the 2′ position is further substituted with a hydroxyl, fluoro, or OMe substituent.

979. The oligomeric compound of any of embodiments 887-970, wherein the safety enhancing nucleoside is a modified nucleoside comprising a bicyclic furanosyl sugar moiety.

980. The oligomeric compound of any of embodiments 887-970, wherein the safety enhancing nucleoside is selected from among cEt, LNA, α-L-LNA, and ENA.

981. The oligomeric compound of any of embodiments 887-970, wherein the safety enhancing nucleoside comprises a 2′-substituted furanosyl sugar moiety.

982. The oligomeric compound of embodiment 981, wherein the 2′-substituted furanosyl sugar moiety of the safety enhancing nucleoside has a 2′ substituent selected from: halo, allyl, amino, azido, SH, CN, OCN, CF 3 , OCF 3 , O—C 1 -C 10 alkoxy, O—C 1 -C 10 substituted alkoxy, C 1 -C 10 alkyl, C 1 -C 10 substituted alkyl, S-alkyl, N(R m )-alkyl, O-alkenyl, S-alkenyl, N(R m )-alkenyl, O-alkynyl, S-alkynyl, N(R m )-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH 2 ) 2 SCH 3 , O(CH 2 ) 2 ON(R m )(R n ) or OCH 2 C(═O)—N(R m )(R n ), where each R m and R n is, independently, H, an amino protecting group, or substituted or unsubstituted C 1 -C 10 alkyl.

983. The oligomeric compound of embodiment 981, wherein the 2′-substituted furanosyl sugar moiety of the safety enhancing nucleoside has a 2′ substituent selected from: halo, O—C 1 -C 10 alkoxy, O—C 1 -C 10 substituted alkoxy, C 1 -C 10 alkyl, C 1 -C 10 substituted alkyl, S-alkyl, N(R m )-alkyl, O(CH 2 ) 2 ON(R m )(R n ) or OCH 2 C(═O)—N(R m )(R n ), where each R m and R n is, independently, H, an amino protecting group, or substituted or unsubstituted C 1 -C 10 alkyl.

984. The oligomeric compound of embodiment 981, wherein the 2′-substituted furanosyl sugar moiety of the safety enhancing nucleoside has a 2′ substituent selected from: fluoro, OMe, MOE, NMA.

985. The oligomeric compound of any of embodiments 887-978 or 981-984, wherein the safety enhancing nucleoside comprises a 2′-substituted furanosyl sugar moiety comprising a 2′-OMe or 2′-MOE.

986. The oligomeric compound of any of embodiments 887-978 or 981-986, wherein the safety enhancing nucleoside comprises a 2′-substituted furanosyl sugar moiety comprising a 2′-OMe.

987. The oligomeric compound of any of embodiments 887-978 or 981-986, wherein the safety enhancing nucleoside comprises a 2′-OMe modified 2′-β-D-deoxyribosyl sugar moiety.

988. The oligomeric compound of any of embodiments 887-970, wherein the safety enhancing nucleoside comprises a 3′-modified furanosyl sugar moiety having a 3′ substituent selected from: halo, allyl, amino, azido, SH, CN, CF 3 , OCF 3 , C 1 -C 10 alkyl, C 1 -C 10 substituted alkyl, S-alkyl, N(R m )-alkyl, N(R m )-alkenyl, N(R m )-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, or aralkyl.

989. The oligomeric compound of any of embodiments 887-970 or embodiment 988, wherein the safety enhancing nucleoside comprises a 3′-modified furanosyl sugar moiety having a 3′ substituent selected from: C 1 -C 10 alkyl, or C 1 -C 10 substituted alkyl.

990. The oligomeric compound of any of embodiments 887-970 or 988-989, wherein the safety enhancing nucleoside comprises a 3′-methyl furanosyl sugar moiety.

991. The oligomeric compound of any of embodiments 887-970, wherein the safety enhancing nucleoside comprises a 4′-modified furanosyl sugar moiety having a 4′ substituent selected from: halo, allyl, amino, azido, SH, CN, OCN, CF 3 , OCF 3 , O—C 1 -C 10 alkoxy, O—C 1 -C 10 substituted alkoxy, C 1 -C 10 alkyl, C 1 -C 10 substituted alkyl, S-alkyl, N(R m )-alkyl, O- alkenyl, S-alkenyl, N(R m )-alkenyl, O-alkynyl, S-alkynyl, N(R m )-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH 2 ) 2 SCH 3 , O(CH 2 ) 2 ON(R m )(R n ) or OCH 2 C(═O)—N(R m )(R n ), where each R m and R n is, independently, H, an amino protecting group, or substituted or unsubstituted C 1 -C 10 alkyl.

992. The oligomeric compound of any of embodiments 887-970 or 991, wherein the safety enhancing nucleoside comprises a 4′-modified furanosyl sugar moiety having a 4′-methyl.

993. The oligomeric compound of any of embodiments 887-970, wherein the safety enhancing nucleoside has the structure shown below, wherein R represents an optional 2′ substituent group and Bx is a heterocyclic base moiety:

994. The oligomeric compound of embodiment 993, wherein in R is selected from among H, OH, OMe, F, or MOE.

995. The oligomeric compound of any of embodiments 887-970, wherein the safety enhancing nucleoside comprises a 5′-modified furanosyl sugar moiety having a 5′ substituent selected from: halo, allyl, amino, azido, SH, CN, OCN, CF 3 , OCF 3 , O—C 1 -C 10 alkoxy, O—C 1 -C 10 substituted alkoxy, C 1 -C 10 alkyl, C 1 -C 10 substituted alkyl, S-alkyl, N(R m )-alkyl, O- alkenyl, S-alkenyl, N(R m )-alkenyl, O-alkynyl, S-alkynyl, N(R m )-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH 2 ) 2 SCH 3 , O(CH 2 ) 2 ON(R m )(R n ) or OCH 2 C(═O)—N(R m )(R n ), where each R m and R n is, independently, H, an amino protecting group, or substituted or unsubstituted C 1 -C 10 alkyl.

996. The oligomeric compound of any of embodiments 887-970 or 995, wherein the safety enhancing nucleoside comprises a 5′-modified furanosyl sugar moiety with a 5′ substituent selected from: 5′-methyl, 5′-ethyl or a 5′-allyl.

997. The oligomeric compound of any of embodiments 887-970 or 995-996, wherein the safety enhancing nucleoside comprises a 5′-modified furanosyl sugar moiety with a 5′ substituent selected from: 5′-(R)-methyl- or 5′-(R)-ethyl.

998. The oligomeric compound of any of embodiments 887-970 or 995-997, wherein the safety enhancing nucleoside comprises a 5′-(R)-methyl-2′-β-D-deoxyribosyl sugar moiety.

999. The oligomeric compound of any of embodiments 887-970 or 995-998, wherein the safety enhancing nucleoside comprises a 5′-(R)-ethyl-2′-β-D-deoxyribosyl sugar moiety.

1000. The oligomeric compound of any of embodiments 887-999, wherein the safety enhancing nucleoside does not comprise a 2′-F modified sugar moiety.

1001. The oligomeric compound of any of embodiments 887-1000, wherein the safety enhancing nucleoside does not comprise a cEt modified sugar moiety.

1002. The oligomeric compound of any of embodiments 887-1001, wherein the safety enhancing nucleoside does not comprise a 2′-MOE modified sugar moiety.

1003. The oligomeric compound of any of embodiments 887-1002, wherein the safety enhancing nucleoside comprises a hypoxanthine nucleobase.

1004. The oligomeric compound of any of embodiments 887-1003, wherein the safety enhancing nucleoside comprises a nucleobase selected from among thymine, uracil, guanine, cytosine, 5-methylcytosine, and adenine.

1005. The oligomeric compound of any of embodiments 887-1004, wherein the safety enhancing nucleoside is a modified nucleoside other than cEt, MOE, LNA, or FANA.

1006. The oligomeric compound of any of embodiments 887-1005, wherein each Nd is independently selected from among a DNA nucleoside, a DNA isomer, a 2′-modified DNA isomer, and a DNA mimic.

1007. The oligomeric compound of embodiment 1006, wherein each DNA isomer comprises a sugar moiety selected from among 2′-β-D-deoxyxylosyl, 2′-α-L-deoxyribosyl, 2′-β-L-deoxyribosyl, 2′-α-D-deoxyxylosyl, 2′-α-D-deoxyribosyl, 2′-α-L-deoxyxylosyl, and 2′-β-L-deoxyxylosyl.

1008. The oligomeric compound of embodiment 1007, wherein each DNA isomer comprises a sugar moiety selected from among 2′-β-D-deoxyxylosyl, 2′-α-L-deoxyribosyl, and 2′-β-L-deoxyribosyl.

1009. The oligomeric compound of embodiment 1006, wherein each modified DNA isomer comprises a 2′-modified sugar moiety, wherein the sugar moiety has the conformation 2′-β-D-deoxyxylosyl, 2′-α-L-deoxyribosyl, 2′-β-L-deoxyribosyl, 2′-α-D-deoxyxylosyl, 1, 2′-α-L-deoxyxylosyl, and 2′-β-L-deoxyxylosyl and the 2′ position is further substituted with a hydroxyl, a fluoro, or O—C 1 -C 10 alkoxy substituent.

1010. The oligomeric compound of embodiment 1009, wherein each modified DNA isomer comprises a 2′-modified sugar moiety, wherein the sugar moiety has the conformation 2′-β-D-deoxyxylosyl, 2′-α-L-deoxyribosyl, 2′-β-L-deoxyribosyl, 2′-α-D-deoxyxylosyl, 1, 2′-α-L-deoxyxylosyl, and 2′-β-L-deoxyxylosyl and the 2′ position is further substituted with a hydroxyl, a fluoro, or OMe substituent.

1011. The oligomeric compound of embodiment 1010, wherein each modified DNA isomer comprises a 2′-modified sugar moiety, wherein the sugar moiety has the conformation 2′-β-D-deoxyxylosyl, 2′-α-L-deoxyribosyl, 2′-β-L-deoxyribosyl, 2′-α-D-deoxyxylosyl, 1, 2′-α-L-deoxyxylosyl, and 2′-β-L-deoxyxylosyl and the 2′ position is further substituted with a fluoro or OMe substituent.

1012. The oligomeric compound of embodiment 1011, wherein each modified DNA isomer comprises a 2′-modified sugar moiety, wherein the sugar moiety is selected from among 2′-β-D-deoxyxylosyl, 2′-α-L-deoxyribosyl, and 2′-β-L-deoxyribosyl and the 2′ position is further substituted with a hydroxyl, fluoro, or OMe substituent.

1013. The oligomeric compound of embodiment 1006, wherein each DNA mimic comprises a structure represented by one of the formulas below:

wherein X is O or S and Bx represents a heterocylic base moiety.

1014. The oligomeric compound of embodiment 1006, wherein each DNA mimic comprises a structure represented by one of the formulas below:

wherein X is O or S;

Bx represents a heterocyclic base moiety; and

R 1 is selected from among H, OH, halo, allyl, amino, azido, SH, CN, OCN, CF 3 , OCF 3 , O—C 1 -C 10 alkoxy, O—C 1 -C 10 substituted alkoxy, C 1 -C 10 alkyl, C 1 -C 10 substituted alkyl, S-alkyl, N(R m )-alkyl, O-alkenyl, S-alkenyl, N(R m )-alkenyl, O-alkynyl, S-alkynyl, N(R m )-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH 2 ) 2 SCH 3 , O(CH 2 ) 2 ON(R m )(R n ) or OCH 2 C(═O)—N(R m )(R n ), where each R m and R n is, independently, H, an amino protecting group, or substituted or unsubstituted C 1 -C 10 alkyl;

wherein if the DNA mimic comprises the structure:

R 1 is other than H.

1015. The oligomeric compound of embodiment 1014, wherein R 1 is H, OH, OMe, or F.

1016. The oligomeric compound of embodiment 1014, wherein R 1 is not F.

1017. The oligomeric compound of embodiment 1006, wherein each DNA mimic comprises a structure represented by the formula below:

wherein X is S, Bx represents a heterocyclic base moiety, and R 1 is H.

1018. The oligomeric compound of embodiment 1006, wherein the DNA mimic has a sugar moiety selected from among: 5′-methyl-2′-β-D-deoxyribosyl, 5′-ethyl-2′-β-D-deoxyribosyl, and 5′-allyl-2′-β-D-deoxyribosyl.

1019. The oligomeric compound of embodiment 1006, wherein the DNA mimic comprises a 2′-fluoro-β-D-arabinofuranosyl sugar moiety.

1020. The oligomeric compound of embodiment 1006, wherein the DNA mimic does not comprise a 2′-fluoro-β-D-arabinofuranosyl sugar moiety.

1021. The oligomeric compound of any of embodiments 887-1020, wherein each N d is a DNA nucleoside.

1022. The oligomeric compound of any of embodiments 887-1021, wherein the central region comprises no more than four nucleosides selected from among DNA isomers, modified DNA isomers, and DNA mimics.

1023. The oligomeric compound of any of embodiments 887-1021, wherein the central region comprises no more than three nucleosides selected from among DNA isomers, modified DNA isomers, and DNA mimics.

1024. The oligomeric compound of any of embodiments 887-1021, wherein the central region comprises no more than two nucleosides selected from among DNA isomers, modified DNA isomers, and DNA mimics.

1025. The oligomeric compound of any of embodiments 887-1021, wherein the central region comprises no more than one nucleoside selected from among DNA isomers, modified DNA isomers, and DNA mimics.

1026. The oligomeric compound of any of embodiments 887-1025, wherein the central region contains exactly one safety enhancing nucleoside and the remainder of nucleosides in the central region are DNA nucleosides.

1027. The oligomeric compound of any of embodiments 887-1026, wherein at least one internucleoside linkage of the central region selected from among: the internucleoside Nda to Nx, Nx to Ny, Ny to Nz, or Nz to the adjacent Ndb is a neutral internucleoside linkage.

1028. The oligomeric compound of embodiments 1027, wherein the neutral linkage is a phosphonate internucleoside linkage.

1029. The oligomeric compound of embodiments 1027, wherein the neutral linkage is a methoxypropyl internucleoside linkage.

1030. The oligomeric compound of embodiments 1027, wherein each remaining internucleoside linkage is a phosphodiester or phosphorothioate internucleoside linkage.

1031. A chirally enriched population of modified oligonucleotides of any of embodiments 887-1026, wherein the central region has at least one particular phorphorothioate internucleoside linkage having a particular stereochemical configuration.

1032. The chirally enriched population of embodiment 1031, wherein the central region has at least one phorphorothioate internucleoside linkage having the (Sp) configuration.

1033. The chirally enriched population of embodiment 1031, wherein central region has at least one phorphorothioate internucleoside linkage having the (Rp) configuration.

1034. The chirally enriched population of embodiment 1031, wherein the central region has a particular, independently selected stereochemical configuration at each phosphorothioate internucleoside linkage.

1035. The chirally enriched population of embodiment 1034, wherein the each phosphorothioate internucleoside linkage of the central region has the (Sp) configuration.

1036. The chirally enriched population of embodiment 1034, wherein the central region has one phosphorothioate internucleoside linkage having the (Rp) configuration and wherein each remaining central region phosphorothioate internucleoside linkage has the (Sp) configuration.

1037. The chirally enriched population of embodiment 1031, wherein the central region has an (Rp) phosphorothioate internucleoside linkage adjacent to an (Sp) phosphorothioate internucleoside linkage.

1038. The chirally enriched population of embodiment 1031, wherein the central region has an (Rp) phosphorothioate internucleoside linkage adjacent to a second (Rp) phosphorothioate internucleoside linkage.

1039. The chirally enriched population of embodiment 1031, wherein the central region has an (Rp) phosphorothioate internucleoside linkage adjacent to a second (Rp) phosphorothioate internucleoside linkage, and wherein each remaining central region phosphorothioate internucleoside linkage has the (Sp) configuration.

1040. The chirally enriched population of any of embodiments 1032, 1033, 1037, or 1038 wherein each phosphorothioate internucleoside linkage that does not have the (Rp) or (Sp) configuration is stereorandom.

1041. The oligomeric compound of any of embodiments 887-1040 comprising a conjugate group.

1042. The oligomeric compound of embodiment 1041, wherein the conjugate group comprises a linking group attaching the remainder of the conjugate group to the modified oligonucleotide, wherein the linking group comprises 1-5 nucleosides.

1043. The oligomeric compound of any of embodiments 887-1041, wherein the oligomeric compound does not comprise additional nucleosides beyond those of the modified oligonucleotide.

1044. The oligomeric compound of any of embodiments 887-1043, wherein the nucleobase sequence of the modified oligonucleotide is complementary to a target RNA.

1045. The oligomeric compound of embodiment 1044, wherein the nucleobase sequence of the modified oligonucleotide is at least 85% complementary to the target RNA.

1046. The oligomeric compound of embodiment 1044, wherein the nucleobase sequence of the modified oligonucleotide is at least 90% complementary to the target RNA.

1047. The oligomeric compound of embodiment 1044, wherein the nucleobase sequence of the modified oligonucleotide is at least 95% complementary to the target RNA.

1048. The oligomeric compound of embodiment 1047, wherein the nucleobase sequence of the modified oligonucleotide is 100% complementary to the target RNA.

1049. The oligomeric compound of any of embodiments 1044-1048, wherein the target RNA is a target mRNA or a target pre-mRNA.

1050. The oligomeric compound of embodiment 1049, wherein the target mRNA or target pre-mRNA is not a mouse, rat, monkey, or human PTEN RNA.

1051. The oligomeric compound of embodiment 1049 or 1050, wherein the target mRNA or target pre-mRNA is not a mouse, rat, monkey, or human SRB-1 RNA.

1052. The oligomeric compound of any of embodiments 1049-1051, wherein the target mRNA or target pre-mRNA is not a mouse, rat, monkey, or human MYD88 RNA.

1053. The oligomeric compound of any of embodiments 1049-1052, wherein the target mRNA or target pre-mRNA is not a mouse, rat, monkey, or human HTT RNA, is not a mouse, rat, monkey, or human SOD1 RNA, and is not a mouse, rat, monkey, or human alpha-synuclein RNA.

1054. The oligomeric compound of any of embodiments 1044-1053, wherein the target RNA is a human RNA.

1055. The oligomeric compound of any of embodiments 1044-1054, wherein the target RNA is expressed in the liver.

1056. The oligomeric compound of any of embodiments 1044-1055, wherein the target RNA is a liver target.

1057. The oligomeric compound of any of embodiments 1044-1054, wherein the target RNA is not expressed in the liver.

1058. The oligomeric compound of any of embodiments 1044-1054 or 1057, wherein the target RNA is not a liver target.

1059. The oligomeric compound of any of embodiments 1044-1056, wherein modulation of the expression of the target RNA in the liver is associated with treating a disorder or condition.

1060. The oligomeric compound of embodiment 1059, wherein the disorder or condition is a liver disorder or condition.

1061. The oligomeric compound of any of embodiments 1044-1060, wherein the target RNA is expressed in the central nervous system.

1062. The oligomeric compound of any of embodiments 1044-1060, wherein the target RNA is not expressed in the central nervous system.

1063. The oligomeric compound of any of embodiments 1044-1061, wherein the target RNA is a central nervous system target.

1064. The oligomeric compound of any of embodiments 1044-1062, wherein the target RNA is not a central nervous system target.

1065. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is expressed in white fat cells.

1066. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is expressed in brown fat cells.

1067. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is expressed in adipocytes.

1068. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is expressed in macrophages.

1069. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is expressed in cancer cells.

1070. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is expressed in tumor cells.

1071. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is expressed in smooth muscle cells.

1072. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is expressed in lymphocytes.

1073. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is expressed in pulmonary cells.

1074. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is expressed in heart muscle cells.

1075. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is expressed in cardiomyocytes.

1076. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is expressed in endothelial cells.

1077. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is expressed in fibroblasts.

1078. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is expressed in glial cells.

1079. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is expressed in Schwann cells.

1080. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is expressed in pancreatic cells.

1081. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is expressed in kidney cells.

1082. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is expressed in beta cells.

1083. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is expressed in non-parenchymal cells.

1084. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is expressed in hepatocytes.

1085. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is expressed in oligodendrocytes.

1086. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is expressed in astrocytes.

1087. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is expressed in microglia.

1088. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is expressed in ependymal cells.

1089. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is expressed in sensory neurons.

1090. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is expressed in motor neurons.

1091. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is expressed in skeletal muscle.

1092. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is expressed in cardiac muscle.

1093. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is expressed in smooth muscle.

1094. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is expressed in adipose tissue.

1095. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is expressed in white adipose tissue.

1096. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is expressed in the spleen.

1097. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is expressed in the bone.

1098. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is expressed in the bone marrow.

1099. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is expressed in the intestine.

1100. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is expressed in the adrenal glands.

1101. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is expressed in the testes.

1102. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is expressed in the ovaries.

1103. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is expressed in the pancreas.

1104. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is expressed in the pituitary gland.

1105. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is expressed in the prostate gland.

1106. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is expressed in the skin.

1107. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is expressed in the epidermis.

1108. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is expressed in the uterus.

1109. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is expressed in the bladder.

1110. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is expressed in the brain.

1111. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is expressed in the glomerulus.

1112. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is expressed in the distal tubular epithelium.

1113. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is expressed in breast tissue.

1114. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is expressed in the lung.

1115. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is expressed in the heart.

1116. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is expressed in the kidney.

1117. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is expressed in the ganglion.

1118. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is expressed in the frontal cortex.

1119. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is expressed in the spinal cord.

1120. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is expressed in the trigeminal ganglion.

1121. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is expressed in the sciatic nerve.

1122. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is expressed in the dorsal root ganglion.

1123. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is expressed in the epidymal fat.

1124. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is expressed in the diaphragm.

1125. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is expressed in the colon.

1126. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is a white fat cell target.

1127. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is a brown fat cell target.

1128. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is an adipocyte target.

1129. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is a macrophage target.

1130. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is a cancer cell target.

1131. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is a tumor cell target.

1132. The oligomeric compound of any of embodiments 158-178, wherein the target RNA is a smooth muscle cell target.

1133. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is a lymphocyte target.

1134. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is a pulmonary cell target.

1135. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is a heart muscle cell target.

1136. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is a cardiomyocyte target.

1137. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is a endothelial cell target.

1138. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is a fibroblast target.

1139. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is a glial cell target.

1140. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is a Schwann cell target.

1141. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is a pancreatic cell target.

1142. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is a kidney cell target.

1143. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is a beta cell target.

1144. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is a non-parenchymal cell target.

1145. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is a hepatocyte target.

1146. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA a oligodendrocyte target.

1147. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is a astrocyte target.

1148. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is a microglia target.

1149. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is a ependymal cell target.

1150. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is a sensory neuron target.

1151. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is a motor neuron target.

1152. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is a skeletal muscle target.

1153. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is a cardiac muscle target.

1154. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is a smooth muscle target.

1155. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is a adipose tissue target.

1156. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is a white adipose tissue target.

1157. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is a spleen target.

1158. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is a bone target.

1159. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is a bone marrow target.

1160. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is an intestinal target.

1161. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is an adrenal gland target.

1162. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is a testicular target.

1163. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is an ovarian target.

1164. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is a pancreatic target.

1165. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is a pituitary gland target.

1166. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is a prostate gland target.

1167. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is a skin target.

1168. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is an epidermal target.

1169. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is a uterine target.

1170. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is a bladder target.

1171. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is a brain target.

1172. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is a glomerulus target.

1173. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is a distal tubular epithelium target.

1174. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is a breast tissue target.

1175. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is a lung target.

1176. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is a heart target.

1177. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is a kidney target.

1178. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is a ganglion target.

1179. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is a frontal cortex target.

1180. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is a spinal cord target.

1181. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is a trigeminal ganglion target.

1182. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is a sciatic nerve target.

1183. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is a dorsal root ganglion target.

1184. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is a epidymal fat target.

1185. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is a diaphragm target.

1186. The oligomeric compound of any of embodiments 1044-1064, wherein the target RNA is a colon target.

1187. The oligomeric compound of any of embodiments 1044-1186, wherein the target RNA is a MeCP2, DUX4, HDAC2, APP, Ataxin 1, Ataxin 2, Ataxin 3, Ataxin 6, Ataxin 7, C9ORF72, UBE3A, Prion, PMP22, Tau, LRRK2, LINGO2, GYS1, KCNT1, IRF8, Progranulin, or GFAP RNA.

1188. The oligomeric compound of any of embodiments 1044-1186, wherein the target RNA is a HTT RNA.

1189. The oligomeric compound of embodiment 1187, wherein the target RNA is a MeCP2 RNA.

1190. The oligomeric compound of embodiment 1187, wherein the target RNA is a DUX4 RNA.

1191. The oligomeric compound of embodiment 1187, wherein the target RNA is a HDAC2 RNA.

1192. The oligomeric compound of embodiment 1187, wherein the target RNA is a Ataxin 1 RNA.

1193. The oligomeric compound of embodiment 1187, wherein the target RNA is a Ataxin 2 RNA.

1194. The oligomeric compound of embodiment 1187, wherein the target RNA is a Ataxin 3 RNA.

1195. The oligomeric compound of embodiment 1187, wherein the target RNA is a Ataxin 6 RNA.

1196. The oligomeric compound of embodiment 1187, wherein the target RNA is a Ataxin 7 RNA.

1197. The oligomeric compound of embodiment 1187, wherein the target RNA is a C9ORF72 RNA.

1198. The oligomeric compound of embodiment 1044-1186, wherein the target RNA is an alpha-synuclein RNA.

1199. The oligomeric compound of embodiment 1187, wherein the target RNA is an UBE3A RNA.

1200. The oligomeric compound of any of embodiments 1044-1186, wherein the target RNA is a SOD1 RNA.

1201. The oligomeric compound of embodiment 1187, wherein the target RNA is a Prion RNA.

1202. The oligomeric compound of embodiment 1187, wherein the target RNA is a PMP22 RNA.

1203. The oligomeric compound of any of embodiments 1044-1187, wherein the target RNA is a Tau RNA.

1204. The oligomeric compound of embodiment 1187, wherein the target RNA is a LRRK2 RNA.

1205. The oligomeric compound of embodiment 1187, wherein the target RNA is an APP RNA.

1206. The oligomeric compound of 1187, wherein the target RNA is a LINGO2 RNA.

1207. The oligomeric compound of any of embodiments 1187, wherein the target RNA is a GYS1 RNA.

1208. The oligomeric compound of any of embodiments 1187, wherein the target RNA is a KCNT1 RNA.

1209. The oligomeric compound of any of embodiments 1187, wherein the target RNA is a IRF8 RNA.

1210. The oligomeric compound of any of embodiments 1187, wherein the target RNA is a Progranulin RNA.

1211. The oligomeric compound of any of embodiments 1187, wherein the target RNA is a GFAP RNA.

1212. The oligomeric compound of any of embodiments 1044-1211, wherein modulation of the expression of the target RNA is associated with treating a disorder or condition.

1213. The oligomeric compound of any of embodiments 1212, wherein the disorder or condition is Alzheimer's Disease, Amyotrophic Lateral Sclerosis, Parkinson's Disease, a Spinocerebellar ataxia, Angelman Syndrome, Alexander's Disease, Lafora Disease, Charcot-Marie Tooth Disease, Prion Disease, a dementia, neurodegeneration, MeCP2 Duplication Syndrome, encephalopathy, neuroinflammation, or multiple sclerosis.

1214. The oligomeric compound of embodiment 1212, wherein the disorder or condition is Alzheimer's Disease.

1215. The oligomeric compound of embodiment 1212, wherein the disorder or condition is Amyotrophic Lateral Sclerosis.

1216. The oligomeric compound of embodiment 1212, wherein the disorder or condition is Parkinson's Disease.

1217. The oligomeric compound of embodiment 1212, wherein the disorder or condition is a Spinocerebellar ataxia.

1218. The oligomeric compound of embodiment 1212, wherein the disorder or condition is Angelman Syndrome.

1219. The oligomeric compound of embodiment 1212, wherein the disorder or condition is Alexander's Disease.

1220. The oligomeric compound of embodiment 1212, wherein the disorder or condition is Lafora Disease.

1221. The oligomeric compound of embodiment 1212, wherein the disorder or condition is Charcot-Marie Tooth Disease.

1222. The oligomeric compound of embodiment 1212, wherein the disorder or condition is Prion Disease.

1223. The oligomeric compound of embodiment 1212, wherein the disorder or condition is a dementia.

1224. The oligomeric compound of embodiment 1212, wherein the disorder or condition is neurodegeneration.

1225. The oligomeric compound of embodiment 1212, wherein the disorder or condition is MeCP2 Duplication Syndrome.

1226. The oligomeric compound of embodiment 1212, wherein the disorder or condition is encephalopathy.

1227. The oligomeric compound of embodiment 1212, wherein the disorder or condition is neuroinflammation.

1228. The oligomeric compound of embodiment 1212, wherein the disorder or condition is multiple sclerosis.

1229. The oligomeric compound of any of embodiments 887-1228, wherein the parent oligomeric compound of the oligomeric compound of any of embodiments 887-1228 is cytotoxic in vitro.

1230. The oligomeric compound of embodiment 1228, wherein the parent oligomeric compound is cytotoxic in a standard in vitro cytotoxicity assay.

1231. The oligomeric compound of any of embodiments 887-1229 wherein administration to a mouse of the parent oligomeric compound of the oligomeric compound of any of embodiments 887-1229 is hepatotoxic to the mouse.

1232. The oligomeric compound of embodiment 1230, wherein the administration of the parent oligomeric compound to the mouse is systemic administration.

1233. The oligomeric compound of embodiment 1230, wherein the systemic administration is subcutaneous administration.

1234. The oligomeric compound of any of embodiments 1230-1232, wherein the mouse is a CD-1 mouse.

1235. The oligomeric compound of any of embodiments 1230-1232, wherein the mouse is a C 57 BL/6 mouse.

1236. The oligomeric compound of any of embodiments 1230-1232, wherein the mouse is a BALB/c mouse.

1237. The oligomeric compound of any of embodiments 1230-1236, wherein the plasma ALT level in the mouse is higher than 500 units per liter following the administration of the parent oligomeric compound.

1238. The oligomeric compound of any of embodiments 1230-1237, wherein the plasma AST level in the mouse is higher than 500 units per liter following the administration of the parent oligomeric compound.

1239. The oligomeric compound of any of embodiments 1230-1238, wherein the plasma ALT level in the mouse is higher than 1000 units per liter following the administration of the parent oligomeric compound.

1240. The oligomeric compound of any of embodiments 1230-1239, wherein the plasma AST level in the mouse is higher than 1000 units per liter following the administration of the parent oligomeric compound.

1241. The oligomeric compound of any of embodiments 1230-1240, wherein the hepatotoxicity is measured 24-48 hours following the administration of the parent oligomeric compound.

1242. The oligomeric compound of any of embodiments 1230-1241, wherein the hepatotoxicity is measured 72 hours following the administration of the parent oligomeric compound.

1243. The oligomeric compound of any of embodiments 1230-1241, wherein the hepatotoxicity is measured 3 days following the administration of the parent oligomeric compound.

1244. The oligomeric compound of any of embodiments 1230-1241, wherein the hepatotoxicity is measured 5 days following the administration of the parent oligomeric compound.

1245. The oligomeric compound of any of embodiments 1230-1241, wherein the hepatotoxicity is measured 7 days following the administration of the parent oligomeric compound.

1246. The oligomeric compound of any of embodiments 1230-1241, wherein the hepatotoxicity is measured 10 days following the administration of the parent oligomeric compound.

1247. The oligomeric compound of any of embodiments 1230-1241, wherein the hepatotoxicity is measured 14 days following the administration of the parent oligomeric compound.

1248. The oligomeric compound of any of embodiments 1230-1241, wherein 1-10 mg/kg of the parent oligomeric compound is administered to the mouse.

1249. The oligomeric compound of any of embodiments 1230-1241, wherein 10-25 mg/kg of the parent oligomeric compound is administered to the mouse.

1250. The oligomeric compound of any of embodiments 1230-1241, wherein 25-50 mg/kg of the parent oligomeric compound is administered to the mouse.

1251. The oligomeric compound of any of embodiments 1230-1241, wherein 50-100 mg/kg of the parent oligomeric compound is administered to the mouse.

1252. The oligomeric compound of any of embodiments 1230-1241, wherein 100-150 mg/kg of the parent oligomeric compound is administered to the mouse.

1253. The oligomeric compound of any of embodiments 1230-1241, wherein the mouse is a BALB/c mouse, wherein 150 mg/kg of the parent oligomeric compound is administered to the mouse, and wherein the plasma ALT level in the mouse is measured 72 hours following the administration of the parent oligomeric compound.

1254. The oligomeric compound of any of embodiments 887-1253, wherein administration of 50 mg/kg of the oligomeric compound of any of embodiments 887-1253 to a mouse is not hepatotoxic to the mouse.

1255. The oligomeric compound of embodiment 1254, wherein plasma ALT level in the mouse is lower than 100 units per liter following the administration of the oligomeric compound of embodiment 1254.

1256. The oligomeric compound of embodiment 1254 or 1255, wherein plasma ALT level in the mouse is at least 10-fold lower than plasma ALT level in a mouse administered the parent oligomeric compound of the oligomeric compound of embodiment 1254 or 1255, wherein the administrations and plasma ALT measurements of both the oligomeric compound of embodiment 1254 or 1255 and the parent oligomeric compound are completed in the same way.

1257. The oligomeric compound of embodiment 1256, wherein the plasma ALT level in the mouse is at least 100-fold lower than the plasma ALT level in the mouse administered the parent oligomeric compound.

1258. The oligomeric compound of embodiment 1256, wherein the plasma ALT level in the mouse is at least 500-fold lower than the plasma ALT level in the mouse administered the parent oligomeric compound.

1259. The oligomeric compound of any of embodiments 1230-1258, wherein the therapeutic index in a mouse of the oligomeric compound of any of embodiments 1230-1258 is increased relative to the therapeutic index of the parent oligomeric compound.

1260. The oligomeric compound of embodiment 1259, wherein the therapeutic index in a mouse of the oligomeric compound of embodiment 1259 is at least two-fold greater than the therapeutic index of the parent oligomeric compound.

1261. The oligomeric compound of any of embodiments 887-1229, wherein an otherwise identical oligomeric compound lacking the at least one modified internucleoside linkage other than phosphorothioate and/or at least one modified nucleoside comprising a modified nucleobase other than 5-methylcytosine and/or a modified sugar moiety in the central region is hepatotoxic following administration to a mouse; and wherein the otherwise identical oligomeric compound has a central region consisting of phosphorothioate internucleoside linkages, unmodified 2′β-D-deoxyribosyl sugar moieties, and nucleobases selected from thymine, uracil, adenine, guanine, cytosine, and 5-methylcytosine.

1262. The oligomeric compound of embodiment 1261, wherein the at least one modified internucleoside linkage other than phosphorothioate and/or at least one modified nucleoside comprising a modified nucleobase other than 5-methylcytosine and/or a modified sugar moiety in the central region is a 2′-O-methyl modified sugar moiety.

1263. The oligomeric compound of embodiment 1262, wherein the 2′-O-methyl modified sugar moiety is at position 2 of the central region.

1264. The oligomeric compound of embodiment 1261-1263, wherein the otherwise identical oligomeric compound lacks a 2′-O-methyl modified sugar moiety, and wherein the otherwise identical oligomeric compound comprises an unmodified 2′β-D-deoxyribosyl sugar moiety in place of the 2′-O-methyl modified sugar moiety.

1265. The oligomeric compound of any of embodiments 1261-1264, wherein the nucleobase sequence of the otherwise identical oligomeric compound is 100% complementary to the target RNA.

1266. The oligomeric compound of any of embodiments 1261-1265, wherein the otherwise identical oligomeric compound is a parent oligomeric compound of the oligomeric compound of any of embodiments 1202-1206.

1267. The oligomeric compound of any of embodiments 1044-1266, wherein the oligomeric compound inhibits the target RNA with an IC 50 lower than 100 nM in a standard in vitro activity assay.

1268. The oligomeric compound of any of embodiments 1044-1266, wherein the parent oligomeric compound of the oligomeric compound of any of embodiments 1044-1266 inhibits the target RNA with an IC 50 lower than 100 nM in a standard in vitro activity assay.

1269. The oligomeric compound of any of embodiments 1044-1268, wherein the difference between the IC 50 of the parent oligomeric compound measured in a standard in vitro activity assay and the IC 50 of the oligomeric compound of any of embodiments 1044-1268 measured in a standard in vitro activity assay is less than 4-fold.

1270. The oligomeric compound of any of embodiments 1044-1268, wherein the difference between the IC 50 of the parent oligomeric compound measured in a standard in vitro activity assay and the IC 50 of the oligomeric compound of any of embodiments 1044-1268 measured in a standard in vitro activity assay is less than 3-fold.

1271. The oligomeric compound of any of embodiments 1044-1268, wherein the difference between the IC 50 of the parent oligomeric compound measured in a standard in vitro activity assay and the IC 50 of the oligomeric compound of any of embodiments 1044-1268 measured in a standard in vitro activity assay is less than 2-fold.

1272. The oligomeric compound of any of embodiments 1044-1271, wherein each sugar moiety of the central region of the parent oligomeric compound is an unmodified 2′-β-D-deoxyribosyl sugar moiety, and wherein each internucleoside linkage of the central region of the parent oligomeric compound is a phosphorothioate internucleoside linkage.

1273. The oligomeric compound of any of embodiments 1044-1272, wherein the nucleobase sequence of the parent oligomeric compound is 100% complementary to the target RNA.

1274. The oligomeric compound of any of embodiments 887-1273, wherein administration of 10-50 mg of the oligomeric compound to a human is not hepatotoxic to the human.

1275. The oligomeric compound of any of embodiments 887-1273, wherein administration of 50-100 mg of the oligomeric compound to a human is not hepatotoxic to the human.

1276. The oligomeric compound of any of embodiments 887-1273, wherein administration of 100-300 mg of the oligomeric compound to a human is not hepatotoxic to the human.

1277. The oligomeric compound of any of embodiments 1274-1276, wherein the administration is systemic administration.

1278. A composition comprising the oligomeric compound of any of embodiments 887-1277, and a second oligomeric compound, wherein the second oligomeric compound is complementary to the oligomeric compound of any of embodiments 887-1277.

1279. The composition of embodiment 1278, wherein the second oligomeric compound comprises at least 14 contiguous linked nucleosides that are at least 90% complementary to the oligomeric compound of any of embodiments 887-1277.

1280. The composition of embodiment 1278, wherein the second oligomeric compound comprises at least 14 contiguous linked nucleosides that are 100% complementary to the oligomeric compound of any of embodiments 887-1277.

1281. A pharmaceutical composition comprising the oligomeric compound of any of embodiments 887-1277 or the composition of any of embodiments 1278-1280, comprising a pharmaceutically acceptable carrier or diluent.

1282. A method comprising administering the oligomeric compound or composition of any of embodiments 887-1281 to a human subject.

1283. A method of treating a disease or disorder comprising administering the oligomeric compound or composition of any of embodiments 887-1281 to a human subject.

1284. A method of modulating the amount or activity of a target RNA in a human subject comprising administering the oligomeric compound or composition of any of embodiments 887-1281 to the human subject; and thereby modulating the amount or activity of the target RNA in the human subject.

1285. A method of treating a disease or disorder in a human subject comprising administering the oligomeric compound or composition of any of embodiments 887-1281 to the human subject having the disease or disorder; and thereby treating the disease or disorder in the human subject.

1286. The method of embodiment 1284 or 1285, wherein the disease or disorder is a liver disease, and wherein the oligomeric compound modulates the amount or activity of a liver target RNA.

1287. The method of embodiment 1284 or 1285, wherein the disease or disorder is a central nervous system disease, and wherein the oligomeric compound modulates the amount or activity of a central nervous system target RNA.

1288. The method of any of embodiments 1284-1287, wherein the disease or disorder is a cancer, a neurodegenerative disease, a cardiovascular disease, an immunological disease, a hereditary disease, a repeat expansion disease, a muscle-wasting disease, or a metabolic disease.

1289. The method of embodiment 1284 or 1285, wherein the oligomeric compound modulates the amount or activity of a white fat cell target.

1290. The method of embodiment 1284 or 1285, wherein the oligomeric compound modulates the amount or activity of a brown fat cell target.

1291. The method of embodiment 1284 or 1285, wherein the oligomeric compound modulates the amount or activity of an adipocyte target.

1292. The method of embodiment 1284 or 1285, wherein the oligomeric compound modulates the amount or activity of a macrophage target.

1293. The method of embodiment 1284 or 1285, wherein the oligomeric compound modulates the amount or activity of a cancer cell target.

1294. The method of embodiment 1284 or 1285, wherein the oligomeric compound modulates the amount or activity of a tumor cell target.

1295. The method of embodiment 1284 or 1285, wherein the oligomeric compound modulates the amount or activity of a smooth muscle cell target.

1296. The method of embodiment 1284 or 1285, wherein the oligomeric compound modulates the amount or activity of a lymphocyte target.

1297. The method of embodiment 1284 or 1285, wherein the oligomeric compound modulates the amount or activity of a pulmonary cell target.

1298. The method of embodiment 1284 or 1285, wherein the oligomeric compound modulates the amount or activity of a heart muscle cell target.

1299. The method of embodiment 1284 or 1285, wherein the oligomeric compound modulates the amount or activity of a cardiomyocyte target.

1300. The method of embodiment 1284 or 1285, wherein the oligomeric compound modulates the amount or activity of a endothelial cell target.

1301. The method of embodiment 1284 or 1285, wherein the oligomeric compound modulates the amount or activity of a fibroblast target.

1302. The method of embodiment 1284 or 1285, wherein the oligomeric compound modulates the amount or activity of a glial cell target.

1303. The method of embodiment 1284 or 1285, wherein the oligomeric compound modulates the amount or activity of a Schwann cell target.

1304. The method of embodiment 1284 or 1285, wherein the oligomeric compound modulates the amount or activity of a pancreatic cell target.

1305. The method of embodiment 1284 or 1285, wherein the oligomeric compound modulates the amount or activity of a kidney cell target.

1306. The method of embodiment 1284 or 1285, wherein the oligomeric compound modulates the amount or activity of a beta cell target.

1307. The method of embodiment 1284 or 1285, wherein the oligomeric compound modulates the amount or activity of a non-parenchymal cell target.

1308. The method of embodiment 1284 or 1285, wherein the oligomeric compound modulates the amount or activity of a hepatocyte target.

1309. The method of embodiment 1284 or 1285, wherein the oligomeric compound modulates the amount or activity of a oligodendrocyte target.

1310. The method of embodiment 1284 or 1285, wherein the oligomeric compound modulates the amount or activity of a astrocyte target.

1311. The method of embodiment 1284 or 1285, wherein the oligomeric compound modulates the amount or activity of a microglia target.

1312. The method of embodiment 1284 or 1285, wherein the oligomeric compound modulates the amount or activity of a ependymal cell target.

1313. The method of embodiment 1284 or 1285, wherein the oligomeric compound modulates the amount or activity of a sensory neuron target.

1314. The method of embodiment 1284 or 1285, wherein the oligomeric compound modulates the amount or activity of a motor neuron target.

1315. The method of embodiment 1284 or 1285, wherein the oligomeric compound modulates the amount or activity of a skeletal muscle target.

1316. The method of embodiment 1284 or 1285, wherein the oligomeric compound modulates the amount or activity of a cardiac muscle target.

1317. The method of embodiment 1284 or 1285, wherein the oligomeric compound modulates the amount or activity of a smooth muscle target.

1318. The method of embodiment 1284 or 1285, wherein the oligomeric compound modulates the amount or activity of a adipose tissue target.

1319. The method of embodiment 1284 or 1285, wherein the oligomeric compound modulates the amount or activity of a white adipose tissue target.

1320. The method of embodiment 1284 or 1285, wherein the oligomeric compound modulates the amount or activity of a spleen target.

1321. The method of embodiment 1284 or 1285, wherein the oligomeric compound modulates the amount or activity of a bone target.

1322. The method of embodiment 1284 or 1285, wherein the oligomeric compound modulates the amount or activity of a bone marrow target.

1323. The method of embodiment 1284 or 1285, wherein the oligomeric compound modulates the amount or activity of an intestinal target.

1324. The method of embodiment 1284 or 1285, wherein the oligomeric compound modulates the amount or activity of an adrenal gland target.

1325. The method of embodiment 1284 or 1285, wherein the oligomeric compound modulates the amount or activity of a testicular target.

1326. The method of embodiment 1284 or 1285, wherein the oligomeric compound modulates the amount or activity of an ovarian target.

1327. The method of embodiment 1284 or 1285, wherein the oligomeric compound modulates the amount or activity of a pancreatic target.

1328. The method of embodiment 1284 or 1285, wherein the oligomeric compound modulates the amount or activity of a pituitary gland target.

1329. The method of embodiment 1284 or 1285, wherein the oligomeric compound modulates the amount or activity of a prostate gland target.

1330. The method of embodiment 1284 or 1285, wherein the oligomeric compound modulates the amount or activity of a skin target.

1331. The method of embodiment 1284 or 1285, wherein the oligomeric compound modulates the amount or activity of an epidermal target.

1332. The method of embodiment 1284 or 1285, wherein the oligomeric compound modulates the amount or activity of a uterine target.

1333. The method of embodiment 1284 or 1285, wherein the oligomeric compound modulates the amount or activity of a bladder target.

1334. The method of embodiment 1284 or 1285, wherein the oligomeric compound modulates the amount or activity of a brain target.

1335. The method of embodiment 1284 or 1285, wherein the oligomeric compound modulates the amount or activity of a glomerulus target.

1336. The method of embodiment 1284 or 1285, wherein the oligomeric compound modulates the amount or activity of a distal tubular epithelium target.

1337. The method of embodiment 1284 or 1285, wherein the oligomeric compound modulates the amount or activity of a breast tissue target.

1338. The method of embodiment 1284 or 1285, wherein the oligomeric compound modulates the amount or activity of a lung target.

1339. The method of embodiment 1284 or 1285, wherein the oligomeric compound modulates the amount or activity of a heart target.

1340. The method of embodiment 1284 or 1285, wherein the oligomeric compound modulates the amount or activity of a kidney target.

1341. The method of embodiment 1284 or 1285, wherein the oligomeric compound modulates the amount or activity of a ganglion target.

1342. The method of embodiment 1284 or 1285, wherein the oligomeric compound modulates the amount or activity of a frontal cortex target.

1343. The method of embodiment 1284 or 1285, wherein the oligomeric compound modulates the amount or activity of a spinal cord target.

1344. The method of embodiment 1284 or 1285, wherein the oligomeric compound modulates the amount or activity of a trigeminal ganglion target.

1345. The method of embodiment 1284 or 1285, wherein the oligomeric compound modulates the amount or activity of a sciatic nerve target.

1346. The method of embodiment 1284 or 1285, wherein the oligomeric compound modulates the amount or activity of a dorsal root ganglion target.

1347. The method of embodiment 1284 or 1285, wherein the oligomeric compound modulates the amount or activity of a epidymal fat target.

1348. The method of embodiment 1284 or 1285, wherein the oligomeric compound modulates the amount or activity of a diaphragm target.

1349. The method of embodiment 1284 or 1285, wherein the oligomeric compound modulates the amount or activity of a colon target.

1350. The method of any of embodiments 1282-1349, wherein the plasma ALT level of the human subject after the administration is not more than three times higher than it was prior to the administration.

1351. The method of any of embodiments 1282-1350, wherein the plasma ALT level of the human subject after the administration is not more than 150 units per liter.

1352. The method of any of embodiments 1282-1351, wherein the human subject is susceptible to liver damage.

1353. The method of any of embodiments 1282-1352, wherein the human subject is susceptible to liver degeneration.

1354. The method of any of embodiments 1282-1353, wherein the human subject is susceptible to elevated apoptosis in the liver.

1355. The method of any of embodiments 1282-1354, wherein the human subject has a liver disease.

1356. The method of any of embodiments 1282-1355, wherein the human subject has kidney disease.

1357. The method of any of embodiments 1282-1356, wherein the human subject is susceptible to kidney damage.

1358. The method of any of embodiments 1282-1357, wherein the human subject has heart disease.

1359. The method of any of embodiments 1282-1358, wherein the human subject is susceptible to heart damage.

1360. The method of any of embodiments 1282-1359, wherein the human subject has pancreatitis.

1361. The method of any of embodiments 1282-1360, wherein the human subject is susceptible to pancreatic damage.

1362. The method of any of embodiments 1282-1361, wherein the human subject has a neurological disease.

1363. The method of any of embodiments 1282-1362, wherein the human subject is susceptible to neurological damage.

1364. The method of any of embodiments 1282-1363, comprising administering the parent oligomeric compound of the oligomeric compound of any of embodiments 887-1281 to a mouse.

1365. The method of any of embodiments 1282-1363, comprising contacting a cell with the parent oligomeric compound of the oligomeric compound of any of embodiments 887-1281.

1366. The method of embodiment 1364 or 1365, wherein each sugar moiety of the central region of the parent oligomeric compound is an unmodified 2′β-D-deoxyribosyl sugar moiety, and wherein each internucleoside linkage of the central region of the parent oligomeric compound is a phosphorothioate internucleoside linkage.

1367. A method of designing an oligomeric compound comprising starting with a parent oligomeric compound and changing the design of that compound in order to arrive at an oligomeric compound of any one of embodiments 887-1281.

1368. A method of designing an oligomeric compound comprising identifying a parent oligomeric compound and changing the design of that parent oligomeric compound to arrive at a second oligomeric compound, wherein the second oligomeric compound is an oligomeric compound of any one of embodiments 887-1281.

1369. A method of improving hepatotoxicity of an oligomeric compound comprising the steps of (i) identifying a parent oligomeric compound that has plasma ALT levels above 300 units per liter in a mouse, and (ii) providing an oligomeric compound according to any one of embodiments 887-1281. 1370. The method of embodiment 1368 or 1369, wherein the method designs an oligomeric compound with improved therapeutic index relative to the parent oligomeric compound.

1371. The method of embodiment 1368 or 1369, wherein the method designs an oligomeric compound with lower hepatotoxicity relative to the parent oligomeric compound.

1372. The method of embodiment 1368, wherein the second oligomeric compound has an improved therapeutic index relative to the parent oligomeric compound.

1373. The method of embodiment 1368 or 1369, wherein the second oligomeric compound has reduced hepatotoxicity in a mouse relative to the parent oligomeric compound.

1374. The method of embodiment 1368, wherein the oligomeric compound according to any one of embodiments 887-1281 has reduced hepatotoxicity relative to the parent oligomeric compound.

1375. A method comprising administering an oligomeric compound of any of embodiments 887-1281 to a mouse and separately administering the parent oligomeric compound of the oligomeric compound of any of embodiments 887-1281 to a second mouse, wherein the therapeutic index of the oligomeric compound of any of embodiments 887-1281 is improved relative to the therapeutic index of the parent oligomeric compound.

1376. The method of any of embodiments 1282-1375, wherein the level of p21 RNA is measured in the mouse, the cell, and/or the human subject.

1377. A method comprising administering an oligomeric compound of any of embodiments 887-1281 to a subject and measuring the level of p21 RNA in the subject.

1378. The method of embodiment 1377, wherein the subject is a mouse.

1379. The method of embodiment 1377, wherein the subject is a human.

1380. The method of any of embodiments 1377-1379, wherein the p21 RNA level is measured within 24 hours of the administration.

1381. The method of any of embodiments 1377-1380, wherein the p21 RNA level is measured 24-48 hours following the administration.

1382. An oligomeric compound or composition of any one of embodiments 887-1281, for use in medical therapy.

1383. The oligomeric compound of any of embodiments 887-1281, wherein the oligomeric compound is not toxic.

1384. The oligomeric compound of any of embodiment 887-1281, wherein a comparator compound is toxic; wherein the comparator compound is identical to the oligomeric compound except that each nucleoside of the central region of the comparator compound is a nucleoside comprising 2′-β-D-deoxyribosyl sugar moiety.

1385. The oligomeric compound of embodiment 1384, wherein administering a dose of the oligomeric compound to an animal results in a circulating ALT level that is at least 3-fold lower than the ALT level that results from administering the same dose of the comparator compound to an animal for at least one matched dose.

1386. The oligomeric compound of embodiment 1384 or 1385, wherein the lowest dose of the oligomeric compound that raises circulating ALT to over 300 units per liter is at least three-fold higher than the lowest dose of the comparator compound that raises circulating ALT to over 300 units per liter.

1387. The oligomeric compound of any of embodiments 1384-1386, wherein the oligomeric compound is capable of reducing the target RNA in a cell.

1388. The oligomeric compound of embodiment 1387, wherein the oligomeric compound has RNA-reducing activity comparable to a comparator compound, wherein the comparator compound is identical to the oligomeric compound except that each nucleoside of the central region of the comparator compound is a nucleoside comprising 2′β-D-deoxyribosyl sugar moiety.

1389. The oligomeric compound of embodiment 1388 having RNA-reducing activity that is no more than 2-fold worse than the RNA-reducing activity of the comparator compound.

1390. A method of modulating the amount or activity of a target RNA in a human subject comprising administering the oligomeric compound or composition of any of embodiments 887-1281 to the human subject; and thereby modulating the amount or activity of the target RNA in the human subject.

1391. A method of treating a disease or disorder in a human subject comprising administering the oligomeric compound or composition of any of embodiments 887-1281 to the human subject having the disease or disorder; and thereby treating the disease or disorder in the human subject.

1392. The method of embodiment 1390 or 1391, wherein the disease or disorder is a liver disease, and wherein the oligomeric compound modulates the amount or activity of a liver target RNA.

1393. The method of embodiment 1390 or 1391, wherein the disease or disorder is a central nervous system disease, and wherein the oligomeric compound modulates the amount or activity of a central nervous system target RNA.

1394. The method of any of embodiments 1390-1393, wherein the disease or disorder is a cancer, a neurodegenerative disease, a cardiovascular disease, an immunological disease, a hereditary disease, a repeat expansion disease, a muscle-wasting disease, or a metabolic disease.

1395. The method of any of embodiments 1390-1394, wherein the plasma ALT level of the human subject after the administration is not more than three times higher than it was prior to the administration.

1396. The method of any of embodiments 1390-1395, wherein the plasma ALT level of the human subject after the administration is not more than 150 units per liter.

1397. A method of treating a disease or disorder in a human subject comprising administering the oligomeric compound or composition of any of embodiments 887-1281 to the human subject having the disease or disorder; and thereby treating the disease or disorder in the human subject.

1398. The method of embodiment 1397, wherein the disease or disorder is not a CNS disease or disorder.

1399. The method of embodiment 1397, wherein the disease or disorder is a disease or disorder of the white fat cells.

1400. The method of embodiment 1397, wherein the disease or disorder is a disease or disorder of the brown fat cells.

1401. The method of embodiment 1397, wherein the disease or disorder is a disease or disorder of the adipocytes.

1402. The method of embodiment 1397, wherein the disease or disorder is a disease or disorder of the macrophages.

1403. The method of embodiment 1397, wherein the disease or disorder is a disease or disorder of the cancer cells.

1404. The method of embodiment 1397, wherein the disease or disorder is a disease or disorder of the tumor cells.

1405. The method of embodiment 1397, wherein the disease or disorder is a disease or disorder of the smooth muscle cells.

1406. The method of embodiment 1397, wherein the disease or disorder is a disease or disorder of the lymphocytes.

1407. The method of embodiment 1397, wherein the disease or disorder is a disease or disorder of the pulmonary cells.

1408. The method of embodiment 1397, wherein the disease or disorder is a disease or disorder of the heart muscle cells.

1409. The method of embodiment 1397, wherein the disease or disorder is a disease or disorder of the cardiomyocytes.

1410. The method of embodiment 1397, wherein the disease or disorder is a disease or disorder of the endothelial cells.

1411. The method of embodiment 1397, wherein the disease or disorder is a disease or disorder of the fibroblasts.

1412. The method of embodiment 1397, wherein the disease or disorder is a disease or disorder of the glial cells.

1413. The method of embodiment 1397, wherein the disease or disorder is a disease or disorder of the Schwann cells.

1414. The method of embodiment 1397, wherein the disease or disorder is a disease or disorder of the pancreatic cells.

1415. The method of embodiment 1397, wherein the disease or disorder is a disease or disorder of the kidney cells.

1416. The method of embodiment 1397, wherein the disease or disorder is a disease or disorder of the beta cells.

1417. The method of embodiment 1397, wherein the disease or disorder is a disease or disorder of the non-parenchymal cells.

1418. The method of embodiment 1397, wherein the disease or disorder is a disease or disorder of the hepatocytes.

1419. The method of embodiment 1397, wherein the disease or disorder is a disease or disorder of the oligodendrocytes.

1420. The method of embodiment 1397, wherein the disease or disorder is a disease or disorder of the astrocytes.

1421. The method of embodiment 1397, wherein the disease or disorder is a disease or disorder of the microglia.

1422. The method of embodiment 1397, wherein the disease or disorder is a disease or disorder of the ependymal cells.

1423. The method of embodiment 1397, wherein the disease or disorder is a disease or disorder of the sensory neurons.

1424. The method of embodiment 1397, wherein the disease or disorder is a disease or disorder of the motor neurons.

1425. The method of embodiment 1397, wherein the disease or disorder is a disease or disorder of the skeletal muscle.

1426. The method of embodiment 1397, wherein the disease or disorder is a disease or disorder of the cardiac muscle.

1427. The method of embodiment 1397, wherein the disease or disorder is a disease or disorder of the smooth muscle.

1428. The method of embodiment 1397, wherein the disease or disorder is a disease or disorder of the adipose tissue.

1429. The method of embodiment 1397, wherein the disease or disorder is a disease or disorder of the white adipose tissue.

1430. The method of embodiment 1397, wherein the disease or disorder is a disease or disorder of the spleen.

1431. The method of embodiment 1397, wherein the disease or disorder is a disease or disorder of the bone.

1432. The method of embodiment 1397, wherein the disease or disorder is a disease or disorder of the bone marrow.

1433. The method of embodiment 1397, wherein the disease or disorder is a disease or disorder of the intestine.

1434. The method of embodiment 1397, wherein the disease or disorder is a disease or disorder of the adrenal glands.

1435. The method of embodiment 1397, wherein the disease or disorder is a disease or disorder of the testes.

1436. The method of embodiment 1397, wherein the disease or disorder is a disease or disorder of the ovaries.

1437. The method of embodiment 1397, wherein the disease or disorder is a disease or disorder of the pancreas.

1438. The method of embodiment 1397, wherein the disease or disorder is a disease or disorder of the pituitary gland.

1439. The method of embodiment 1397, wherein the disease or disorder is a disease or disorder of the prostate gland.

1440. The method of embodiment 1397, wherein the disease or disorder is a disease or disorder of the skin.

1441. The method of embodiment 1397, wherein the disease or disorder is a disease or disorder of the epidermis.

1442. The method of embodiment 1397, wherein the disease or disorder is a disease or disorder of the uterus.

1443. The method of embodiment 1397, wherein the disease or disorder is a disease or disorder of the bladder.

1444. The method of embodiment 1397, wherein the disease or disorder is a disease or disorder of the brain.

1445. The method of embodiment 1397, wherein the disease or disorder is a disease or disorder of the glomerulus.

1446. The method of embodiment 1397, wherein the disease or disorder is a disease or disorder of the distal tubular epithelium.

1447. The method of embodiment 1397, wherein the disease or disorder is a disease or disorder of the breast tissue.

1448. The method of embodiment 1397, wherein the disease or disorder is a disease or disorder of the lung.

1449. The method of embodiment 1397, wherein the disease or disorder is a disease or disorder of the heart.

1450. The method of embodiment 1397, wherein the disease or disorder is a disease or disorder of the kidney.

1451. The method of embodiment 1397, wherein the disease or disorder is a disease or disorder of the ganglion.

1452. The method of embodiment 1397, wherein the disease or disorder is a disease or disorder of the frontal cortex.

1453. The method of embodiment 1397, wherein the disease or disorder is a disease or disorder of the spinal cord.

1454. The method of embodiment 1397, wherein the disease or disorder is a disease or disorder of the trigeminal ganglion.

1455. The method of embodiment 1397, wherein the disease or disorder is a disease or disorder of the sciatic nerve.

1456. The method of embodiment 1397, wherein the disease or disorder is a disease or disorder of the dorsal root ganglion.

1457. The method of embodiment 1397, wherein the disease or disorder is a disease or disorder of the epidymal fat.

1458. The method of embodiment 1397, wherein the disease or disorder is a disease or disorder of the diaphragm.

1459. The method of embodiment 1397, wherein the disease or disorder is a disease or disorder of the colon.

1460. A method of screening a library of oligomeric compounds for activity against a target RNA, wherein the library of oligomeric compounds comprises a plurality of oligomeric compounds of any of embodiments 887-1281.

1461. An oligomeric compound comprising a modified oligonucleotide consisting of 12-21 linked nucleosides, wherein the modified oligonucleotide has the formula A-B-C, wherein A is a 5′-region, B is a central region, and C is a 3′-region; wherein:

the 5′-region consists of 1-5 linked nucleosides, wherein at least one nucleoside of the 5′-region is a modified nucleoside comprising a modified sugar; the 3′-region consists of 1-5 linked nucleosides wherein at least one nucleoside of the 3′-region is a modified nucleoside comprising a modified sugar; and the central region consists of 7-11 linked nucleosides, wherein

the 5′-most portion of the central region has the following formula:

(N da )(N x )(N y )(N z )(N db )

wherein one of N x , N y , and N z , is a safety-enhancing nucleoside; the other two of N x , N y , and N z are independently selected from an unmodified 2′β-D-deoxyribosyl sugar moiety, a DNA isomer, a modified DNA isomer, and a DNA mimic; and N da and N db are each independently selected from an unmodified 2′-β-D-deoxyribosyl sugar moiety, a DNA isomer, a modified DNA isomer, and a DNA mimic.

1462. The oligomeric compound of embodiment 1461, wherein the 5′-region consists of one nucleoside.

1463. The oligomeric compound of embodiment 1461, wherein the 5′-region consists of 2-5 linked nucleosides.

1464. The oligomeric compound of embodiment 1461, wherein the 5′-region consists of 2-4 linked nucleosides.

1465. The oligomeric compound of embodiment 1461, wherein the 5′-region consists of 2 linked nucleosides.

1466. The oligomeric compound of embodiment 1461, wherein the 5′-region consists of 3 linked nucleosides.

1467. The oligomeric compound of embodiment 1461, wherein the 5′-region consists of 4 linked nucleosides.

1468. The oligomeric compound of embodiment 1461, wherein the 5′-region consists of 5 linked nucleosides.

1469. The oligomeric compound of any of embodiments 1461-1468, wherein each nucleoside of the 5′-region is a modified nucleoside.

1470. The oligomeric compound of any of embodiments 1461-1469, wherein each nucleoside of the 5′-region is a modified nucleoside comprising a modified sugar.

1471. The oligomeric compound of any of embodiments 1461-1470, wherein each modified nucleoside of the 5′-region has the same modification.

1472. The oligomeric compound of and of embodiments 1461-1470, wherein at least two nucleosides of the 5′-region are modified nucleosides having different modifications.

1473. The oligomeric compound of any of embodiments 1461-1472, wherein each nucleoside of the 5′-region comprises a 2′-modified ribosyl sugar moiety.

1474. The oligomeric compound of any of embodiments 1461-1473, wherein at least one nucleoside of the 5′-region comprises a bicyclic furanosyl sugar moiety.

1475. The oligomeric compound of any of embodiments 1461-1474, wherein each nucleoside of the 5′-region comprises a bicyclic furanosyl sugar moiety.

1476. The oligomeric compound of any of embodiments 1461-1474, wherein at least one nucleoside of the 5′-region comprises a non-bicyclic sugar moiety.

1477. The oligomeric compound of embodiment 1476, wherein the non-bicyclic sugar moiety of the at least one nucleoside of the 5′-region is a 2′-substituted ribosyl sugar moiety.

1478. The oligomeric compound of any of embodiments 1461-1474 or 1476-1477, wherein each nucleoside of the 5′-region comprises a non-bicyclic sugar moiety.

1479. The oligomeric compound of embodiment 1478, wherein each nucleoside of the 5′-region comprises a 2′-substituted furanosyl sugar moiety.

1480. The oligomeric compound of any of embodiments 1461-1474 or 1476-1477, wherein each nucleoside of the 5′-region comprises a 2′-modified furanosyl sugar moiety independently selected from a bicyclic sugar moiety and a non-bicyclic 2′-substituted ribosyl sugar moiety.

1481. The oligomeric compound of any of embodiments 1461-1477 or 1480, wherein each nucleoside of the 5′-region comprises a bicyclic sugar moiety.

1482. The oligomeric compound of any of embodiments 1461-1474 or 1476-1480, wherein each nucleoside of the 5′-region comprises a non-bicyclic 2′-substituted ribosyl sugar moiety.

1483. The oligomeric compound of any of embodiments 1461-1477 or 1480-1481, wherein each bicyclic sugar moiety of the 5′-region is selected from among cEt, LNA, and ENA.

1484. The oligomeric compound of any of embodiments 1461-1477 or 1480-1481, wherein each bicyclic sugar moiety of the 5′-region is a cEt sugar moiety.

1485. The oligomeric compound of any of embodiments 1461-1477 or 1480-1481, wherein each bicyclic sugar moiety of the 5′-region is an LNA sugar moiety.

1486. The oligomeric compound of any of embodiments 1461-1474, 1476-1480, or 1482-1485, wherein each non-bicyclic sugar moiety of the 5′-region has a 2′-substituent selected from among 2′-MOE, 2′-OMe, and 2′-NMA.

1487. The oligomeric compound of any of embodiments 1461-1486, wherein none of the nucleosides of the 5′-region comprise a sugar moiety having a 2′-F substituent.

1488. The oligomeric compound of any of embodiments 1461-1487, wherein none of the nucleosides of the 5′-region comprise a sugar moiety having a 2′-MOE substituent.

1489. The oligomeric compound of any of embodiments 1461-1488, wherein none of the nucleosides of the 5′-region comprise a sugar moiety having a 2′-OMe substituent.

1490. The oligomeric compound of any of embodiments 1461-1489, wherein none of the nucleosides of the 5′-region comprise a cEt sugar moiety.

1491. The oligomeric compound of any of embodiments 1461-1490, wherein none of the nucleosides of the 5′-region comprise a LNA sugar moiety.

1492. The oligomeric compound of any of embodiments 1461-1491, wherein each nucleobase of the 5′-region is independently selected from among thymine, uracil, guanine, cytosine, 5-methylcytosine, and adenine.

1493. The oligomeric compound of any of embodiments 1461-1492, wherein each internucleoside linkage of the 5′-region is independently selected from among phosphodiester and phosphorothioate internucleoside linkages.

1494. The oligomeric compound of any of embodiments 1461-1493, wherein the 3′-region consists of one nucleoside.

1495. The oligomeric compound of any of embodiments 1461-1493, wherein the 3′-region consists of 2-5 linked nucleosides.

1496. The oligomeric compound of any of embodiments 1461-1493, wherein the 3′-region consists of 2-4 linked nucleosides.

1497. The oligomeric compound of any of embodiments 1461-1493, wherein the 3′-region consists of 2 linked nucleosides.

1498. The oligomeric compound of any of embodiments 1461-1493, wherein the 3′-region consists of 3 linked nucleosides.

1499. The oligomeric compound of any of embodiments 1461-1493, wherein the 3′-region consists of 4 linked nucleosides.

1500. The oligomeric compound of any of embodiments 1461-1493, wherein the 3′-region consists of 5 linked nucleosides.

1501. The oligomeric compound of any of embodiments 1461-1500, wherein each nucleoside of the 3′-region is a modified nucleoside.

1502. The oligomeric compound of any of embodiments 1461-1501, wherein each nucleoside of the 3′-region is a modified nucleoside comprising a modified sugar moiety.

1503. The oligomeric compound of any of embodiments 1461-1502, wherein each modified nucleoside of the 3′-region has the same modification.

1504. The oligomeric compound of and of embodiments 1461-1502, wherein at least two nucleosides of the 3′-region are modified nucleosides having different modifications.

1505. The oligomeric compound of any of embodiments 1461-1504, wherein each nucleoside of the 3′-region comprises a 2′-modified ribosyl sugar moiety.

1506. The oligomeric compound of any of embodiments 1461-1505, wherein at least one nucleoside of the 3′-region comprises a bicyclic furanosyl sugar moiety.

1507. The oligomeric compound of any of embodiments 1461-1506, wherein each nucleoside of the 3′-region comprises a bicyclic furanosyl sugar moiety.

1508. The oligomeric compound of any of embodiments 1461-1506, wherein at least one nucleoside of the 3′-region comprises a non-bicyclic sugar moiety.

1509. The oligomeric compound of embodiment 1508, wherein the non-bicyclic sugar moiety of the at least one nucleoside of the 3′-region is a 2′-substituted ribosyl sugar moiety.

1510. The oligomeric compound of any of embodiments 1461-1509, wherein each nucleoside of the 3′-region comprises a non-bicyclic sugar moiety.

1511. The oligomeric compound of embodiment 1510, wherein each nucleoside of the 3′-region comprises a 2′-substituted furanosyl sugar moiety.

1512. The oligomeric compound of any of embodiments 1461-1511, wherein each nucleoside of the 3′-region comprises a 2′-modified furanosyl sugar moiety independently selected from a bicyclic sugar moiety and a non-bicyclic 2′-substituted ribosyl sugar moiety.

1513. The oligomeric compound of any of embodiments 1461-1512, wherein each nucleoside of the 3′-region comprises a bicyclic sugar moiety.

1514. The oligomeric compound of any of embodiments 1461-1512, wherein each nucleoside of the 3′-region comprises a non-bicyclic 2′-substituted ribosyl sugar moiety.

1515. The oligomeric compound of any of embodiments 1461-1509 or 1512-1513, wherein each bicyclic sugar moiety of the 3′-region is selected from among cEt, LNA, and ENA.

1516. The oligomeric compound of any of embodiments 1461-1509, 1512-1513, or 1515, wherein each bicyclic sugar moiety of the 3′-region is a cEt sugar moiety.

1517. The oligomeric compound of any of embodiments 1461-1509, 1512-1513, or 1515, wherein each bicyclic sugar moiety of the 3′-region is an LNA sugar moiety.

1518. The oligomeric compound of any of embodiments 1461-1506, 1508-1512 or 1514, wherein each non-bicyclic sugar moiety of the 3′-region has a 2′-substituent selected from among 2′-MOE, 2′-OMe, and 2′-NMA.

1519. The oligomeric compound of any of embodiments 1461-1518, wherein none of the nucleosides of the 3′-region comprise a sugar moiety having a 2′-F substituent.

1520. The oligomeric compound of any of embodiments 1461-1519, wherein none of the nucleosides of the 3′-region comprise a sugar moiety having a 2′-MOE substituent.

1521. The oligomeric compound of any of embodiments 1461-1520, wherein none of the nucleosides of the 3′-region comprise a sugar moiety having a 2′-OMe substituent.

1522. The oligomeric compound of any of embodiments 1461-1521, wherein none of the nucleosides of the 3′-region comprise a cEt sugar moiety.

1523. The oligomeric compound of any of embodiments 1461-1522, wherein none of the nucleosides of the 3′-region comprise a LNA sugar moiety.

1524. The oligomeric compound of any of embodiments 1461-1523, wherein each nucleobase of the 3′-region is independently selected from among thymine, uracil, guanine, cytosine, 5-methylcytosine, and adenine.

1525. The oligomeric compound of any of embodiments 1461-1524, wherein each internucleoside linkage of the 3′-region is independently selected from among phosphodiester and phosphorothioate internucleoside linkages.

1526. The oligomeric compound of any of embodiments 1461-1525, wherein the modified nucleosides of the 5′-region have the same modifications as the modifications of the modified nucleosides of the 3′-region.

1527. The oligomeric compound of any of embodiments 1461-1525, wherein at least one modified nucleoside of the 5′-region and one modified nucleoside of the 3′-region comprise modifications that differ from one another.

1528. The oligomeric compound of any of embodiments 1461-1474, 1476-1477, 1480, 1483-1506, 1508-1509, 1512, 1515-1527, wherein the 5′-region and the 3′-region together include at least one non-bicyclic 2′-substituted modified nucleoside and at least one bicyclic nucleoside.

1529. The oligomeric compound of any of embodiment 1528, where the bicyclic nucleoside is a cEt nucleoside.

1530. The oligomeric compound of embodiment 1528, where the bicyclic nucleoside is an LNA nucleoside.

1531. The oligomeric compound of any of embodiments 1528-1530, wherein the non-bicyclic 2′-modified nucleoside is a 2′-MOE nucleoside.

1532. The oligomeric compound of any of embodiments 1528-1530, wherein the non-bicyclic 2′-modified nucleoside is a 2′-OMe nucleoside.

1533. The oligomeric compound of any of embodiments 1528-1532, wherein at least one nucleoside of the 5′-region or the 3′-region is an unmodified 2′β-D-deoxyribosyl sugar moiety.

1534. The oligomeric compound of any of embodiments 1461-1533, wherein the central region has the formula:

(N da )(N x )(N y )(N z )(N db )(N dc ) q

wherein each N dc is independently selected from an unmodified 2′β-D-deoxyribosyl sugar moiety, a DNA isomer, a modified DNA isomer, and a DNA mimic; and q is 2-6.

1535. The oligomeric compound of any of embodiments 1461-1534, wherein the central region consists of 7 linked nucleosides.

1536. The oligomeric compound of any of embodiments 1461-1534, wherein the central region consists of 8 linked nucleosides.

1537. The oligomeric compound of any of embodiments 1461-1534, wherein the central region consists of 9 linked nucleosides.

1538. The oligomeric compound of any of embodiments 1461-1534, wherein the central region consists of 10 linked nucleosides.

1539. The oligomeric compound of any of embodiments 1461-1534, wherein the central region consists of 11 linked nucleosides.

1540. The oligomeric compound of any of embodiments 1461-1539, wherein Nx is the safety-enhancing nucleoside.

1541. The oligomeric compound of any of embodiments 1461-1539, wherein Ny is the safety-enhancing nucleoside.

1542. The oligomeric compound of any of embodiments 1461-1539, wherein Nz is the safety-enhancing nucleoside.

1543. The oligomeric compound of any of embodiments 1461-1542, wherein the safety enhancing nucleoside is a DNA isomer or a modified DNA isomer, or a modified nucleoside comprising either a sugar surrogate, a bicyclic furanosyl sugar moiety, or a non-bicyclic modified furanosyl sugar moiety.

1544. The oligomeric compound of any of embodiments 1461-1543, wherein the safety enhancing nucleoside is a DNA isomer or a modified DNA isomer, or comprises either a sugar surrogate, a bicyclic furanosyl sugar moiety, a non-bicyclic, 2′-modified furanosyl sugar moiety, a non-bicyclic 3′-modified furanosyl sugar moiety, a non-bicyclic, 4′-modified furanosyl sugar moiety, or a non-bicyclic 5′-modified furanosyl sugar moiety.

1545. The oligomeric compound of any of embodiments 1461-1544, wherein the safety enhancing nucleoside comprises a sugar surrogate selected from a morpholino, a modified morpholino, a modified cyclohexenyl, or a modified tetrahydropyran.

1546. The oligomeric compound of any of embodiments 1461-1544, wherein the safety enhancing nucleoside comprises a sugar surrogate selected from a morpholino, a modified morpholino, 2′-fluoroarabinose, 2′-fluororibose, CeNA, F-CeNA, HNA, OMe-HNA or F-HNA.

1547. The oligomeric compound of any of embodiments 1461-1544, wherein the safety enhancing nucleoside is a DNA isomer comprising a sugar moiety selected from among 2′-β-D-deoxyxylosyl, 2′-α-L-deoxyribosyl, 2′β-L-deoxyribosyl, 2′-α-D-deoxyxylosyl, 2′-α-D-deoxyribosyl, 2′-α-L-deoxyxylosyl, and 2′-O-L-deoxyxylosyl.

1548. The oligomeric compound of any of embodiments 1461-1544 or 1547, wherein the safety enhancing nucleoside is a DNA isomer comprising a sugar moiety selected from among 2′-β-D-deoxyxylosyl, 2′-α-L-deoxyribosyl, and 2′-β-L-deoxyribosyl.

1549. The oligomeric compound of any of embodiments 1461-1544, wherein the safety enhancing nucleoside is a modified DNA isomer comprising a 2′-modified sugar moiety, wherein the sugar moiety has the conformation 2′-β-D-deoxyxylosyl, 2′-α-L-deoxyribosyl, 2′-β-L-deoxyribosyl, 2′-α-D-deoxyxylosyl, 1, 2′-α-L-deoxyxylosyl, and 2′-β-L-deoxyxylosyl and the 2′ position is further substituted with a hydroxyl, a fluoro, or O—C 1 -C 10 alkoxy substituent.

1550. The oligomeric compound of any of embodiments 1461-1544 or 1549, wherein the safety enhancing nucleoside is a modified DNA isomer comprising a 2′-modified sugar moiety, wherein the sugar moiety has the conformation 2′-β-D-deoxyxylosyl, 2′-α-L-deoxyribosyl, 2′-β-L-deoxyribosyl, 2′-α-D-deoxyxylosyl, 1, 2′-α-L-deoxyxylosyl, and 2′-β-L-deoxyxylosyl and the 2′ position is further substituted with a hydroxyl, a fluoro, or OMe substituent.

1551. The oligomeric compound of any of embodiments 1461-1544 or 1549-1550, wherein the safety enhancing nucleoside is a modified DNA isomer comprising a 2′-modified sugar moiety, wherein the sugar moiety has the conformation 2′-β-D-deoxyxylosyl, 2′-α-L-deoxyribosyl, 2′-β-L-deoxyribosyl, 2′-α-D-deoxyxylosyl, 1, 2′-α-L-deoxyxylosyl, and 2′-β-L-deoxyxylosyl and the 2′ position is further substituted with a fluoro or OMe substituent.

1552. The oligomeric compound of any of embodiments 1461-1544 or 1549-1551, wherein the safety enhancing nucleoside is a modified DNA isomer comprising a sugar moiety selected from among 2′-β-D-deoxyxylosyl, 2′-α-L-deoxyribosyl, and 2′-β-L-deoxyribosyl and the 2′ position is further substituted with a hydroxyl, fluoro, or OMe substituent.

1553. The oligomeric compound of any of embodiments 1461-1544, wherein the safety enhancing nucleoside is a modified nucleoside comprising a bicyclic furanosyl sugar moiety.

1554. The oligomeric compound of any of embodiments 1461-1544, wherein the safety enhancing nucleoside is selected from among cEt, LNA, α-L-LNA, and ENA.

1555. The oligomeric compound of any of embodiments 1461-1544, wherein the safety enhancing nucleoside comprises a 2′-substituted furanosyl sugar moiety.

1556. The oligomeric compound of embodiment 1555, wherein the 2′-substituted furanosyl sugar moiety of the safety enhancing nucleoside has a 2′ substituent selected from: halo, allyl, amino, azido, SH, CN, OCN, CF 3 , OCF 3 , O—C 1 -C 10 alkoxy, O—C 1 -C 10 substituted alkoxy, C 1 -C 10 alkyl, C 1 -C 10 substituted alkyl, S-alkyl, N(R m )-alkyl, O-alkenyl, S-alkenyl, N(R m )-alkenyl, O-alkynyl, S-alkynyl, N(R m )-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH 2 ) 2 SCH 3 , O(CH 2 ) 2 ON(R m )(R n ) or OCH 2 C(═O)—N(R m )(R n ), where each R m and R n is, independently, H, an amino protecting group, or substituted or unsubstituted C 1 -C 10 alkyl.

1557. The oligomeric compound of embodiment 1555, wherein the 2′-substituted furanosyl sugar moiety of the safety enhancing nucleoside has a 2′ substituent selected from: halo, O—C 1 -C 10 alkoxy, O—C 1 -C 10 substituted alkoxy, C 1 -C 10 alkyl, C 1 -C 10 substituted alkyl, S-alkyl, N(R m )-alkyl, O(CH 2 ) 2 ON(R m )(R n ) or OCH 2 C(═O)—N(R m )(R n ), where each R m and R n is, independently, H, an amino protecting group, or substituted or unsubstituted C 1 -C 10 alkyl.

1558. The oligomeric compound of embodiment 1555, wherein the 2′-substituted furanosyl sugar moiety of the safety enhancing nucleoside has a 2′ substituent selected from: fluoro, OMe, MOE, NMA.

1559. The oligomeric compound of any of embodiments 1461-1558, wherein the safety enhancing nucleoside comprises a 2′-substituted furanosyl sugar moiety comprising a 2′-OMe or 2′-MOE.

1560. The oligomeric compound of any of embodiments 1461-1559, wherein the safety enhancing nucleoside comprises a 2′-substituted furanosyl sugar moiety comprising a 2′-OMe.

1561. The oligomeric compound of any of embodiments 1461-1560, wherein the safety enhancing nucleoside comprises a 2′-OMe modified 2′-β-D-deoxyribosyl sugar moiety.

1562. The oligomeric compound of any of embodiments 1461-1544, wherein the safety enhancing nucleoside comprises a 3′-modified furanosyl sugar moiety having a 3′ substituent selected from: halo, allyl, amino, azido, SH, CN, CF 3 , OCF 3 , C 1 -C 10 alkyl, C 1 -C 10 substituted alkyl, S-alkyl, N(R m )-alkyl, N(R m )-alkenyl, N(R m )-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, or aralkyl.

1563. The oligomeric compound of any of embodiments 1461-1544 or embodiment 1562, wherein the safety enhancing nucleoside comprises a 3′-modified furanosyl sugar moiety having a 3′ substituent selected from: C 1 -C 10 alkyl, or C 1 -C 10 substituted alkyl.

1564. The oligomeric compound of any of embodiments 1461-1544 or 1562-1563, wherein the safety enhancing nucleoside comprises a 3′-methyl furanosyl sugar moiety.

1565. The oligomeric compound of any of embodiments 1461-1544, wherein the safety enhancing nucleoside comprises a 4′-modified furanosyl sugar moiety having a 4′ substituent selected from: halo, allyl, amino, azido, SH, CN, OCN, CF 3 , OCF 3 , O—C 1 -C 10 alkoxy, O—C 1 -C 10 substituted alkoxy, C 1 -C 10 alkyl, C 1 -C 10 substituted alkyl, S-alkyl, N(R m )- alkyl, O-alkenyl, S-alkenyl, N(R m )-alkenyl, O-alkynyl, S-alkynyl, N(R m )-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH 2 ) 2 SCH 3 , O(CH 2 ) 2 ON(R m )(R n ) or OCH 2 C(═O)—N(R m )(R n ), where each R m and R n is, independently, H, an amino protecting group, or substituted or unsubstituted C 1 -C 10 alkyl.

1566. The oligomeric compound of any of embodiments 1461-1544 or 1565, wherein the safety enhancing nucleoside comprises a 4′-modified furanosyl sugar moiety having a 4′-methyl.

1567. The oligomeric compound of any of embodiments 1461-1544, wherein the safety enhancing nucleoside has the structure shown below, wherein R represents an optional 2′ substituent group and Bx is a heterocyclic base moiety:

1568. The oligomeric compound of embodiment 1567, wherein in R is selected from among H, OH, OMe, F, or MOE.

1569. The oligomeric compound of any of embodiments 1461-1544, wherein the safety enhancing nucleoside comprises a 5′-modified furanosyl sugar moiety having a 5′ substituent selected from: halo, allyl, amino, azido, SH, CN, OCN, CF 3 , OCF 3 , O—C 1 -C 10 alkoxy, O—C 1 -C 10 substituted alkoxy, C 1 -C 10 alkyl, C 1 -C 10 substituted alkyl, S-alkyl, N(R m )- alkyl, O-alkenyl, S-alkenyl, N(R m )-alkenyl, O-alkynyl, S-alkynyl, N(R m )-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH 2 ) 2 SCH 3 , O(CH 2 ) 2 ON(R m )(R n ) or OCH 2 C(═O)—N(R m )(R n ), where each R m and R n is, independently, H, an amino protecting group, or substituted or unsubstituted C 1 -C 10 alkyl.

1570. The oligomeric compound of any of embodiments 1461-1544 or 1569, wherein the safety enhancing nucleoside comprises a 5′-modified furanosyl sugar moiety with a 5′ substituent selected from: 5′-methyl, 5′-ethyl or a 5′-allyl.

1571. The oligomeric compound of any of embodiments 1461-1544 or 1569-1570, wherein the safety enhancing nucleoside comprises a 5′-modified furanosyl sugar moiety with a 5′ substituent selected from: 5′-(R)-methyl- or 5′-(R)-ethyl.

1572. The oligomeric compound of any of embodiments 1461-1544 or 1569-1571, wherein the safety enhancing nucleoside comprises a 5′-(R)-methyl-2′-β-D-deoxyribosyl sugar moiety.

1573. The oligomeric compound of any of embodiments 1461-154 or 1569-1572, wherein the safety enhancing nucleoside comprises a 5′-(R)-ethyl-2′-β-D-deoxyribosyl sugar moiety.

1574. The oligomeric compound of any of embodiments 1461-1573, wherein the safety enhancing nucleoside does not comprise a 2′-F modified sugar moiety.

1575. The oligomeric compound of any of embodiments 1461-1574, wherein the safety enhancing nucleoside does not comprise a cEt modified sugar moiety.

1576. The oligomeric compound of any of embodiments 1461-1575, wherein the safety enhancing nucleoside does not comprise a 2′-MOE modified sugar moiety.

1577. The oligomeric compound of any of embodiments 1461-1576, wherein the safety enhancing nucleoside comprises a hypoxanthine nucleobase.

1578. The oligomeric compound of any of embodiments 1461-1577, wherein the safety enhancing nucleoside comprises a nucleobase selected from among thymine, uracil, guanine, cytosine, 5-methylcytosine, and adenine.

1579. The oligomeric compound of any of embodiments 1461-1578, wherein the safety enhancing nucleoside is a modified nucleoside other than cEt, MOE, LNA, or FANA.

1580. The oligomeric compound of any of embodiments 1461-1579, wherein each Nd is independently selected from among an unmodified 2′-β-D-deoxyribosyl sugar moiety, a DNA isomer, a 2′-modified DNA isomer, and a DNA mimic.

1581. The oligomeric compound of embodiment 1580, wherein each DNA isomer comprises a sugar moiety selected from among 2′-β-D-deoxyxylosyl, 2′-α-L-deoxyribosyl, 2′-β-L-deoxyribosyl, 2′-α-D-deoxyxylosyl, 2′-α-D-deoxyribosyl, 2′-α-L-deoxyxylosyl, and 2′-β-L-deoxyxylosyl.

1582. The oligomeric compound of embodiment 1581, wherein each DNA isomer comprises a sugar moiety selected from among 2′-β-D-deoxyxylosyl, 2′-α-L-deoxyribosyl, and 2′-β-L-deoxyribosyl.

1583. The oligomeric compound of embodiment 1580, wherein each modified DNA isomer comprises a 2′-modified sugar moiety, wherein the sugar moiety has the conformation 2′-β-D-deoxyxylosyl, 2′-α-L-deoxyribosyl, 2′-β-L-deoxyribosyl, 2′-α-D-deoxyxylosyl, 1, 2′-α-L-deoxyxylosyl, and 2′-β-L-deoxyxylosyl and the 2′ position is further substituted with a hydroxyl, a fluoro, or O—C 1 -C 10 alkoxy substituent.

1584. The oligomeric compound of embodiment 1583, wherein each modified DNA isomer comprises a 2′-modified sugar moiety, wherein the sugar moiety has the conformation 2′-β-D-deoxyxylosyl, 2′-α-L-deoxyribosyl, 2′-β-L-deoxyribosyl, 2′-α-D-deoxyxylosyl, 1, 2′-α-L-deoxyxylosyl, and 2′-β-L-deoxyxylosyl and the 2′ position is further substituted with a hydroxyl, a fluoro, or OMe substituent.

1585. The oligomeric compound of embodiment 1584, wherein each modified DNA isomer comprises a 2′-modified sugar moiety, wherein the sugar moiety has the conformation 2′-β-D-deoxyxylosyl, 2′-α-L-deoxyribosyl, 2′-β-L-deoxyribosyl, 2′-α-D-deoxyxylosyl, 1, 2′-α-L-deoxyxylosyl, and 2′-β-L-deoxyxylosyl and the 2′ position is further substituted with a fluoro or OMe substituent.

1586. The oligomeric compound of embodiment 1585, wherein each modified DNA isomer comprises a 2′-modified sugar moiety, wherein the sugar moiety is selected from among 2′-β-D-deoxyxylosyl, 2′-α-L-deoxyribosyl, and 2′-β-L-deoxyribosyl and the 2′ position is further substituted with a hydroxyl, fluoro, or OMe substituent.

1587. The oligomeric compound of embodiment 1580, wherein each DNA mimic comprises a structure represented by one of the formulas below:

wherein X is O or S and Bx represents a heterocylic base moiety.

1588. The oligomeric compound of embodiment 1580, wherein each DNA mimic comprises a structure represented by one of the formulas below:

wherein X is O or S;

Bx represents a heterocyclic base moiety; and

R 1 is selected from among H, OH, halo, allyl, amino, azido, SH, CN, OCN, CF 3 , OCF 3 , O—C 1 -C 10 alkoxy, O—C 1 -C 10 substituted alkoxy, C 1 -C 10 alkyl, C 1 -C 10 substituted alkyl, S-alkyl, N(R m )-alkyl, O-alkenyl, S-alkenyl, N(R m )-alkenyl, O-alkynyl, S-alkynyl, N(R m )-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH 2 ) 2 SCH 3 , O(CH 2 ) 2 ON(R m )(R n ) or OCH 2 C(═O)—N(R m )(R n ), where each R m and R n is, independently, H, an amino protecting group, or substituted or unsubstituted C 1 -C 10 alkyl;

wherein if the DNA mimic comprises the structure:

R 1 is other than H.

1589. The oligomeric compound of embodiment 1588, wherein R 1 is H, OH, OMe, or F.

1590. The oligomeric compound of embodiment 1588, wherein R 1 is not F.

1591. The oligomeric compound of embodiment 1580, wherein each DNA mimic comprises a structure represented by the formula below:

wherein X is S, Bx represents a heterocyclic base moiety, and R 1 is H.

1592. The oligomeric compound of embodiment 1580, wherein the DNA mimic has a sugar moiety selected from among: 5′-methyl-2′-β-D-deoxyribosyl, 5′-ethyl-2′-β-D-deoxyribosyl, and 5′-allyl-2′-β-D-deoxyribosyl.

1593. The oligomeric compound of embodiment 1580, wherein the DNA mimic comprises a 2′-fluoro-β-D-arabinofuranosyl sugar moiety.

1594. The oligomeric compound of embodiment 1580, wherein the DNA mimic does not comprise a 2′-fluoro-β-D-arabinofuranosyl sugar moiety.

1595. The oligomeric compound of any of embodiments 1461-1594, wherein each N d is an unmodified 2′-β-D-deoxyribosyl sugar moiety.

1596. The oligomeric compound of any of embodiments 1461-1595, wherein the central region comprises no more than four nucleosides selected from among DNA isomers, modified DNA isomers, and DNA mimics.

1597. The oligomeric compound of any of embodiments 1461-1595, wherein the central region comprises no more than three nucleosides selected from among DNA isomers, modified DNA isomers, and DNA mimics.

1598. The oligomeric compound of any of embodiments 1461-1595, wherein the central region comprises no more than two nucleosides selected from among DNA isomers, modified DNA isomers, and DNA mimics.

1599. The oligomeric compound of any of embodiments 1461-1595, wherein the central region comprises no more than one nucleoside selected from among DNA isomers, modified DNA isomers, and DNA mimics.

1600. The oligomeric compound of any of embodiments 1461-1599, wherein the central region contains exactly one safety enhancing nucleoside and the remainder of nucleosides in the central region are unmodified 2′-β-D-deoxyribosyl sugar moieties.

1601. The oligomeric compound of any of embodiments 1461-1600, wherein at least one internucleoside linkage of the central region selected from among: the internucleoside Nda to Nx, Nx to Ny, Ny to Nz, or Nz to the adjacent Ndb is a neutral internucleoside linkage.

1602. The oligomeric compound of embodiment 1601, wherein the neutral linkage is a phosphonate internucleoside linkage.

1603. The oligomeric compound of embodiment 1601, wherein the neutral linkage is a methoxypropyl internucleoside linkage.

1604. The oligomeric compound of embodiment 1601, wherein each remaining internucleoside linkage is a phosphodiester or phosphorothioate internucleoside linkage.

1605. The oligomeric compound of any of embodiments 1461-1600, wherein at least one internucleoside linkage of the central region is a 2′-5′ internucleoside linkage.

1606. The oligomeric compound of any of embodiments 1461-1600, wherein exactly one internucleoside linkage of the central region is a 2′-5′ internucleoside linkage.

1607. The oligomeric compound of any of embodiments 1461-1600, wherein at least one internucleoside linkage of the central region selected from among: the internucleoside Nda to Nx, Nx to Ny, Ny to Nz, or Nz to the adjacent Ndb is a 2′-5′ internucleoside linkage.

1608. A chirally enriched population of modified oligonucleotides of any of embodiments 1461-1607, wherein the central region has at least one particular phorphorothioate internucleoside linkage having a particular stereochemical configuration.

1609. The chirally enriched population of embodiment 1608, wherein the central region has at least one phorphorothioate internucleoside linkage having the (Sp) configuration.

1610. The chirally enriched population of embodiment 1608, wherein central region has at least one phorphorothioate internucleoside linkage having the (Rp) configuration.

1611. The chirally enriched population of embodiment 1608, wherein the central region has a particular, independently selected stereochemical configuration at each phosphorothioate internucleoside linkage.

1612. The chirally enriched population of embodiment 1608, wherein the each phosphorothioate internucleoside linkage of the central region has the (Sp) configuration.

1613. The chirally enriched population of embodiment 1608, wherein the central region has one phosphorothioate internucleoside linkage having the (Rp) configuration and wherein each remaining central region phosphorothioate internucleoside linkage has the (Sp) configuration.

1614. The chirally enriched population of embodiment 1608, wherein the central region has an (Rp) phosphorothioate internucleoside linkage adjacent to an (Sp) phosphorothioate internucleoside linkage.

1615. The chirally enriched population of embodiment 1608, wherein the central region has an (Rp) phosphorothioate internucleoside linkage adjacent to a second (Rp) phosphorothioate internucleoside linkage.

1616. The chirally enriched population of embodiment 1608, wherein the central region has an (Rp) phosphorothioate internucleoside linkage adjacent to a second (Rp) phosphorothioate internucleoside linkage, and wherein each remaining central region phosphorothioate internucleoside linkage has the (Sp) configuration.

1617. The chirally enriched population of any of embodiments 1609, 1610, 1614, or 1615 wherein each phosphorothioate internucleoside linkage that does not have the (Rp) or (Sp) configuration is stereorandom.

1618. The oligomeric compound of any of embodiments 1461-1617 comprising a conjugate group.

1619. The oligomeric compound of embodiment 1618, wherein the conjugate group comprises a linking group attaching the remainder of the conjugate group to the modified oligonucleotide, wherein the linking group comprises 1-5 nucleosides.

1620. The oligomeric compound of any of embodiments 1461-1618, wherein the oligomeric compound does not comprise additional nucleosides beyond those of the modified oligonucleotide.

1621. The oligomeric compound of any of embodiments 1461-1620, wherein the nucleobase sequence of the modified oligonucleotide is complementary to a target RNA.

1622. The oligomeric compound of embodiment 1621, wherein the nucleobase sequence of the modified oligonucleotide is at least 85% complementary to the target RNA.

1623. The oligomeric compound of embodiment 1621, wherein the nucleobase sequence of the modified oligonucleotide is at least 90% complementary to the target RNA.

1624. The oligomeric compound of embodiment 1621, wherein the nucleobase sequence of the modified oligonucleotide is at least 95% complementary to the target RNA.

1625. The oligomeric compound of embodiment 1621, wherein the nucleobase sequence of the modified oligonucleotide is 100% complementary to the target RNA.

1626. The oligomeric compound of any of embodiments 1621-1625, wherein the target RNA is a target mRNA or a target pre-mRNA.

1627. The oligomeric compound of embodiment 1626, wherein the target mRNA or target pre-mRNA is not a mouse, rat, monkey, or human PTEN RNA.

1628. The oligomeric compound of embodiment 1626 or 1627, wherein the target mRNA or target pre-mRNA is not a mouse, rat, monkey, or human SRB-1 RNA.

1629. The oligomeric compound of any of embodiments 1626-1628, wherein the target mRNA or target pre-mRNA is not a mouse, rat, monkey, or human MYD88 RNA.

1630. The oligomeric compound of any of embodiments 1626-1629, wherein the target mRNA or target pre-mRNA is not a mouse, rat, monkey, or human HTT RNA, is not a mouse, rat, monkey, or human SOD1 RNA, and is not a mouse, rat, monkey, or human alpha-synuclein RNA.

1631. The oligomeric compound of any of embodiments 1621-1630, wherein the target RNA is a human RNA.

1632. The oligomeric compound of any of embodiments 1621-1631, wherein the target RNA is expressed in the liver.

1633. The oligomeric compound of any of embodiments 1621-1632, wherein the target RNA is a liver target.

1634. The oligomeric compound of any of embodiments 1621-1631, wherein the target RNA is not expressed in the liver.

1635. The oligomeric compound of any of embodiments 1621-1631 or 1634, wherein the target RNA is not a liver target.

1636. The oligomeric compound of any of embodiments 1621-1635, wherein modulation of the expression of the target RNA in the liver is associated with treating a disorder or condition.

1637. The oligomeric compound of embodiment 1636, wherein the disorder or condition is a liver disorder or condition.

1638. The oligomeric compound of any of embodiments 1621-1637, wherein the target RNA is expressed in the central nervous system.

1639. The oligomeric compound of any of embodiments 1621-1637, wherein the target RNA is not expressed in the central nervous system.

1640. The oligomeric compound of any of embodiments 1621-1638, wherein the target RNA is a central nervous system target.

1641. The oligomeric compound of any of embodiments 1621-1639, wherein the target RNA is not a central nervous system target.

1642. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is expressed in white fat cells.

1643. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is expressed in brown fat cells.

1644. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is expressed in adipocytes.

1645. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is expressed in macrophages.

1646. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is expressed in cancer cells.

1647. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is expressed in tumor cells.

1648. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is expressed in smooth muscle cells.

1649. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is expressed in lymphocytes.

1650. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is expressed in pulmonary cells.

1651. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is expressed in heart muscle cells.

1652. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is expressed in cardiomyocytes.

1653. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is expressed in endothelial cells.

1654. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is expressed in fibroblasts.

1655. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is expressed in glial cells.

1656. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is expressed in Schwann cells.

1657. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is expressed in pancreatic cells.

1658. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is expressed in kidney cells.

1659. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is expressed in beta cells.

1660. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is expressed in non-parenchymal cells.

1661. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is expressed in hepatocytes.

1662. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is expressed in oligodendrocytes.

1663. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is expressed in astrocytes.

1664. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is expressed in microglia.

1665. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is expressed in ependymal cells.

1666. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is expressed in sensory neurons.

1667. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is expressed in motor neurons.

1668. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is expressed in skeletal muscle.

1669. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is expressed in cardiac muscle.

1670. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is expressed in smooth muscle.

1671. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is expressed in adipose tissue.

1672. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is expressed in white adipose tissue.

1673. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is expressed in the spleen.

1674. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is expressed in the bone.

1675. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is expressed in the bone marrow.

1676. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is expressed in the intestine.

1677. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is expressed in the adrenal glands.

1678. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is expressed in the testes.

1679. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is expressed in the ovaries.

1680. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is expressed in the pancreas.

1681. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is expressed in the pituitary gland.

1682. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is expressed in the prostate gland.

1683. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is expressed in the skin.

1684. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is expressed in the epidermis.

1685. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is expressed in the uterus.

1686. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is expressed in the bladder.

1687. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is expressed in the brain.

1688. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is expressed in the glomerulus.

1689. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is expressed in the distal tubular epithelium.

1690. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is expressed in breast tissue.

1691. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is expressed in the lung.

1692. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is expressed in the heart.

1693. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is expressed in the kidney.

1694. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is expressed in the ganglion.

1695. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is expressed in the frontal cortex.

1696. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is expressed in the spinal cord.

1697. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is expressed in the trigeminal ganglion.

1698. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is expressed in the sciatic nerve.

1699. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is expressed in the dorsal root ganglion.

1700. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is expressed in the epidymal fat.

1701. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is expressed in the diaphragm.

1702. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is expressed in the colon.

1703. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is a white fat cell target.

1704. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is a brown fat cell target.

1705. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is an adipocyte target.

1706. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is a macrophage target.

1707. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is a cancer cell target.

1708. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is a tumor cell target.

1709. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is a smooth muscle cell target.

1710. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is a lymphocyte target.

1711. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is a pulmonary cell target.

1712. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is a heart muscle cell target.

1713. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is a cardiomyocyte target.

1714. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is a endothelial cell target.

1715. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is a fibroblast target.

1716. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is a glial cell target.

1717. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is a Schwann cell target.

1718. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is a pancreatic cell target.

1719. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is a kidney cell target.

1720. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is a beta cell target.

1721. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is a non-parenchymal cell target.

1722. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is a hepatocyte target.

1723. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA a oligodendrocyte target.

1724. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is a astrocyte target.

1725. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is a microglia target.

1726. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is a ependymal cell target.

1727. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is a sensory neuron target.

1728. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is a motor neuron target.

1729. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is a skeletal muscle target.

1730. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is a cardiac muscle target.

1731. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is a smooth muscle target.

1732. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is a adipose tissue target.

1733. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is a white adipose tissue target.

1734. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is a spleen target.

1735. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is a bone target.

1736. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is a bone marrow target.

1737. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is an intestinal target.

1738. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is an adrenal gland target.

1739. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is a testicular target.

1740. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is an ovarian target.

1741. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is a pancreatic target.

1742. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is a pituitary gland target.

1743. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is a prostate gland target.

1744. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is a skin target.

1745. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is an epidermal target.

1746. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is a uterine target.

1747. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is a bladder target.

1748. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is a brain target.

1749. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is a glomerulus target.

1750. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is a distal tubular epithelium target.

1751. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is a breast tissue target.

1752. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is a lung target.

1753. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is a heart target.

1754. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is a kidney target.

1755. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is a ganglion target.

1756. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is a frontal cortex target.

1757. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is a spinal cord target.

1758. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is a trigeminal ganglion target.

1759. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is a sciatic nerve target.

1760. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is a dorsal root ganglion target.

1761. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is a epidymal fat target.

1762. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is a diaphragm target.

1763. The oligomeric compound of any of embodiments 1621-1641, wherein the target RNA is a colon target.

1764. The oligomeric compound of any of embodiments 1621-1763, wherein the target RNA is a MeCP2, DUX4, HDAC2, APP, Ataxin 1, Ataxin 2, Ataxin 3, Ataxin 6, Ataxin 7, C9ORF72, UBE3A, Prion, PMP22, Tau, LRRK2, LINGO2, GYS1, KCNT1, IRF8, Progranulin, or GFAP RNA.

1765. The oligomeric compound of any of embodiments 1621-1763, wherein the target RNA is a HTT RNA.

1766. The oligomeric compound of embodiment 1764, wherein the target RNA is a MeCP2 RNA.

1767. The oligomeric compound of embodiment 1764, wherein the target RNA is a DUX4 RNA.

1768. The oligomeric compound of embodiment 1764, wherein the target RNA is a HDAC2 RNA.

1769. The oligomeric compound of embodiment 1764, wherein the target RNA is a Ataxin 1 RNA.

1770. The oligomeric compound of embodiment 1764, wherein the target RNA is a Ataxin 2 RNA.

1771. The oligomeric compound of embodiment 1764, wherein the target RNA is a Ataxin 3 RNA.

1772. The oligomeric compound of embodiment 1764, wherein the target RNA is a Ataxin 6 RNA.

1773. The oligomeric compound of embodiment 1764, wherein the target RNA is a Ataxin 7 RNA.

1774. The oligomeric compound of embodiment 1764, wherein the target RNA is a C9ORF72 RNA.

1775. The oligomeric compound of embodiment 1621-1763, wherein the target RNA is an alpha-synuclein RNA.

1776. The oligomeric compound of embodiment 1764, wherein the target RNA is an UBE3A RNA.

1777. The oligomeric compound of any of embodiments 1621-1763, wherein the target RNA is a SOD1 RNA.

1778. The oligomeric compound of embodiment 1764, wherein the target RNA is a Prion RNA.

1779. The oligomeric compound of embodiment 1764, wherein the target RNA is a PMP22 RNA.

1780. The oligomeric compound of any of embodiments 1621-1764, wherein the target RNA is a Tau RNA.

1781. The oligomeric compound of embodiment 1764, wherein the target RNA is a LRRK2 RNA.

1782. The oligomeric compound of embodiment 1764, wherein the target RNA is an APP RNA.

1783. The oligomeric compound of 1764, wherein the target RNA is a LINGO2 RNA.

1784. The oligomeric compound of any of embodiments 1764, wherein the target RNA is a GYS1 RNA.

1785. The oligomeric compound of any of embodiments 1764, wherein the target RNA is a KCNT1 RNA.

1786. The oligomeric compound of any of embodiments 1764, wherein the target RNA is a IRF8 RNA.

1787. The oligomeric compound of any of embodiments 1764, wherein the target RNA is a Progranulin RNA.

1788. The oligomeric compound of any of embodiments 1764, wherein the target RNA is a GFAP RNA.

1789. The oligomeric compound of any of embodiments 1621-1788, wherein modulation of the expression of the target RNA is associated with treating a disorder or condition.

1790. The oligomeric compound of embodiment 1789, wherein the disorder or condition is Alzheimer's Disease, Amyotrophic Lateral Sclerosis, Parkinson's Disease, a Spinocerebellar ataxia, Angelman Syndrome, Alexander's Disease, Lafora Disease, Charcot-Marie Tooth Disease, Prion Disease, a dementia, neurodegeneration, MeCP2 Duplication Syndrome, encephalopathy, neuroinflammation, or multiple sclerosis.

1791. The oligomeric compound of embodiment 1790, wherein the disorder or condition is Alzheimer's Disease.

1792. The oligomeric compound of embodiment 1790, wherein the disorder or condition is Amyotrophic Lateral Sclerosis.

1793. The oligomeric compound of embodiment 1790, wherein the disorder or condition is Parkinson's Disease.

1794. The oligomeric compound of embodiment 1790 wherein the disorder or condition is a Spinocerebellar ataxia.

1795. The oligomeric compound of embodiment 1790 wherein the disorder or condition is Angelman Syndrome.

1796. The oligomeric compound of embodiment 1790, wherein the disorder or condition is Alexander's Disease.

1797. The oligomeric compound of embodiment 1790, wherein the disorder or condition is Lafora Disease.

1798. The oligomeric compound of embodiment 1790, wherein the disorder or condition is Charcot-Marie Tooth Disease.

1799. The oligomeric compound of embodiment 1790, wherein the disorder or condition is Prion Disease.

1800. The oligomeric compound of embodiment 1790, wherein the disorder or condition is a dementia.

1801. The oligomeric compound of embodiment 1790, wherein the disorder or condition is neurodegeneration.

1802. The oligomeric compound of embodiment 1790, wherein the disorder or condition is MeCP2 Duplication Syndrome.

1803. The oligomeric compound of embodiment 1790, wherein the disorder or condition is encephalopathy.

1804. The oligomeric compound of embodiment 1790, wherein the disorder or condition is neuroinflammation.

1805. The oligomeric compound of embodiment 1790, wherein the disorder or condition is multiple sclerosis.

1806. The oligomeric compound of any of embodiments 1461-1805, wherein the parent oligomeric compound of the oligomeric compound of any of embodiments 1461-1805 is cytotoxic in vitro.

1807. The oligomeric compound of embodiment 1806, wherein the parent oligomeric compound is cytotoxic in a standard in vitro cytotoxicity assay.

1808. The oligomeric compound of any of embodiments 1461-1805 wherein administration to a mouse of the parent oligomeric compound of the oligomeric compound of any of embodiments 1461-1805 is hepatotoxic to the mouse.

1809. The oligomeric compound of embodiment 1808, wherein the administration of the parent oligomeric compound to the mouse is systemic administration.

1810. The oligomeric compound of embodiment 1809, wherein the systemic administration is subcutaneous administration.

1811. The oligomeric compound of any of embodiments 1808-1810, wherein the mouse is a CD-1 mouse.

1812. The oligomeric compound of any of embodiments 1808-1810, wherein the mouse is a C 57 BL/6 mouse.

1813. The oligomeric compound of any of embodiments 1808-1810, wherein the mouse is a BALB/c mouse.

1814. The oligomeric compound of any of embodiments 1807-1813, wherein the plasma ALT level in the mouse is higher than 500 units per liter following the administration of the parent oligomeric compound.

1815. The oligomeric compound of any of embodiments 1807-1814, wherein the plasma AST level in the mouse is higher than 500 units per liter following the administration of the parent oligomeric compound.

1816. The oligomeric compound of any of embodiments 1807-1815, wherein the plasma ALT level in the mouse is higher than 1000 units per liter following the administration of the parent oligomeric compound.

1817. The oligomeric compound of any of embodiments 1807-1816, wherein the plasma AST level in the mouse is higher than 1000 units per liter following the administration of the parent oligomeric compound.

1818. The oligomeric compound of any of embodiments 1807-1817, wherein the hepatotoxicity is measured 24-48 hours following the administration of the parent oligomeric compound.

1819. The oligomeric compound of any of embodiments 1807-1817, wherein the hepatotoxicity is measured 72 hours following the administration of the parent oligomeric compound.

1820. The oligomeric compound of any of embodiments 1807-1817, wherein the hepatotoxicity is measured 3 days following the administration of the parent oligomeric compound.

1821. The oligomeric compound of any of embodiments 1807-1817, wherein the hepatotoxicity is measured 5 days following the administration of the parent oligomeric compound.

1822. The oligomeric compound of any of embodiments 1807-1817, wherein the hepatotoxicity is measured 7 days following the administration of the parent oligomeric compound.

1823. The oligomeric compound of any of embodiments 1807-1817, wherein the hepatotoxicity is measured 10 days following the administration of the parent oligomeric compound.

1824. The oligomeric compound of any of embodiments 1807-1817, wherein the hepatotoxicity is measured 14 days following the administration of the parent oligomeric compound.

1825. The oligomeric compound of any of embodiments 1807-1817, wherein 1-10 mg/kg of the parent oligomeric compound is administered to the mouse.

1826. The oligomeric compound of any of embodiments 1807-1817, wherein 10-25 mg/kg of the parent oligomeric compound is administered to the mouse.

1827. The oligomeric compound of any of embodiments 1807-1817, wherein 25-50 mg/kg of the parent oligomeric compound is administered to the mouse.

1828. The oligomeric compound of any of embodiments 1807-1817, wherein 50-100 mg/kg of the parent oligomeric compound is administered to the mouse.

1829. The oligomeric compound of any of embodiments 1807-1817, wherein 100-150 mg/kg of the parent oligomeric compound is administered to the mouse.

1830. The oligomeric compound of any of embodiments 1807-1817, wherein the mouse is a BALB/c mouse, wherein 150 mg/kg of the parent oligomeric compound is administered to the mouse, and wherein the plasma ALT level in the mouse is measured 72 hours following the administration of the parent oligomeric compound.

1831. The oligomeric compound of any of embodiments 1461-1830, wherein administration of 50 mg/kg of the oligomeric compound of any of embodiments 1461-1830 to a mouse is not hepatotoxic to the mouse.

1832. The oligomeric compound of embodiment 1831, wherein plasma ALT level in the mouse is lower than 100 units per liter following the administration of the oligomeric compound of embodiment 1831.

1833. The oligomeric compound of embodiment 1831 or 1832, wherein plasma ALT level in the mouse is at least 10-fold lower than plasma ALT level in a mouse administered the parent oligomeric compound of the oligomeric compound of embodiment 1831 or 1832, wherein the administrations and plasma ALT measurements of both the oligomeric compound of embodiment 1831 or 1832 and the parent oligomeric compound are completed in the same way.

1834. The oligomeric compound of embodiment 1833, wherein the plasma ALT level in the mouse is at least 100-fold lower than the plasma ALT level in the mouse administered the parent oligomeric compound.

1835. The oligomeric compound of embodiment 1833, wherein the plasma ALT level in the mouse is at least 500-fold lower than the plasma ALT level in the mouse administered the parent oligomeric compound.

1836. The oligomeric compound of any of embodiments 1807-1835, wherein the therapeutic index in a mouse of the oligomeric compound of any of embodiments 1807-1835 is increased relative to the therapeutic index of the parent oligomeric compound.

1837. The oligomeric compound of embodiment 1836, wherein the therapeutic index in a mouse of the oligomeric compound of embodiment 1836 is at least two-fold greater than the therapeutic index of the parent oligomeric compound.

1838. The oligomeric compound of any of embodiments 1461-1805, wherein an otherwise identical oligomeric compound lacking the at least one modified internucleoside linkage other than phosphorothioate and/or at least one modified nucleoside comprising a modified nucleobase other than 5-methylcytosine and/or a modified sugar moiety in the central region is hepatotoxic following administration to a mouse;

and wherein the otherwise identical oligomeric compound has a central region consisting of phosphorothioate internucleoside linkages, unmodified 2′β-D-deoxyribosyl sugar moieties, and nucleobases selected from thymine, uracil, adenine, guanine, cytosine, and 5-methylcytosine.

1839. The oligomeric compound of embodiment 1838, wherein the at least one modified internucleoside linkage other than phosphorothioate and/or at least one modified nucleoside comprising a modified nucleobase other than 5-methylcytosine and/or a modified sugar moiety in the central region is a 2′-O-methyl modified sugar moiety.

1840. The oligomeric compound of embodiment 1839, wherein the 2′-O-methyl modified sugar moiety is at position 2 of the central region.

1841. The oligomeric compound of embodiment 1838-1840, wherein the otherwise identical oligomeric compound lacks a 2′-O-methyl modified sugar moiety, and wherein the otherwise identical oligomeric compound comprises an unmodified 2′β-D-deoxyribosyl sugar moiety in place of the 2′-O-methyl modified sugar moiety.

1842. The oligomeric compound of any of embodiments 1838-1841, wherein the nucleobase sequence of the otherwise identical oligomeric compound is 100% complementary to the target RNA.

1843. The oligomeric compound of any of embodiments 1838-1842, wherein the otherwise identical oligomeric compound is a parent oligomeric compound of the oligomeric compound of any of embodiments 1838-1842.

1844. The oligomeric compound of any of embodiments 1621-1843, wherein the oligomeric compound inhibits the target RNA with an IC 50 lower than 100 nM in a standard in vitro activity assay.

1845. The oligomeric compound of any of embodiments 1621-1843, wherein the parent oligomeric compound of the oligomeric compound of any of embodiments 1621-1843 inhibits the target RNA with an IC 50 lower than 100 nM in a standard in vitro activity assay.

1846. The oligomeric compound of any of embodiments 1621-1845, wherein the difference between the IC 50 of the parent oligomeric compound measured in a standard in vitro activity assay and the IC 50 of the oligomeric compound of any of embodiments 1621-1845 measured in a standard in vitro activity assay is less than 4-fold.

1847. The oligomeric compound of any of embodiments 1621-1845, wherein the difference between the IC 50 of the parent oligomeric compound measured in a standard in vitro activity assay and the IC 50 of the oligomeric compound of any of embodiments 1621-1845 measured in a standard in vitro activity assay is less than 3-fold.

1848. The oligomeric compound of any of embodiments 1621-1845, wherein the difference between the IC 50 of the parent oligomeric compound measured in a standard in vitro activity assay and the IC 50 of the oligomeric compound of any of embodiments 1621-1845 measured in a standard in vitro activity assay is less than 2-fold.

1849. The oligomeric compound of any of embodiments 1621-1848, wherein each sugar moiety of the central region of the parent oligomeric compound is an unmodified 2′-β-D-deoxyribosyl sugar moiety, and wherein each internucleoside linkage of the central region of the parent oligomeric compound is a phosphorothioate internucleoside linkage.

1850. The oligomeric compound of any of embodiments 1621-1849, wherein the nucleobase sequence of the parent oligomeric compound is 100% complementary to the target RNA.

1851. The oligomeric compound of any of embodiments 1461-1850, wherein administration of 10-50 mg of the oligomeric compound to a human is not hepatotoxic to the human.

1852. The oligomeric compound of any of embodiments 1461-1850, wherein administration of 50-100 mg of the oligomeric compound to a human is not hepatotoxic to the human.

1853. The oligomeric compound of any of embodiments 1461-1850, wherein administration of 100-300 mg of the oligomeric compound to a human is not hepatotoxic to the human.

1854. The oligomeric compound of any of embodiments 1851-1853, wherein the administration is systemic administration.

1855. A composition comprising the oligomeric compound of any of embodiments 1461-1854, and a second oligomeric compound, wherein the second oligomeric compound is complementary to the oligomeric compound of any of embodiments 1461-1854.

1856. The composition of embodiment 1855, wherein the second oligomeric compound comprises at least 14 contiguous linked nucleosides that are at least 90% complementary to the oligomeric compound of any of embodiments 1851-1853.

1857. The composition of embodiment 1855, wherein the second oligomeric compound comprises at least 14 contiguous linked nucleosides that are 100% complementary to the oligomeric compound of any of embodiments 1461-1854.

1858. A pharmaceutical composition comprising the oligomeric compound of any of embodiments 1461-1854 or the composition of any of embodiments 1855-1857, comprising a pharmaceutically acceptable carrier or diluent.

1859. A method comprising administering the oligomeric compound or composition of any of embodiments 1461-1858 to a human subject.

1860. A method of treating a disease or disorder comprising administering the oligomeric compound or composition of any of embodiments 1461-1858 to a human subject.

1861. A method of modulating the amount or activity of a target RNA in a human subject comprising administering the oligomeric compound or composition of any of embodiments 1461-1858 to the human subject; and thereby modulating the amount or activity of the target RNA in the human subject.

1862. A method of treating a disease or disorder in a human subject comprising administering the oligomeric compound or composition of any of embodiments 1461-1858 to the human subject having the disease or disorder; and thereby treating the disease or disorder in the human subject.

1863. The method of embodiment 1861 or 1862, wherein the disease or disorder is a liver disease, and wherein the oligomeric compound modulates the amount or activity of a liver target RNA.

1864. The method of embodiment 1861 or 1862, wherein the disease or disorder is a central nervous system disease, and wherein the oligomeric compound modulates the amount or activity of a central nervous system target RNA.

1865. The method of any of embodiments 1861-1864, wherein the disease or disorder is a cancer, a neurodegenerative disease, a cardiovascular disease, an immunological disease, a hereditary disease, a repeat expansion disease, a muscle-wasting disease, or a metabolic disease.

1866. The method of embodiment 1861 or 1862, wherein the oligomeric compound modulates the amount or activity of a white fat cell target.

1867. The method of embodiment 1861 or 1862, wherein the oligomeric compound modulates the amount or activity of a brown fat cell target.

1868. The method of embodiment 1861 or 1862, wherein the oligomeric compound modulates the amount or activity of an adipocyte target.

1869. The method of embodiment 1861 or 1862, wherein the oligomeric compound modulates the amount or activity of a macrophage target.

1870. The method of embodiment 1861 or 1862, wherein the oligomeric compound modulates the amount or activity of a cancer cell target.

1871. The method of embodiment 1861 or 1862, wherein the oligomeric compound modulates the amount or activity of a tumor cell target.

1872. The method of embodiment 1861 or 1862, wherein the oligomeric compound modulates the amount or activity of a smooth muscle cell target.

1873. The method of embodiment 1861 or 1862, wherein the oligomeric compound modulates the amount or activity of a lymphocyte target.

1874. The method of embodiment 1861 or 1862, wherein the oligomeric compound modulates the amount or activity of a pulmonary cell target.

1875. The method of embodiment 1861 or 1862, wherein the oligomeric compound modulates the amount or activity of a heart muscle cell target.

1876. The method of embodiment 1861 or 1862, wherein the oligomeric compound modulates the amount or activity of a cardiomyocyte target.

1877. The method of embodiment 1861 or 1862, wherein the oligomeric compound modulates the amount or activity of a endothelial cell target.

1878. The method of embodiment 1861 or 1862, wherein the oligomeric compound modulates the amount or activity of a fibroblast target.

1879. The method of embodiment 1861 or 1862, wherein the oligomeric compound modulates the amount or activity of a glial cell target.

1880. The method of embodiment 1861 or 1862, wherein the oligomeric compound modulates the amount or activity of a Schwann cell target.

1881. The method of embodiment 1861 or 1862, wherein the oligomeric compound modulates the amount or activity of a pancreatic cell target.

1882. The method of embodiment 1861 or 1862, wherein the oligomeric compound modulates the amount or activity of a kidney cell target.

1883. The method of embodiment 1861 or 1862, wherein the oligomeric compound modulates the amount or activity of a beta cell target.

1884. The method of embodiment 1861 or 1862, wherein the oligomeric compound modulates the amount or activity of a non-parenchymal cell target.

1885. The method of embodiment 1861 or 1862, wherein the oligomeric compound modulates the amount or activity of a hepatocyte target.

1886. The method of embodiment 1861 or 1862, wherein the oligomeric compound modulates the amount or activity of a oligodendrocyte target.

1887. The method of embodiment 1861 or 1862, wherein the oligomeric compound modulates the amount or activity of a astrocyte target.

1888. The method of embodiment 1861 or 1862, wherein the oligomeric compound modulates the amount or activity of a microglia target.

1889. The method of embodiment 1861 or 1862, wherein the oligomeric compound modulates the amount or activity of a ependymal cell target.

1890. The method of embodiment 1861 or 1862, wherein the oligomeric compound modulates the amount or activity of a sensory neuron target.

1891. The method of embodiment 1861 or 1862, wherein the oligomeric compound modulates the amount or activity of a motor neuron target.

1892. The method of embodiment 1861 or 1862, wherein the oligomeric compound modulates the amount or activity of a skeletal muscle target.

1893. The method of embodiment 1861 or 1862, wherein the oligomeric compound modulates the amount or activity of a cardiac muscle target.

1894. The method of embodiment 1861 or 1862, wherein the oligomeric compound modulates the amount or activity of a smooth muscle target.

1895. The method of embodiment 1861 or 1862, wherein the oligomeric compound modulates the amount or activity of a adipose tissue target.

1896. The method of embodiment 1861 or 1862, wherein the oligomeric compound modulates the amount or activity of a white adipose tissue target.

1897. The method of embodiment 1861 or 1862, wherein the oligomeric compound modulates the amount or activity of a spleen target.

1898. The method of embodiment 1861 or 1862, wherein the oligomeric compound modulates the amount or activity of a bone target.

1899. The method of embodiment 1861 or 1862, wherein the oligomeric compound modulates the amount or activity of a bone marrow target.

1900. The method of embodiment 1861 or 1862, wherein the oligomeric compound modulates the amount or activity of an intestinal target.

1901. The method of embodiment 1861 or 1862, wherein the oligomeric compound modulates the amount or activity of an adrenal gland target.

1902. The method of embodiment 1861 or 1862, wherein the oligomeric compound modulates the amount or activity of a testicular target.

1903. The method of embodiment 1861 or 1862, wherein the oligomeric compound modulates the amount or activity of an ovarian target.

1904. The method of embodiment 1861 or 1862, wherein the oligomeric compound modulates the amount or activity of a pancreatic target.

1905. The method of embodiment 1861 or 1862, wherein the oligomeric compound modulates the amount or activity of a pituitary gland target.

1906. The method of embodiment 1861 or 1862, wherein the oligomeric compound modulates the amount or activity of a prostate gland target.

1907. The method of embodiment 1861 or 1862, wherein the oligomeric compound modulates the amount or activity of a skin target.

1908. The method of embodiment 1861 or 1862, wherein the oligomeric compound modulates the amount or activity of an epidermal target.

1909. The method of embodiment 1861 or 1862, wherein the oligomeric compound modulates the amount or activity of a uterine target.

1910. The method of embodiment 1861 or 1862, wherein the oligomeric compound modulates the amount or activity of a bladder target.

1911. The method of embodiment 1861 or 1862, wherein the oligomeric compound modulates the amount or activity of a brain target.

1912. The method of embodiment 1861 or 1862, wherein the oligomeric compound modulates the amount or activity of a glomerulus target.

1913. The method of embodiment 1861 or 1862, wherein the oligomeric compound modulates the amount or activity of a distal tubular epithelium target.

1914. The method of embodiment 1861 or 1862, wherein the oligomeric compound modulates the amount or activity of a breast tissue target.

1915. The method of embodiment 1861 or 1862, wherein the oligomeric compound modulates the amount or activity of a lung target.

1916. The method of embodiment 1861 or 1862, wherein the oligomeric compound modulates the amount or activity of a heart target.

1917. The method of embodiment 1861 or 1862, wherein the oligomeric compound modulates the amount or activity of a kidney target.

1918. The method of embodiment 1861 or 1862, wherein the oligomeric compound modulates the amount or activity of a ganglion target.

1919. The method of embodiment 1861 or 1862, wherein the oligomeric compound modulates the amount or activity of a frontal cortex target.

1920. The method of embodiment 1861 or 1862, wherein the oligomeric compound modulates the amount or activity of a spinal cord target.

1921. The method of embodiment 1861 or 1862, wherein the oligomeric compound modulates the amount or activity of a trigeminal ganglion target.

1922. The method of embodiment 1861 or 1862, wherein the oligomeric compound modulates the amount or activity of a sciatic nerve target.

1923. The method of embodiment 1861 or 1862, wherein the oligomeric compound modulates the amount or activity of a dorsal root ganglion target.

1924. The method of embodiment 1861 or 1862, wherein the oligomeric compound modulates the amount or activity of a epidymal fat target.

1925. The method of embodiment 1861 or 1862, wherein the oligomeric compound modulates the amount or activity of a diaphragm target.

1926. The method of embodiment 1861 or 1862, wherein the oligomeric compound modulates the amount or activity of a colon target.

1927. The method of any of embodiments 1802-1926, wherein the plasma ALT level of the human subject after the administration is not more than three times higher than it was prior to the administration.

1928. The method of any of embodiments 1802-1926, wherein the plasma ALT level of the human subject after the administration is not more than 150 units per liter.

1929. The method of any of embodiments 1802-1928, wherein the human subject is susceptible to liver damage.

1930. The method of any of embodiments 1802-1928, wherein the human subject is susceptible to liver degeneration.

1931. The method of any of embodiments 1802-1930, wherein the human subject is susceptible to elevated apoptosis in the liver.

1932. The method of any of embodiments 1802-1931, wherein the human subject has a liver disease.

1933. The method of any of embodiments 1802-1932, wherein the human subject has kidney disease.

1934. The method of any of embodiments 1802-1933, wherein the human subject is susceptible to kidney damage.

1935. The method of any of embodiments 1802-1934, wherein the human subject has heart disease.

1936. The method of any of embodiments 1802-1935, wherein the human subject is susceptible to heart damage.

1937. The method of any of embodiments 1802-1936, wherein the human subject has pancreatitis.

1938. The method of any of embodiments 1802-1937, wherein the human subject is susceptible to pancreatic damage.

1939. The method of any of embodiments 1802-1938, wherein the human subject has a neurological disease.

1940. The method of any of embodiments 1802-1939, wherein the human subject is susceptible to neurological damage.

1941. The method of any of embodiments 1859-1940, comprising administering the parent oligomeric compound of the oligomeric compound of any of embodiments 1461-1858 to a mouse.

1942. The method of any of embodiments 1859-1940, comprising contacting a cell with the parent oligomeric compound of the oligomeric compound of any of embodiments 1461-1858.

1943. The method of embodiment 1941 or 1942, wherein each sugar moiety of the central region of the parent oligomeric compound is an unmodified 2′β-D-deoxyribosyl sugar moiety, and wherein each internucleoside linkage of the central region of the parent oligomeric compound is a phosphorothioate internucleoside linkage.

1944. A method of designing an oligomeric compound comprising starting with a parent oligomeric compound and changing the design of that compound in order to arrive at an oligomeric compound of any one of embodiments 1461-1858.

1945. A method of designing an oligomeric compound comprising identifying a parent oligomeric compound and changing the design of that parent oligomeric compound to arrive at a second oligomeric compound, wherein the second oligomeric compound is an oligomeric compound of any one of embodiments 1461-1858.

1946. A method of improving hepatotoxicity of an oligomeric compound comprising the steps of (i) identifying a parent oligomeric compound that has plasma ALT levels above 300 units per liter in a mouse, and (ii) providing an oligomeric compound according to any one of embodiments 1461-1858.

1947. The method of embodiment 1945 or 1946, wherein the method designs an oligomeric compound with improved therapeutic index relative to the parent oligomeric compound.

1948. The method of embodiment 1945 or 1946, wherein the method designs an oligomeric compound with lower hepatotoxicity relative to the parent oligomeric compound.

1949. The method of embodiment 1945, wherein the second oligomeric compound has an improved therapeutic index relative to the parent oligomeric compound.

1950. The method of embodiment 1945 or 1946, wherein the second oligomeric compound has reduced hepatotoxicity in a mouse relative to the parent oligomeric compound.

1951. The method of embodiment 1945, wherein the oligomeric compound according to any one of embodiments 1461-1858 has reduced hepatotoxicity relative to the parent oligomeric compound.

1952. A method comprising administering an oligomeric compound of any of embodiments 1461-1858 to a mouse and separately administering the parent oligomeric compound of the oligomeric compound of any of embodiments 1461-1858 to a second mouse, wherein the therapeutic index of the oligomeric compound of any of embodiments 1461-1858 is improved relative to the therapeutic index of the parent oligomeric compound.

1953. The method of any of embodiments 1859-1952, wherein the level of p21 RNA is measured in the mouse, the cell, and/or the human subject.

1954. A method comprising administering an oligomeric compound of any of embodiments 1461-1858 to a subject and measuring the level of p21 RNA in the subject.

1955. The method of embodiment 1954, wherein the subject is a mouse.

1956. The method of embodiment 1954, wherein the subject is a human.

1957. The method of any of embodiments 1954-1956, wherein the p21 RNA level is measured within 24 hours of the administration.

1958. The method of any of embodiments 1954-1956, wherein the p21 RNA level is measured 24-48 hours following the administration.

1959. An oligomeric compound or composition of any one of embodiments 1461-1858, for use in medical therapy.

1960. The oligomeric compound of any of embodiments 1461-1858, wherein the oligomeric compound is not toxic.

1961. The oligomeric compound of any of embodiment 1461-1858, wherein a comparator compound is toxic; wherein the comparator compound is identical to the oligomeric compound except that each nucleoside of the central region of the comparator compound is a nucleoside comprising 2′-β-D-deoxyribosyl sugar moiety.

1962. The oligomeric compound of embodiment 1961, wherein administering a dose of the oligomeric compound to an animal results in a circulating ALT level that is at least 3-fold lower than the ALT level that results from administering the same dose of the comparator compound to an animal for at least one matched dose.

1963. The oligomeric compound of embodiment 1961 or 1962, wherein the lowest dose of the oligomeric compound that raises circulating ALT to over 300 units per liter is at least three-fold higher than the lowest dose of the comparator compound that raises circulating ALT to over 300 units per liter.

1964. The oligomeric compound of any of embodiments 1961-1963, wherein the oligomeric compound is capable of reducing the target RNA in a cell.

1965. The oligomeric compound of embodiment 1964, wherein the oligomeric compound has RNA-reducing activity comparable to a comparator compound, wherein the comparator compound is identical to the oligomeric compound except that each nucleoside of the central region of the comparator compound is a nucleoside comprising 2′β-D-deoxyribosyl sugar moiety.

1966. The oligomeric compound of embodiment 1965 having RNA-reducing activity that is no more than 2-fold worse than the RNA-reducing activity of the comparator compound.

1967. A method of modulating the amount or activity of a target RNA in a human subject comprising administering the oligomeric compound or composition of any of embodiments 1461-1858 to the human subject; and thereby modulating the amount or activity of the target RNA in the human subject.

1968. A method of treating a disease or disorder in a human subject comprising administering the oligomeric compound or composition of any of embodiments 1461-1858 to the human subject having the disease or disorder; and thereby treating the disease or disorder in the human subject.

1969. The method of embodiment 1967 or 1968, wherein the disease or disorder is a liver disease, and wherein the oligomeric compound modulates the amount or activity of a liver target RNA.

1970. The method of embodiment 1967 or 1968, wherein the disease or disorder is a central nervous system disease, and wherein the oligomeric compound modulates the amount or activity of a central nervous system target RNA.

1971. The method of any of embodiments 1967-1970, wherein the disease or disorder is a cancer, a neurodegenerative disease, a cardiovascular disease, an immunological disease, a hereditary disease, a repeat expansion disease, a muscle-wasting disease, or a metabolic disease.

1972. The method of any of embodiments 1967-1971, wherein the plasma ALT level of the human subject after the administration is not more than three times higher than it was prior to the administration.

1973. The method of any of embodiments 1967-1972, wherein the plasma ALT level of the human subject after the administration is not more than 150 units per liter.

1974. A method of treating a disease or disorder in a human subject comprising administering the oligomeric compound or composition of any of embodiments 1461-1858 to the human subject having the disease or disorder; and thereby treating the disease or disorder in the human subject.

1975. The method of embodiment 1974, wherein the disease or disorder is not a CNS disease or disorder.

1976. The method of embodiment 1974, wherein the disease or disorder is a disease or disorder of the white fat cells.

1977. The method of embodiment 1974, wherein the disease or disorder is a disease or disorder of the brown fat cells.

1978. The method of embodiment 1974, wherein the disease or disorder is a disease or disorder of the adipocytes.

1979. The method of embodiment 1974, wherein the disease or disorder is a disease or disorder of the macrophages.

1980. The method of embodiment 1974, wherein the disease or disorder is a disease or disorder of the cancer cells.

1981. The method of embodiment 1974, wherein the disease or disorder is a disease or disorder of the tumor cells.

1982. The method of embodiment 1974, wherein the disease or disorder is a disease or disorder of the smooth muscle cells.

1983. The method of embodiment 1974, wherein the disease or disorder is a disease or disorder of the lymphocytes.

1984. The method of embodiment 1974, wherein the disease or disorder is a disease or disorder of the pulmonary cells.

1985. The method of embodiment 1974, wherein the disease or disorder is a disease or disorder of the heart muscle cells.

1986. The method of embodiment 1974, wherein the disease or disorder is a disease or disorder of the cardiomyocytes.

1987. The method of embodiment 1974, wherein the disease or disorder is a disease or disorder of the endothelial cells.

1988. The method of embodiment 1974, wherein the disease or disorder is a disease or disorder of the fibroblasts.

1989. The method of embodiment 1974, wherein the disease or disorder is a disease or disorder of the glial cells.

1990. The method of embodiment 1974, wherein the disease or disorder is a disease or disorder of the Schwann cells.

1991. The method of embodiment 1974, wherein the disease or disorder is a disease or disorder of the pancreatic cells.

1992. The method of embodiment 1974, wherein the disease or disorder is a disease or disorder of the kidney cells.

1993. The method of embodiment 1974, wherein the disease or disorder is a disease or disorder of the beta cells.

1994. The method of embodiment 1974, wherein the disease or disorder is a disease or disorder of the non-parenchymal cells.

1995. The method of embodiment 1974, wherein the disease or disorder is a disease or disorder of the hepatocytes.

1996. The method of embodiment 1974, wherein the disease or disorder is a disease or disorder of the oligodendrocytes.

1997. The method of embodiment 1974, wherein the disease or disorder is a disease or disorder of the astrocytes.

1998. The method of embodiment 1974, wherein the disease or disorder is a disease or disorder of the microglia.

1999. The method of embodiment 1974, wherein the disease or disorder is a disease or disorder of the ependymal cells.

2000. The method of embodiment 1974, wherein the disease or disorder is a disease or disorder of the sensory neurons.

2001. The method of embodiment 1974, wherein the disease or disorder is a disease or disorder of the motor neurons.

2002. The method of embodiment 1974, wherein the disease or disorder is a disease or disorder of the skeletal muscle.

2003. The method of embodiment 1974, wherein the disease or disorder is a disease or disorder of the cardiac muscle.

2004. The method of embodiment 1974, wherein the disease or disorder is a disease or disorder of the smooth muscle.

2005. The method of embodiment 1974, wherein the disease or disorder is a disease or disorder of the adipose tissue.

2006. The method of embodiment 1974, wherein the disease or disorder is a disease or disorder of the white adipose tissue.

2007. The method of embodiment 1974, wherein the disease or disorder is a disease or disorder of the spleen.

2008. The method of embodiment 1974, wherein the disease or disorder is a disease or disorder of the bone.

2009. The method of embodiment 1974, wherein the disease or disorder is a disease or disorder of the bone marrow.

2010. The method of embodiment 1974, wherein the disease or disorder is a disease or disorder of the intestine.

2011. The method of embodiment 1974, wherein the disease or disorder is a disease or disorder of the adrenal glands.

2012. The method of embodiment 1974, wherein the disease or disorder is a disease or disorder of the testes.

2013. The method of embodiment 1974, wherein the disease or disorder is a disease or disorder of the ovaries.

2014. The method of embodiment 1974, wherein the disease or disorder is a disease or disorder of the pancreas.

2015. The method of embodiment 1974, wherein the disease or disorder is a disease or disorder of the pituitary gland.

2016. The method of embodiment 1974, wherein the disease or disorder is a disease or disorder of the prostate gland.

2017. The method of embodiment 1974, wherein the disease or disorder is a disease or disorder of the skin.

2018. The method of embodiment 1974, wherein the disease or disorder is a disease or disorder of the epidermis.

2019. The method of embodiment 1974, wherein the disease or disorder is a disease or disorder of the uterus.

2020. The method of embodiment 1974, wherein the disease or disorder is a disease or disorder of the bladder.

2021. The method of embodiment 1974, wherein the disease or disorder is a disease or disorder of the brain.

2022. The method of embodiment 1974, wherein the disease or disorder is a disease or disorder of the glomerulus.

2023. The method of embodiment 1974, wherein the disease or disorder is a disease or disorder of the distal tubular epithelium.

2024. The method of embodiment 1974, wherein the disease or disorder is a disease or disorder of the breast tissue.

2025. The method of embodiment 1974, wherein the disease or disorder is a disease or disorder of the lung.

2026. The method of embodiment 1974, wherein the disease or disorder is a disease or disorder of the heart.

2027. The method of embodiment 1974, wherein the disease or disorder is a disease or disorder of the kidney.

2028. The method of embodiment 1974, wherein the disease or disorder is a disease or disorder of the ganglion.

2029. The method of embodiment 1974, wherein the disease or disorder is a disease or disorder of the frontal cortex.

2030. The method of embodiment 1974, wherein the disease or disorder is a disease or disorder of the spinal cord.

2031. The method of embodiment 1974, wherein the disease or disorder is a disease or disorder of the trigeminal ganglion.

2032. The method of embodiment 1974, wherein the disease or disorder is a disease or disorder of the sciatic nerve.

2033. The method of embodiment 1974, wherein the disease or disorder is a disease or disorder of the dorsal root ganglion.

2034. The method of embodiment 1974, wherein the disease or disorder is a disease or disorder of the epidymal fat.

2035. The method of embodiment 1974, wherein the disease or disorder is a disease or disorder of the diaphragm.

2036. The method of embodiment 1974, wherein the disease or disorder is a disease or disorder of the colon.

2037. A method of screening a library of oligomeric compounds for activity against a target RNA, wherein the library of oligomeric compounds comprises a plurality of oligomeric compounds of any of embodiments 1461-1858.

Certain Compounds

In certain embodiments, compounds described herein are oligomeric compounds comprising or consisting of oligonucleotides consisting of linked nucleosides. Oligonucleotides may be unmodified oligonucleotides or may be modified oligonucleotides. Modified oligonucleotides comprise at least one modification relative to an unmodified oligonucleotide (i.e., comprise at least one modified nucleoside (comprising a modified sugar moiety and/or a modified nucleobase) and/or at least one modified internucleoside linkage).

I. Modifications

A. Modified Nucleosides

Modified nucleosides comprise a modified sugar moiety, a modified nucleobase, or both a modified sugar moiety and a modified nucleobase.

1. Certain Modified Sugar Moieties

In certain embodiments, sugar moieties are non-bicyclic, modified furanosyl sugar moieties. In certain embodiments, modified sugar moieties are bicyclic or tricyclic furanosyl sugar moieties. In certain embodiments, modified sugar moieties are sugar surrogates. Such sugar surrogates may comprise one or more substitutions corresponding to those of other types of modified sugar moieties.

In certain embodiments, modified sugar moieties are non-bicyclic modified furanosyl sugar moieties comprising one or more acyclic substituent, including but not limited to substituents at the 2′, 3′, 4′, and/or 5′ positions. In certain embodiments, the furanosyl sugar moiety is a ribosyl sugar moiety. In certain embodiments, the furanosyl sugar moiety is a β-D-ribofuranosyl sugar moiety. In certain embodiments one or more acyclic substituent of non-bicyclic modified sugar moieties is branched. Examples of 2′-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to: 2′-F, 2′-OCH 3 (“2′-OMe” or “2′-O-methyl”), and 2′-O(CH 2 ) 2 OCH 3 (“2′-MOE”). In certain embodiments, 2′-substituent groups are selected from among: halo, allyl, amino, azido, SH, CN, OCN, CF 3 , OCF 3 , O—C 1 -C 10 alkoxy, O—C 1 -C 10 substituted alkoxy, C 1 -C 10 alkyl, C 1 -C 10 substituted alkyl, S-alkyl, O-alkenyl, S-alkenyl, N(R m )-alkenyl, O-alkynyl, S-alkynyl, N(R m )-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH 2 ) 2 SCH 3 , O(CH 2 ) 2 ON(R m )(R n ) or OCH 2 C(═O)—N(R m )(R n ), where each R m and R n is, independently, H, an amino protecting group, or substituted or unsubstituted C 1 -C 10 alkyl, and the 2′-substituent groups described in Cook et al., U.S. Pat. No. 6,531,584; Cook et al., U.S. Pat. No. 5,859,221; and Cook et al., U.S. Pat. No. 6,005,087. Certain embodiments of these 2′-substituent groups can be further substituted with one or more substituent groups independently selected from among: hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro (NO 2 ), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl and alkynyl. Examples of 3′-substituent groups include 3′-methyl (see Frier, et al., The ups and downs of nucleic acid duplex stability: structure-stability studies on chemically-modified DNA:RNA duplexes. Nucleic Acids Res., 25, 4429-4443, 1997.) Examples of 4′-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to alkoxy (e.g., methoxy), alkyl, and those described in Manoharan et al., WO 2015/106128. Examples of 5′-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to: 5′-methyl (R or S), 5′-allyl, 5′-ethyl, 5′-vinyl, and 5′-methoxy. In certain embodiments, non-bicyclic modified sugars comprise more than one non-bridging sugar substituent, for example, 2′-F-5′-methyl sugar moieties and the modified sugar moieties and modified nucleosides described in Migawa et al., WO 2008/101157 and Rajeev et al., US2013/0203836. 2′,4′-difluoro modified sugar moieties have been described in Martinez-Montero, et al., Rigid 2′,4′-difluororibonucleosides: synthesis, conformational analysis, and incorporation into nascent RNA by HCV polymerase. J. Org. Chem., 2014, 79:5627-5635. Modified sugar moieties comprising a 2′-modification (OMe or F) and a 4′-modification (OMe or F) have also been described in Malek-Adamian, et al., J. Org. Chem, 2018, 83: 9839-9849.

In certain embodiments, a 2′-substituted nucleoside or non-bicyclic 2′-modified nucleoside comprises a sugar moiety comprising a non-bridging 2′-substituent group selected from: F, NH 2 , N 3 , OCF 3 , OCH 3 , O(CH 2 ) 3 NH 2 , CH 2 CH═CH 2 , OCH 2 CH═CH 2 , OCH 2 CH 2 OCH 3 , O(CH 2 ) 2 SCH 3 , O(CH 2 ) 2 ON(R m )(R n ), O(CH 2 ) 2 O(CH 2 ) 2 N(CH 3 ) 2 , and N-substituted acetamide (OCH 2 C(═O)—N(R m )(R n )), where each R m and R n is, independently, H, an amino protecting group, or substituted or unsubstituted C 1 -C 10 alkyl.

In certain embodiments, a 2′-substituted nucleoside or non-bicyclic 2′-modified nucleoside comprises a sugar moiety comprising a non-bridging 2′-substituent group selected from: F, OCF 3 , OCH 3 , OCH 2 CH 2 OCH 3 , O(CH 2 ) 2 SCH 3 , O(CH 2 ) 2 ON(CH 3 ) 2 , O(CH 2 ) 2 O(CH 2 ) 2 N(CH 3 ) 2 , and OCH 2 C(═O)—N(H)CH 3 (“NMA”).

In certain embodiments, a 2′-substituted nucleoside or non-bicyclic 2′-modified nucleoside comprises a sugar moiety comprising a non-bridging 2′-substituent group selected from: F, OCH 3 , and OCH 2 CH 2 OCH 3 .

In certain embodiments, the 4′ 0 of 2′-deoxyribose can be substituted with a S to generate 4′-thio DNA (see Takahashi, et al., Nucleic Acids Research 2009, 37: 1353-1362). This modification can be combined with other modifications detailed herein. In certain such embodiments, the sugar moiety is further modified at the 2′ position. In certain embodiments the sugar moiety comprises a 2′-fluoro. A thymidine with this sugar moiety has been described in Watts, et al., J. Org. Chem. 2006, 71(3): 921-925 (4′-S-fluoro5-methylarauridine or FAMU).

Certain modified sugar moieties comprise a bridging sugar substituent that forms a second ring resulting in a bicyclic sugar moiety. In certain such embodiments, the bicyclic sugar moiety comprises a bridge between the 4′ and the 2′ furanose ring atoms. In certain such embodiments, the furanose ring is a ribose ring. Examples of sugar moieties comprising such 4′ to 2′ bridging sugar substituents include but are not limited to bicyclic sugars comprising: 4′-CH 2 -2′, 4′-(CH 2 ) 2 -2′, 4′-(CH 2 ) 3 -2′, (“LNA”), 4′-(CH 2 ) 2 -O-2′ (“ENA”), 4′-CH(CH 3 )—O-2′ (referred to as “constrained ethyl” or “cEt” when in the S configuration), 4′-CH 2 —O—CH 2 -2′, 4′-CH 2 —N(R)-2′, 4′-CH(CH 2 OCH 3 )—O-2′ (“constrained MOE” or “cMOE”) and analogs thereof (see, e.g., Seth et al., U.S. Pat. No. 7,399,845, Bhat et al., U.S. Pat. No. 7,569,686, Swayze et al., U.S. Pat. No. 7,741,457, and Swayze et al., U.S. Pat. No. 8,022,193), 4′-C(CH 3 )(CH 3 )—O-2′ and analogs thereof (see, e.g., Seth et al., U.S. Pat. No. 8,278,283), 4′-CH 2 —N(OCH 3 )-2′ and analogs thereof (see, e.g., Prakash et al., U.S. Pat. No. 8,278,425), 4′-CH 2 —O—N(CH 3 )-2′ (see, e.g., Allerson et al., U.S. Pat. No. 7,696,345 and Allerson et al., U.S. Pat. No. 8,124,745), 4′-CH 2 —C(H)(CH 3 )-2′ (see, e.g., Zhou, et al., J. Org. Chem., 2009, 74, 118-134), 4′-CH 2 —C(═CH 2 )-2′ and analogs thereof (see e.g., Seth et al., U.S. Pat. No. 8,278,426), 4′-C(R a R b )—N(R)—O-2′, 4′-C(R a R b )—O—N(R)-2′, 4′-CH 2 —O—N(R)-2′, and 4′-CH 2 —N(R)—O-2′, wherein each R, R a , and R b is, independently, H, a protecting group, or C 1 -C 12 alkyl (see, e.g. Imanishi et al., U.S. Pat. No. 7,427,672), 4′-C(═O)—N(CH 3 ) 2 -2′, 4′-C(═O)—N(R) 2 -2′, 4′-C(═S)—N(R) 2 -2′ and analogs thereof (see, e.g., Obika et al., WO2011052436A1, Yusuke, WO2017018360A1).

In certain embodiments, such 4′ to 2′ bridges independently comprise from 1 to 4 linked groups independently selected from: —[C(R a )(R b )] n —, —[C(R a )(R b )] n —O—, —C(R a )═C(R b )—, —C(R a )═N—, —C(═NR a )—, —C(═O)—, —C(═S)—, —O—, —Si(R a ) 2 —, —S(═O) x —, and —N(R a )—;

wherein: x is 0, 1, or 2; n is 1, 2, 3, or 4; each R a and R b is, independently, H, a protecting group, hydroxyl, C 1 -C 12 alkyl, substituted C 1 -C 12 alkyl, C 2 -C 12 alkenyl, substituted C 2 -C 12 alkenyl, C 2 -C 12 alkynyl, substituted C 2 -C 12 alkynyl, C 5 -C 20 aryl, substituted C 5 -C 20 aryl, heterocycle radical, substituted heterocycle radical, heteroaryl, substituted heteroaryl, C 5 -C 7 alicyclic radical, substituted C 5 -C 7 alicyclic radical, halogen, OJ 1 , NJ 1 J 2 , SJ 1 , N 3 , COOJ 1 , acyl (C(═O)—H), substituted acyl, CN, sulfonyl (S(═O) 2 -J 1 ), or sulfoxyl (S(═O)-J 1 ); and each J 1 and J 2 is, independently, H, C 1 -C 12 alkyl, substituted C 1 -C 12 alkyl, C 2 -C 12 alkenyl, substituted C 2 -C 12 alkenyl, C 2 -C 12 alkynyl, substituted C 2 -C 12 alkynyl, C 5 -C 20 aryl, substituted C 5 -C 20 aryl, acyl (C(═O)—H), substituted acyl, a heterocycle radical, a substituted heterocycle radical, C 1 -C 12 aminoalkyl, substituted C 1 -C 12 aminoalkyl, or a protecting group.

Additional bicyclic sugar moieties are known in the art, see, for example: Freier et al., Nucleic Acids Research, 1997, 25(22), 4429-4443, Albaek et al., J. Org. Chem., 2006, 71, 7731-7740, Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. Org. Chem., 1998, 63, 10035-10039; Srivastava et al., J. Am. Chem. Soc., 2017, 129, 8362-8379; Elayadi et al., Christiansen, et al., J. Am. Chem. Soc. 1998, 120, 5458-5463; Wengel et a., U.S. Pat. No. 7,053,207; Imanishi et al., U.S. Pat. No. 6,268,490; Imanishi et al. U.S. Pat. No. 6,770,748; Imanishi et al., U.S. RE44,779; Wengel et al., U.S. Pat. No. 6,794,499; Wengel et al., U.S. Pat. No. 6,670,461; Wengel et al., U.S. Pat. No. 7,034,133; Wengel et al., U.S. Pat. No. 8,080,644; Wengel et al., U.S. Pat. No. 8,034,909; Wengel et al., U.S. Pat. No. 8,153,365; Wengel et al., U.S. Pat. No. 7,572,582; and Ramasamy et al., U.S. Pat. No. 6,525,191; Torsten et al., WO 2004/106356; Wengel et al., WO 1999/014226; Seth et al., WO 2007/134181; Seth et al., U.S. Pat. No. 7,547,684; Seth et al., U.S. Pat. No. 7,666,854; Seth et al., U.S. Pat. No. 8,088,746; Seth et al., U.S. Pat. No. 7,750,131; Seth et al., U.S. Pat. No. 8,030,467; Seth et al., U.S. Pat. No. 8,268,980; Seth et al., U.S. Pat. No. 8,546,556; Seth et al., U.S. Pat. No. 8,530,640; Migawa et al., U.S. Pat. No. 9,012,421; Seth et al., U.S. Pat. No. 8,501,805; and U.S. Patent Publication Nos. Allerson et al., US2008/0039618 and Migawa et al., US2015/0191727.

In certain embodiments, bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by isomeric configuration. For example, an LNA nucleoside (described herein) may be in the α-L configuration or in the β-D configuration.

α-L-methyleneoxy (4′-CH 2 —O-2′) or α-L-LNA bicyclic nucleosides have been incorporated into antisense oligonucleotides that showed antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372). Herein, general descriptions of bicyclic nucleosides include both isomeric configurations. When the positions of specific bicyclic nucleosides (e.g., LNA) are identified in exemplified embodiments herein, they are in the β-D configuration, unless otherwise specified.

In certain embodiments, modified sugar moieties comprise one or more non-bridging sugar substituent and one or more bridging sugar substituent (e.g., 5′-substituted and 4′-2′ bridged sugars).

Nucleosides comprising modified furanosyl sugar moieties and modified furanosyl sugar moieties may be referred to by the position(s) of the substitution(s) on the sugar moiety of the nucleoside. The term “modified” following a position of the furanosyl ring, such as “2′-modified”, indicates that the sugar moiety comprises the indicated modification at the 2′ position and may comprise additional modifications and/or substituents. A 4′-2′ bridged sugar moiety is 2′-modified and 4′-modified, or, alternatively, “2′, 4′-modified”. The term “substituted” following a position of the furanosyl ring, such as “2′-substituted” or “2′-4′-substituted”, indicates that is the only position(s) having a substituent other than those found in unmodified sugar moieties in oligonucleotides. Accordingly, the following sugar moieties are represented by the following formulas.

In the context of a nucleoside and/or an oligonucleotide, a non-bicyclic, modified furanosyl sugar moiety is represented by formula I:

wherein B is a nucleobase; and L 1 and L 2 are each, independently, an internucleoside linkage, a terminal group, a conjugate group, or a hydroxyl group. Among the R groups, at least one of R 3-7 is not H and/or at least one of R 1 and R 2 is not H or OH. In a 2′-modified furanosyl sugar moiety, at least one of R 1 and R 2 is not H or OH and each of R 3-7 is independently selected from H or a substituent other than H. In a 4′-modified furanosyl sugar moiety, R 5 is not H and each of R 1 -4, 6, 7 are independently selected from H and a substituent other than H; and so on for each position of the furanosyl ring. The stereochemistry is not defined unless otherwise noted.

In the context of a nucleoside and/or an oligonucleotide, a non-bicyclic, modified, substituted fuarnosyl sugar moiety is represented by formula I, wherein B is a nucleobase; and L 1 and L 2 are each, independently, an internucleoside linkage, a terminal group, a conjugate group, or a hydroxyl group. Among the R groups, either one (and no more than one) of R 3-7 is a substituent other than H or one of R 1 or R 2 is a substituent other than H or OH. The stereochemistry is not defined unless otherwise noted. Examples of non-bicyclic, modified, substituted furanosyl sugar moieties include 2′-substituted ribosyl, 4′-substituted ribosyl, and 5′-substituted ribosyl sugar moieties, as well as substituted 2′-deoxyfuranosyl sugar moieties, such as 4′-substituted 2′-deoxyribosyl and 5′-substituted 2′-deoxyribosyl sugar moieties.

In the context of a nucleoside and/or an oligonucleotide, a 2′-substituted ribosyl sugar moiety is represented by formula II:

wherein B is a nucleobase; and L 1 and L 2 are each, independently, an internucleoside linkage, a terminal group, a conjugate group, or a hydroxyl group. R 1 is a substituent other than H or OH. The stereochemistry is defined as shown.

In the context of a nucleoside and/or an oligonucleotide, a 4′-substituted ribosyl sugar moiety is represented by formula III:

wherein B is a nucleobase; and L 1 and L 2 are each, independently, an internucleoside linkage, a terminal group, a conjugate group, or a hydroxyl group. R 5 is a substituent other than H. The stereochemistry is defined as shown.

In the context of a nucleoside and/or an oligonucleotide, a 5′-substituted ribosyl sugar moiety is represented by formula IV:

wherein B is a nucleobase; and L 1 and L 2 are each, independently, an internucleoside linkage, a terminal group, a conjugate group, or a hydroxyl group. R 6 or R 7 is a substituent other than H. The stereochemistry is defined as shown.

In the context of a nucleoside and/or an oligonucleotide, a 2′-deoxyfuranosyl sugar moiety is represented by formula V:

wherein B is a nucleobase; and L 1 and L 2 are each, independently, an internucleoside linkage, a terminal group, a conjugate group, or a hydroxyl group. Each of R 1-5 are independently selected from H and a non-H substituent. If all of R 1-5 are each H, the sugar moiety is an unsubstituted 2′-deoxyfuranosyl sugar moiety. The stereochemistry is not defined unless otherwise noted.

In the context of a nucleoside and/or an oligonucleotide, a 4′-substituted 2′-deoxyribosyl sugar moiety is represented by formula VI:

wherein B is a nucleobase; and L 1 and L 2 are each, independently, an internucleoside linkage, a terminal group, a conjugate group, or a hydroxyl group. R 3 is a substituent other than H. The stereochemistry is defined as shown.

In the context of a nucleoside and/or an oligonucleotide, a 5′-substituted 2′-deoxyribosyl sugar moiety is represented by formula VII:

wherein B is a nucleobase; and L 1 and L 2 are each, independently, an internucleoside linkage, a terminal group, a conjugate group, or a hydroxyl group. R 4 or R 5 is a substituent other than H. The stereochemistry is defined as shown.

Unsubstituted 2′-deoxyfuranosyl sugar moieties may be unmodified (β-D-2′-deoxyribosyl) or modified. Examples of modified, unsubstituted 2′-deoxyfuranosyl sugar moieties include β-L-2′-deoxyribosyl, α-L-2′-deoxyribosyl, α-D-2′-deoxyribosyl, and β-D-xylosyl sugar moieties. For example, in the context of a nucleoside and/or an oligonucleotide, a β-L-2′-deoxyribosyl sugar moiety is represented by formula VIII:

wherein B is a nucleobase; and L 1 and L 2 are each, independently, an internucleoside linkage, a terminal group, a conjugate group, or a hydroxyl group. The stereochemistry is defined as shown. Synthesis of α-L-ribosyl nucleotides and β-D-xylosyl nucleotides has been described by Gaubert, et al., Tetehedron 2006, 62: 2278-2294. Additional isomers of DNA and RNA nucleosides are described by Vester, et. al., “Chemically modified oligonucleotides with efficient RNase H response,” Bioorg. Med. Chem. Letters, 2008, 18: 2296-2300.

In certain embodiments, modified sugar moieties are sugar surrogates. In certain such embodiments, the oxygen atom of the sugar moiety is replaced, e.g., with a sulfur, carbon or nitrogen atom. In certain such embodiments, such modified sugar moieties also comprise bridging and/or non-bridging substituents as described herein. For example, certain sugar surrogates comprise a 4′-sulfur atom and a substitution at the 2′-position (see, e.g., Bhat et al., U.S. Pat. No. 7,875,733 and Bhat et al., U.S. Pat. No. 7,939,677) and/or the 5′ position.

In certain embodiments, sugar surrogates comprise rings having other than 5 atoms. For example, in certain embodiments, a sugar surrogate comprises a six-membered tetrahydropyran (“THP”). Such tetrahydropyrans may be further modified or substituted. Nucleosides comprising such modified tetrahydropyrans include but are not limited to hexitol nucleic acid (“HNA”), altritol nucleic acid (“ANA”), mannitol nucleic acid (“MNA”) (see, e.g., Leumann, C J. Bioorg . & Med. Chem. 2002, 10, 841-854), fluoro HNA

(“F-HNA”, see e.g. Swayze et al., U.S. Pat. No. 8,088,904; Swayze et al., U.S. Pat. No. 8,440,803; Swayze et al., U.S. Pat. No. 8,796,437; and Swayze et al., U.S. Pat. No. 9,005,906; F-HNA can also be referred to as a F-THP or 3′-fluoro tetrahydropyran), F-CeNA, and 3′-ara-HNA, having the formulas below, where L 1 and L 2 are each, independently, an internucleoside linkage linking the modified THP nucleoside to the remainder of an oligonucleotide or one of L 1 and L 2 is an internucleoside linkage linking the modified THP nucleoside to the remainder of an oligonucleotide and the other of L 1 and L 2 is H, a hydroxyl protecting group, a linked conjugate group, or a 5′ or 3′-terminal group.

Additional sugar surrogates comprise THP compounds having the formula:

wherein, independently, for each of said modified THP nucleoside:

Bx is a nucleobase moiety; T 3 and T 4 are each, independently, an internucleoside linkage linking the modified THP nucleoside to the remainder of an oligonucleotide or one of T 3 and T 4 is an internucleoside linkage linking the modified THP nucleoside to the remainder of an oligonucleotide and the other of T 3 and T 4 is H, a hydroxyl protecting group, a linked conjugate group, or a 5′ or 3′-terminal group; q 1 , q 2 , q 3 , q 4 , q 5 , q 6 and q 7 are each, independently, H, C 1 -C 6 alkyl, substituted C 1 -C 6 alkyl, C 2 -C 6 alkenyl, substituted C 2 -C 6 alkenyl, C 2 -C 6 alkynyl, or substituted C 2 -C 6 alkynyl; and each of R 1 and R 2 is independently selected from among: hydrogen, halogen, substituted or unsubstituted alkoxy, NJ 1 J 2 , SJ 1 , N 3 , OC(═X)J 1 , OC(═X)NJ 1 J 2 , NJ 3 C(═X)NJ 1 J 2 , and CN, wherein X is O, S or NJ 1 , and each J 1 , J 2 , and J 3 is, independently, H or C 1 -C 6 alkyl.

In certain embodiments, modified THP nucleosides are provided wherein q 1 , q 2 , q 3 , q 4 , q 5 , q 6 and q 7 are each H. In certain embodiments, at least one of q 1 , q 2 , q 3 , q 4 , q 5 , q 6 and q 7 is other than H. In certain embodiments, at least one of q 1 , q 2 , q 3 , q 4 , q 5 , q 6 and q 7 is methyl. In certain embodiments, modified THP nucleosides are provided wherein one of R 1 and R 2 is F. In certain embodiments, R 1 is F and R 2 is H, in certain embodiments, R 1 is methoxy and R 2 is H, and in certain embodiments, R 1 is methoxyethoxy and R 2 is H.

In certain embodiments, sugar surrogates comprise rings having no heteroatoms. For example, nucleosides comprising bicyclo [3.1.0]-hexane have been described (see, e.g., Marquez, et al., J. Med. Chem. 1996, 39:3739-3749).

In certain embodiments, sugar surrogates comprise rings having more than 5 atoms and more than one heteroatom. For example, nucleosides comprising morpholino sugar moieties and their use in oligonucleotides have been reported (see, e.g., Braasch et al., Biochemistry, 2002, 41, 4503-4510 and Summerton et al., U.S. Pat. No. 5,698,685; Summerton et al., U.S. Pat. No. 5,166,315; Summerton et al., U.S. Pat. No. 5,185,444; and Summerton et al., U.S. Pat. No. 5,034,506). As used here, the term “morpholino” means a sugar surrogate comprising the following structure:

In certain embodiments, morpholinos may be modified, for example by adding or altering various substituent groups from the above morpholino structure. Such sugar surrogates are referred to herein as “modified morpholinos.” In certain embodiments, morpholino residues replace a full nucleotide, including the internucleoside linkage, and have the structures shown below, wherein Bx is a heterocyclic base moiety.

In certain embodiments, sugar surrogates comprise acyclic moieties. Examples of nucleosides and oligonucleotides comprising such acyclic sugar surrogates include but are not limited to: peptide nucleic acid (“PNA”), acyclic butyl nucleic acid (see, e.g., Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), glycol nucleic acid (“GNA”, see Schlegel, et al., J. Am. Chem. Soc. 2017, 139:8537-8546) and nucleosides and oligonucleotides described in Manoharan et al., WO2011/133876.

Many other bicyclic and tricyclic sugar and sugar surrogate ring systems are known in the art that can be used in modified nucleosides. Certain such ring systems are described in Hanessian, et al., J. Org. Chem., 2013, 78: 9051-9063 and include bcDNA and tcDNA. Modifications to bcDNA and tcDNA, such as 6′-fluoro, have also been described (Dogovic and Leumann, J. Org. Chem., 2014, 79: 1271-1279).

In certain embodiments, modified nucleosides are DNA mimics. “DNA mimic” means a nucleoside other than a DNA nucleoside wherein the nucleobase is directly linked to a carbon atom of a ring bound to a second carbon atom within the ring, wherein the second carbon atom comprises a bond to at least one hydrogen atom, wherein the nucleobase and at least one hydrogen atom are trans to one another relative to the bond between the two carbon atoms.

In certain embodiments, a DNA mimic comprises a structure represented by the formula below:

Wherein Bx represents a heterocyclic base moiety.

In certain embodiments, a DNA mimic comprises a structure represented by one of the formulas below:

wherein X is O or S and Bx represents a heterocyclic base moiety.

In certain embodiments, a DNA mimic is a sugar surrogate. In certain embodiments, a DNA mimic is a cycohexenyl or hexitol nucleic acid. In certain embodiments, a DNA mimic is described in FIG. 1 of Vester, et. al., “Chemically modified oligonucleotides with efficient RNase H response,” Bioorg. Med. Chem. Letters, 2008, 18: 2296-2300, incorporated by reference herein. In certain embodiments, a DNA mimic nucleoside has a formula selected from

wherein Bx is a heterocyclic base moiety, and L 1 and L 2 are each, independently, an internucleoside linkage linking the modified THP nucleoside to the remainder of an oligonucleotide or one of L 1 and L 2 is an internucleoside linkage linking the modified nucleoside to the remainder of an oligonucleotide and the other of L 1 and L 2 is H, a hydroxyl protecting group, a linked conjugate group, or a 5′ or 3′-terminal group. In certain embodiments, a DNA mimic is α,β-constrained nucleic acid (CAN), 2′,4′-carbocyclic-LNA, or 2′,4′-carbocyclic-ENA. In certain embodiments, a DNA mimic has a sugar moiety selected from among: 4′-C-hydroxymethyl-2′-deoxyribosyl, 3′-C-hydroxymethyl-2′-deoxyribosyl, 3′-C-hydroxymethyl-arabinosyl, 3′-C-2′-O-arabinosyl, 3′-C-methylene-extended-xyolosyl, 3′-C-2′-O-piperazino-arabinosyl. In certain embodiments, a DNA mimic has a sugar moiety selected from among: 2′-methylribosyl, 2′-S-methylribosyl, 2′-aminoribosyl, 2′-NH(CH 2 )-ribosyl, 2′-NH(CH 2 ) 2 -ribosyl, 2′-CH2-F-ribosyl, 2′-CHF2-ribosyl, 2′-CF3-ribosyl, 2′=CF2 ribosyl, 2′-ethylribosyl, 2′-alkenylribosyl, 2′-alkynylribosyl, 2′-O-4′-C-methyleneribosyl, 2′-cyanoarabinosyl, 2′-chloroarabinosyl, 2′-fluoroarabinosyl, 2′-bromoarabinosyl, 2′-azidoarabinosyl, 2′-methoxyarabinosyl, and 2′-arabinosyl. In certain embodiments, a DNA mimic has a sugar moiety selected from 4′-methyl-modified deoxyfuranosyl, 4′-F-deoxyfuranosyl, 4′-OMe-deoxyfuranosyl. In certain embodiments, a DNA mimic has a sugar moiety selected from among: 5′-methyl-2′-β-D-deoxyribosyl, 5′-ethyl-2′-β-D-deoxyribosyl, 5′-allyl-2′-β-D-deoxyribosyl, 2′-fluoro-β-D-arabinofuranosyl. In certain embodiments, DNA mimics are listed on page 32-33 of PCT/US00/267929 as B-form nucleotides, incorporated by reference herein in its entirety.

2. Modified Nucleobases

In certain embodiments, modified nucleobases are selected from: 5-substituted pyrimidines, 6-azapyrimidines, alkyl or alkynyl substituted pyrimidines, alkyl substituted purines, and N-2, N-6 and O-6 substituted purines. In certain embodiments, modified nucleobases are selected from: 2-aminopropyladenine, 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (—C≡C—CH 3 ) uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza and other 8-substituted purines, 5-halo, particularly 5-bromo, 5-trifluoromethyl, 5-halouracil, and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl 4-N-benzoylcytosine, 5-methyl 4-N-benzoyluracil, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases. Further modified nucleobases include tricyclic pyrimidines, such as 1,3-diazaphenoxazine-2-one, 1,3-diazaphenothiazine-2-one and 9-(2-aminoethoxy)-1,3-diazaphenoxazine-2-one (G-clamp). Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. Further nucleobases include those disclosed in Merigan et al., U.S. Pat. No. 3,687,808, those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering , Kroschwitz, J. I., Ed., John Wiley & Sons, 1990, 858-859; Englisch et al., Angewandte Chemie , International Edition, 1991, 30, 613; Sanghvi, Y. S., Chapter 15 , Antisense Research and Applications , Crooke, S. T. and Lebleu, B., Eds., CRC Press, 1993, 273-288; and those disclosed in Chapters 6 and 15, Antisense Drug Technology, Crooke S. T., Ed., CRC Press, 2008, 163-166 and 442-443. In certain embodiments, modified nucleosides comprise double-headed nucleosides having two nucleobases. Such compounds are described in detail in Sorinas et al., J. Org. Chem, 2014 79: 8020-8030.

Publications that teach the preparation of certain of the above noted modified nucleobases as well as other modified nucleobases include without limitation, Manoharan et al., US2003/0158403; Manoharan et al., US2003/0175906; Dinh et al., U.S. Pat. No. 4,845,205; Spielvogel et al., U.S. Pat. No. 5,130,302; Rogers et al., U.S. Pat. No. 5,134,066; Bischofberger et al., U.S. Pat. No. 5,175,273; Urdea et al., U.S. Pat. No. 5,367,066; Benner et al., U.S. Pat. No. 5,432,272; Matteucci et al., U.S. Pat. No. 5,434,257; Gmeiner et al., U.S. Pat. No. 5,457,187; Cook et al., U.S. Pat. No. 5,459,255; Froehler et al., U.S. Pat. No. 5,484,908; Matteucci et al., U.S. Pat. No. 5,502,177; Hawkins et al., U.S. Pat. No. 5,525,711; Haralambidis et al., U.S. Pat. No. 5,552,540; Cook et al., U.S. Pat. No. 5,587,469; Froehler et al., U.S. Pat. No. 5,594,121; Switzer et al., U.S. Pat. No. 5,596,091; Cook et al., U.S. Pat. No. 5,614,617; Froehler et al., U.S. Pat. No. 5,645,985; Cook et al., U.S. Pat. No. 5,681,941; Cook et al., U.S. Pat. No. 5,811,534; Cook et al., U.S. Pat. No. 5,750,692; Cook et al., U.S. Pat. No. 5,948,903; Cook et al., U.S. Pat. No. 5,587,470; Cook et al., U.S. Pat. No. 5,457,191; Matteucci et al., U.S. Pat. No. 5,763,588; Froehler et al., U.S. Pat. No. 5,830,653; Cook et al., U.S. Pat. No. 5,808,027; Cook et al., 6,166,199; and Matteucci et al., U.S. Pat. No. 6,005,096.

In certain embodiments, compounds comprise or consist of a modified oligonucleotide complementary to an target nucleic acid comprising one or more modified nucleobases. In certain embodiments, the modified nucleobase is 5-methylcytosine. In certain embodiments, each cytosine is a 5-methylcytosine.

B. Modified Internucleoside Linkages

In certain embodiments, compounds described herein having one or more modified internucleoside linkages are selected over compounds having only phosphodiester internucleoside linkages because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for target nucleic acids, and increased stability in the presence of nucleases.

In certain embodiments, compounds comprise or consist of a modified oligonucleotide complementary to a target nucleic acid comprising one or more modified internucleoside linkages. In certain embodiments, the modified internucleoside linkages are phosphorothioate linkages. In certain embodiments, each internucleoside linkage of an antisense compound is a phosphorothioate internucleoside linkage.

In certain embodiments, nucleosides of modified oligonucleotides may be linked together using any internucleoside linkage. The two main classes of internucleoside linkages are defined by the presence or absence of a phosphorus atom. Representative phosphorus-containing internucleoside linkages include unmodified phosphodiester internucleoside linkages, modified phosphotriesters such as THP phosphotriester and isopropyl phosphotriester, phosphonates such as methylphosphonate, isopropyl phosphonate, isobutyl phosphonate, and phosphonoacetate, phosphoramidates, phosphorothioate, and phosphorodithioate (“HS-P═S”). Representative non-phosphorus containing internucleoside linkages include but are not limited to methylenemethylimino (—CH 2 —N(CH 3 )—O—CH 2 —), thiodiester, thionocarbamate (—O—C(═O)(NH)—S—); siloxane (—O—SiH 2 —O—); formacetal, thioacetamido (TANA), alt-thioformacetal, glycine amide, and N,N′-dimethylhydrazine (—CH 2 —N(CH 3 )—N(CH 3 )—). Modified internucleoside linkages, compared to naturally occurring phosphate linkages, can be used to alter, typically increase, nuclease resistance of the oligonucleotide. Methods of preparation of phosphorous-containing and non-phosphorous-containing internucleoside linkages are well known to those skilled in the art.

Representative internucleoside linkages having a chiral center include but are not limited to alkylphosphonates and phosphorothioates. Modified oligonucleotides comprising internucleoside linkages having a chiral center can be prepared as populations of modified oligonucleotides comprising stereorandom internucleoside linkages, or as populations of modified oligonucleotides comprising phosphorothioate linkages in particular stereochemical configurations. In certain embodiments, populations of modified oligonucleotides comprise phosphorothioate internucleoside linkages wherein all of the phosphorothioate internucleoside linkages are stereorandom. Such modified oligonucleotides can be generated using synthetic methods that result in random selection of the stereochemical configuration of each phosphorothioate linkage. All phosphorothioate linkages described herein are stereorandom unless otherwise specified. Nonetheless, as is well understood by those of skill in the art, each individual phosphorothioate of each individual oligonucleotide molecule has a defined stereoconfiguration. In certain embodiments, populations of modified oligonucleotides are enriched for modified oligonucleotides comprising one or more particular phosphorothioate internucleoside linkages in a particular, independently selected stereochemical configuration. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 65% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 70% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 80% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 90% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 99% of the molecules in the population. Such chirally enriched populations of modified oligonucleotides can be generated using synthetic methods known in the art, e.g., methods described in Oka et al., JACS 125, 8307 (2003), Wan et al. Nuc. Acid. Res. 42, 13456 (2014), and WO 2017/015555. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one indicated phosphorothioate in the (Sp) configuration. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one phosphorothioate in the (Rp) configuration. In certain embodiments, modified oligonucleotides comprising (Rp) and/or (Sp) phosphorothioates comprise one or more of the following formulas, respectively, wherein “B” indicates a nucleobase:

Unless otherwise indicated, chiral internucleoside linkages of modified oligonucleotides described herein can be stereorandom or in a particular stereochemical configuration.

Neutral internucleoside linkages include, without limitation, phosphotriesters, phosphonates, MMI (3′-CH 2 —N(CH 3 )—O-5′), amide-3 (3′-CH 2 —C(═O)—N(H)-5′), amide-4 (3′-CH 2 —N(H)—C(═O)-5′), formacetal (3′-O—CH 2 —O-5′), methoxypropyl, and thioformacetal (3′-S—CH 2 —O-5′). Further neutral internucleoside linkages include nonionic linkages comprising siloxane (dialkylsiloxane), carboxylate ester, carboxamide, sulfide, sulfonate ester and amides (See for example: Carbohydrate Modifications in Antisense Research; Y. S. Sanghvi and P. D. Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Further neutral internucleoside linkages include nonionic linkages comprising mixed N, O, S and CH 2 component parts.

In certain embodiments, nucleic acids can be linked 2′ to 5′ rather than the standard 3′ to 5′ linkage. Such a linkage is illustrated below.

In the context of a nucleoside and/or an oligonucleotide, a non-bicyclic, 2′-linked modified furanosyl sugar moiety is represented by formula IX:

wherein B is a nucleobase; L 1 is an internucleoside linkage, a terminal group, a conjugate group, or a hydroxyl group and L 2 is an internucleoside linkage. The stereochemistry is not defined unless otherwise noted.

In certain embodiments, nucleosides can be linked by vinicinal 2′, 3′-phosphodiester bonds. In certain such embodiments, the nucleosides are threofuranosyl nucleosides (TNA; see Bala, et al., J Org. Chem. 2017, 82:5910-5916). A TNA linkage is shown below.

Additional modified linkages include α,β-D-CNA type linkages and related conformationally-constrained linkages, shown below. Synthesis of such molecules has been described previously (see Dupouy, et al., Angew. Chem. Int. Ed. Engl., 2014, 45: 3623-3627, Bursting, et al. Tetahedron, 2004, 60:10955-10966; Ostergaard, et al., ACS Chem. Biol. 2014, 9: 1975-1979, Dupouy, et al., Eur. J Org. Chem., 2008, U.S. Pat. No. 12,851,294; Martinez, et al., PLoS One, 2011, 6:e25510; Dupouy, et al., Eur. J. Org. Chem., 2007, 5256-5264; Boissonnet, et al. New J. Chem., 2011 35: 1528-1533.)

II. Certain Motifs

In certain embodiments, oligomeric compounds described herein comprise or consist of oligonucleotides. Oligonucleotides can have a motif, e.g. a pattern of unmodified and/or modified sugar moieties, nucleobases, and/or internucleoside linkages. In certain embodiments, modified oligonucleotides comprise one or more modified nucleoside comprising a modified sugar. In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more modified internucleoside linkage. In such embodiments, the modified, unmodified, and differently modified sugar moieties, nucleobases, and/or internucleoside linkages of a modified oligonucleotide define a pattern or motif. In certain embodiments, the patterns or motifs of sugar moieties, nucleobases, and internucleoside linkages are each independent of one another. Thus, a modified oligonucleotide may be described by its sugar motif, nucleobase motif and/or internucleoside linkage motif (as used herein, nucleobase motif describes the modifications to the nucleobases independent of the sequence of nucleobases).

A. Certain Sugar Motifs

In certain embodiments, oligomeric compounds described herein comprise or consist of oligonucleotides. In certain embodiments, oligonucleotides comprise one or more type of modified sugar and/or unmodified sugar moiety arranged along the oligonucleotide or region thereof in a defined pattern or sugar motif. In certain instances, such sugar motifs include but are not limited to any of the sugar modifications discussed herein.

In certain embodiments, a modified oligonucleotide comprises or consists of a gapmer. The sugar motif of a gapmer defines the regions of the gapmer: 5′-region, central region, and 3′-region. The positions of the nucleosides within each region are counted beginning at the 5′-end of each region. Each region of a gapmer is connected by an internucleoside linkage, as are the nucleosides within each region. Each nucleoside of the 5′-region and each nucleoside of the 3′-region comprise a 2′-modified furanosyl sugar moiety. The nucleoside at the first position (position 1) of the central region and the nucleoside at the last position of the central region are adjacent to the 5′-region and 3′-region, respectively, and each comprise a sugar moiety independently selected from a 2′-deoxyfuranosyl sugar moiety or a sugar surrogate. Unlike the nucleosides at the first and last positions of the central region, the nucleosides at the other positions within the central region may comprise a 2′-modified furanosyl sugar moiety. In certain embodiments, the 2′-modified furanosyl sugar moiety in the 5′ and 3′-regions is a 4′-2′-bicyclic sugar moiety. In certain embodiments, the 2′-modified furanosyl sugar moiety in the 5′ and 3′ regions is a cEt. In certain embodiments, the 2′-modified furanosyl sugar moiety is a 2′-MOE furanosyl sugar moiety. In certain embodiments, each nucleoside within the gap supports RNase H cleavage. In certain embodiments, a plurality of nucleosides within the gap support RNase H cleavage. In certain embodiments, the nucleoside at the first and last positions of the central region adjacent to the 5′ and 3′ regions are DNA nucleosides.

Herein, the lengths (number of nucleosides) of the three regions of a gapmer may be provided using the notation [# of nucleosides in the 5′-wing]−[of nucleosides in the gap]−[of nucleosides in the 3′-wing]. Thus, a 3-10-3 gapmer consists of 3 linked nucleosides in each wing and 10 linked nucleosides in the gap. Where such nomenclature is followed by a specific modification, that modification is the modification of each sugar moiety of each wing and the gap nucleosides comprise 2′-β-D-deoxyribosyl sugar moieties. Thus, a 5-10-5 MOE gapmer consists of 5 linked nucleosides comprising 2′-MOE-β-D-ribofuranosyl sugar moieties in the 5′-wing, 10 linked nucleosides comprising a 2′β-D-deoxyribosyl sugar moiety in the gap, and 5 linked nucleosides comprising 2′-MOE-β-D-ribofuranosyl sugar moieties in the 3′-wing. A 3-10-3 cEt gapmer consists of 3 linked nucleosides comprising a cEt in the 5′-wing, 10 linked nucleosides comprising a 2′-β-D-deoxyribosyl sugar moiety in the gap, and 3 linked nucleosides comprising a cEt in the 3′-wing.

In certain embodiments, modified oligonucleotides are 5-10-5 MOE gapmers. In certain embodiments, modified oligonucleotides are 3-10-3 BNA gapmers. In certain embodiments, modified oligonucleotides are 3-10-3 cEt gapmers. In certain embodiments, modified oligonucleotides are 3-10-3 LNA gapmers.

The sugar motif of a 3-10-3 cEt gapmer may also be denoted by the notation kkk-d(10)-kkk, wherein each “k” represents a cEt and each “d” represents a 2′-β-D-deoxyribosyl sugar moiety. This sugar motif is independent of the nucleobase sequence, the internucleoside linkage motif, and any nucleobase modifications. A 5-10-5 MOE gapmer may be denoted by the notation eeeee-d(10)-eeeee or e(5)-d(10)-e(5), wherein each “e” represents a 2′-MOE-β-D-ribofuranosyl sugar moiety, and each “d” represents a 2′-β-D-deoxyribosyl sugar moiety.

B. Certain Nucleobase Motifs

In certain embodiments, oligomeric compounds described herein comprise or consist of oligonucleotides. In certain embodiments, oligonucleotides comprise modified and/or unmodified nucleobases arranged along the oligonucleotide or region thereof in a defined pattern or motif. In certain embodiments, each nucleobase is modified. In certain embodiments, none of the nucleobases are modified. In certain embodiments, each purine or each pyrimidine is modified. In certain embodiments, each adenine is modified. In certain embodiments, each guanine is modified. In certain embodiments, each thymine is modified. In certain embodiments, each uracil is modified. In certain embodiments, each cytosine is modified. In certain embodiments, some or all of the cytosine nucleobases in a modified oligonucleotide are 5-methylcytosines.

In certain embodiments, modified oligonucleotides comprise a block of modified nucleobases. In certain such embodiments, the block is at the 3′-end of the oligonucleotide. In certain embodiments the block is within 3 nucleosides of the 3′-end of the oligonucleotide. In certain embodiments, the block is at the 5′-end of the oligonucleotide. In certain embodiments the block is within 3 nucleosides of the 5′-end of the oligonucleotide.

In certain embodiments, one nucleoside comprising a modified nucleobase is in the central region of a modified oligonucleotide. In certain such embodiments, the sugar moiety of said nucleoside is a 2′-β-D-deoxyribosyl moiety. In certain such embodiments, the modified nucleobase is selected from: 5-methyl cytosine, 2-thiopyrimidine, 2-thiothymine, 6-methyladenine, inosine, pseudouracil, or 5-propynepyrimidine.

C. Certain Internucleoside Linkage Motifs

In certain embodiments, oligomeric compounds described herein comprise or consist of oligonucleotides. In certain embodiments, oligonucleotides comprise modified and/or unmodified internucleoside linkages arranged along the oligonucleotide or region thereof in a defined pattern or motif. In certain embodiments, each internucleoside linkage is a phosphodiester internucleoside linkage (P═O). In certain embodiments, each internucleoside linkage of a modified oligonucleotide is a phosphorothioate internucleoside linkage (P═S). In certain embodiments, each internucleoside linkage of a modified oligonucleotide is independently selected from a phosphorothioate internucleoside linkage and phosphodiester internucleoside linkage. In certain embodiments, each phosphorothioate internucleoside linkage is independently selected from a stereorandom phosphorothioate, a (Sp) phosphorothioate, and a (Rp) phosphorothioate. In certain embodiments, the internucleoside linkages within the central region of a modified oligonucleotide are all modified. In certain such embodiments, some or all of the internucleoside linkages in the 5′-region and 3′-region are unmodified phosphate linkages. In certain embodiments, the terminal internucleoside linkages are modified. In certain embodiments, the internucleoside linkage motif comprises at least one phosphodiester internucleoside linkage in at least one of the 5′-region and the 3′-region, wherein the at least one phosphodiester linkage is not a terminal internucleoside linkage, and the remaining internucleoside linkages are phosphorothioate internucleoside linkages. In certain such embodiments, all of the phosphorothioate linkages are stereorandom. In certain embodiments, all of the phosphorothioate linkages in the 5′-region and 3′-region are (Sp) phosphorothioates, and the central region comprises at least one Sp, Sp, Rp motif. In certain embodiments, populations of modified oligonucleotides are enriched for modified oligonucleotides comprising such internucleoside linkage motifs.

In certain embodiments, oligonucleotides comprise a region having an alternating internucleoside linkage motif. In certain embodiments, oligonucleotides comprise a region of uniformly modified internucleoside linkages. In certain such embodiments, the internucleoside linkages are phosphorothioate internucleoside linkages. In certain embodiments, all of the internucleoside linkages of the oligonucleotide are phosphorothioate internucleoside linkages. In certain embodiments, each internucleoside linkage of the oligonucleotide is selected from phosphodiester or phosphate and phosphorothioate. In certain embodiments, each internucleoside linkage of the oligonucleotide is selected from phosphodiester or phosphate and phosphorothioate and at least one internucleoside linkage is phosphorothioate.

In certain embodiments, the oligonucleotide comprises at least 6 phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least 8 phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least 10 phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 6 consecutive phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 8 consecutive phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 10 consecutive phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least block of at least one 12 consecutive phosphorothioate internucleoside linkages. In certain such embodiments, at least one such block is located at the 3′ end of the oligonucleotide. In certain such embodiments, at least one such block is located within 3 nucleosides of the 3′ end of the oligonucleotide.

In certain embodiments, oligonucleotides comprise one or more methylphosphonate linkages. In certain embodiments, modified oligonucleotides comprise a linkage motif comprising all phosphorothioate linkages except for one or two methylphosphonate linkages. In certain embodiments, one methylphosphonate linkage is in the central region of an oligonucleotide.

In certain embodiments, it is desirable to arrange the number of phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages to maintain nuclease resistance. In certain embodiments, it is desirable to arrange the number and position of phosphorothioate internucleoside linkages and the number and position of phosphodiester internucleoside linkages to maintain nuclease resistance. In certain embodiments, the number of phosphorothioate internucleoside linkages may be decreased and the number of phosphodiester internucleoside linkages may be increased. In certain embodiments, the number of phosphorothioate internucleoside linkages may be decreased and the number of phosphodiester internucleoside linkages may be increased while still maintaining nuclease resistance. In certain embodiments it is desirable to decrease the number of phosphorothioate internucleoside linkages while retaining nuclease resistance. In certain embodiments it is desirable to increase the number of phosphodiester internucleoside linkages while retaining nuclease resistance.

III. Certain Modified Oligonucleotides

In certain embodiments, oligomeric compounds described herein comprise or consist of modified oligonucleotides. In certain embodiments, the above modifications (sugar, nucleobase, internucleoside linkage) are incorporated into a modified oligonucleotide. In certain embodiments, modified oligonucleotides are characterized by their modifications, motifs, and overall lengths. In certain embodiments, such parameters are each independent of one another. Thus, unless otherwise indicated, each internucleoside linkage of a modified oligonucleotide may be modified or unmodified and may or may not follow the modification pattern of the sugar moieties. Likewise, such modified oligonucleotides may comprise one or more modified nucleobase independent of the pattern of the sugar modifications. Furthermore, in certain instances, a modified oligonucleotide is described by an overall length or range and by lengths or length ranges of two or more regions (e.g., a region of nucleosides having specified sugar modifications), in such circumstances it may be possible to select numbers for each range that result in an oligonucleotide having an overall length falling outside the specified range. In such circumstances, both elements must be satisfied. For example, in certain embodiments, a modified oligonucleotide consists of 15-20 linked nucleosides and has a sugar motif consisting of three regions or segments, A, B, and C, wherein region or segment A consists of 2-6 linked nucleosides having a specified sugar moiety, region or segment B consists of 6-10 linked nucleosides having a specified sugar moiety, and region or segment C consists of 2-6 linked nucleosides having a specified sugar moiety. Such embodiments do not include modified oligonucleotides where A and C each consist of 6 linked nucleosides and B consists of 10 linked nucleosides (even though those numbers of nucleosides are permitted within the requirements for A, B, and C) because the overall length of such oligonucleotide is 22, which exceeds the upper limit of 20 for the overall length of the modified oligonucleotide. Unless otherwise indicated, all modifications are independent of nucleobase sequence except that the modified nucleobase 5-methylcytosine is necessarily a “C” in an oligonucleotide sequence. In certain embodiments, when a DNA nucleoside or DNA-like nucleoside that comprises a T in a DNA sequence is replaced with a RNA-like nucleoside, including a nucleoside comprising a 2′-OMe modified sugar moiety, the nucleobase T is replaced with the nucleobase U. Each of these compounds has an identical target RNA.

In certain embodiments, oligonucleotides consist of X to Y linked nucleosides, where X represents the fewest number of nucleosides in the range and Y represents the largest number nucleosides in the range. In certain such embodiments, X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50; provided that X≤Y. For example, in certain embodiments, oligonucleotides consist of 12 to 13, 12 to 14, 12 to 15, 12 to 16, 12 to 17, 12 to 18, 12 to 19, 12 to 20, 12 to 21, 12 to 22, 12 to 23, 12 to 24, 12 to 25, 12 to 26, 12 to 27, 12 to 28, 12 to 29, 12 to 30, 13 to 14, 13 to 15, 13 to 16, 13 to 17, 13 to 18, 13 to 19, 13 to 20, 13 to 21, 13 to 22, 13 to 23, 13 to 24, 13 to 25, 13 to 26, 13 to 27, 13 to 28, 13 to 29, 13 to 30, 14 to 15, 14 to 16, 14 to 17, 14 to 18, 14 to 19, 14 to 20, 14 to 21, 14 to 22, 14 to 23, 14 to 24, 14 to 25, 14 to 26, 14 to 27, 14 to 28, 14 to 29, 14 to 30, 15 to 16, 15 to 17, 15 to 18, 15 to 19, 15 to 20, 15 to 21, 15 to 22, 15 to 23, 15 to 24, 15 to 25, 15 to 26, 15 to 27, 15 to 28, 15 to 29, 15 to 30, 16 to 17, 16 to 18, 16 to 19, 16 to 20, 16 to 21, 16 to 22, 16 to 23, 16 to 24, 16 to 25, 16 to 26, 16 to 27, 16 to 28, 16 to 29, 16 to 30, 17 to 18, 17 to 19, 17 to 20, 17 to 21, 17 to 22, 17 to 23, 17 to 24, 17 to 25, 17 to 26, 17 to 27, 17 to 28, 17 to 29, 17 to 30, 18 to 19, 18 to 20, 18 to 21, 18 to 22, 18 to 23, 18 to 24, 18 to 25, 18 to 26, 18 to 27, 18 to 28, 18 to 29, 18 to 30, 19 to 20, 19 to 21, 19 to 22, 19 to 23, 19 to 24, 19 to 25, 19 to 26, 19 to 29, 19 to 28, 19 to 29, 19 to 30, 20 to 21, 20 to 22, 20 to 23, 20 to 24, 20 to 25, 20 to 26, 20 to 27, 20 to 28, 20 to 29, 20 to 30, 21 to 22, 21 to 23, 21 to 24, 21 to 25, 21 to 26, 21 to 27, 21 to 28, 21 to 29, 21 to 30, 22 to 23, 22 to 24, 22 to 25, 22 to 26, 22 to 27, 22 to 28, 22 to 29, 22 to 30, 23 to 24, 23 to 25, 23 to 26, 23 to 27, 23 to 28, 23 to 29, 23 to 30, 24 to 25, 24 to 26, 24 to 27, 24 to 28, 24 to 29, 24 to 30, 25 to 26, 25 to 27, 25 to 28, 25 to 29, 25 to 30, 26 to 27, 26 to 28, 26 to 29, 26 to 30, 27 to 28, 27 to 29, 27 to 30, 28 to 29, 28 to 30, or 29 to 30 linked nucleosides.

In certain embodiments oligonucleotides have a nucleobase sequence that is complementary to a second oligonucleotide or an identified reference nucleic acid, such as a target nucleic acid. In certain embodiments, a region of an oligonucleotide has a nucleobase sequence that is complementary to a second oligonucleotide or an identified reference nucleic acid, such as a target nucleic acid. In certain embodiments, the nucleobase sequence of a region or entire length of an oligonucleotide is at least 70%, at least 80%, at least 90%, at least 95%, or 100% complementary to the second oligonucleotide or nucleic acid, such as a target nucleic acid.

IV. Certain Conjugated Compounds

In certain embodiments, the oligomeric compounds described herein comprise or consist of an oligonucleotide (modified or unmodified) and optionally one or more conjugate groups and/or terminal groups. Conjugate groups consist of one or more conjugate moiety and a conjugate linker that links the conjugate moiety to the oligonucleotide. Conjugate groups may be attached to either or both ends of an oligonucleotide and/or at any internal position. In certain embodiments, conjugate groups are attached to the 2′-position of a nucleoside of a modified oligonucleotide. In certain embodiments, conjugate groups that are attached to either or both ends of an oligonucleotide are terminal groups. In certain such embodiments, conjugate groups or terminal groups are attached at the 3′ and/or 5′-end of oligonucleotides. In certain such embodiments, conjugate groups (or terminal groups) are attached at the 3′-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 3′-end of oligonucleotides. In certain embodiments, conjugate groups (or terminal groups) are attached at the 5′-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 5′-end of oligonucleotides.

Examples of terminal groups include but are not limited to conjugate groups, capping groups, phosphate moieties, protecting groups, modified or unmodified nucleosides, and two or more nucleosides that are independently modified or unmodified.

A. Certain Conjugate Groups

In certain embodiments, oligonucleotides are covalently attached to one or more conjugate groups. In certain embodiments, conjugate groups modify one or more properties of the attached oligonucleotide, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge and clearance. In certain embodiments, conjugate groups impart a new property on the attached oligonucleotide, e.g., fluorophores or reporter groups that enable detection of the oligonucleotide.

Certain conjugate groups and conjugate moieties have been described previously, for example: cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Lett., 1993, 3, 2765-2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), an aliphatic chain, e.g., do-decan-diol or undecyl residues (Saison-Behmoaras et al., EMBO 1, 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic, a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, i, 923-937), a tocopherol group (Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220; doi:10.1038/mtna.2014.72 and Nishina et al., Molecular Therapy, 2008, 16, 734-740), or a GalNAc cluster (e.g., WO2014/179620).

1. Conjugate Moieties

Conjugate moieties include, without limitation, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates (e.g., GalNAc), vitamin moieties, polyethylene glycols, thioethers, polyethers, cholesterols, thiocholesterols, cholic acid moieties, folate, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins, fluorophores, and dyes.

In certain embodiments, a conjugate moiety comprises an active drug substance, for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fen-bufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a diazepine, indo-methicin, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial or an antibiotic.

2. Conjugate Linkers

Conjugate moieties are attached to oligonucleotides through conjugate linkers. In certain oligomeric compounds, a conjugate linker is a single chemical bond (i.e. conjugate moiety is attached to an oligonucleotide via a conjugate linker through a single bond). In certain embodiments, the conjugate linker comprises a chain structure, such as a hydrocarbyl chain, or an oligomer of repeating units such as ethylene glycol, nucleosides, or amino acid units.

In certain embodiments, a conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the conjugate linker comprises groups selected from alkyl, amino, oxo, amide and ether groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and amide groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker includes at least one neutral linking group.

In certain embodiments, conjugate linkers, including the conjugate linkers described above, are bifunctional linking moieties, e.g., those known in the art to be useful for attaching conjugate groups to oligomeric compounds, such as the oligonucleotides provided herein. In general, a bifunctional linking moiety comprises at least two functional groups. One of the functional groups is selected to bind to a particular site on an oligomeric compound and the other is selected to bind to a conjugate group. Examples of functional groups used in a bifunctional linking moiety include but are not limited to electrophiles for reacting with nucleophilic groups and nucleophiles for reacting with electrophilic groups. In certain embodiments, bifunctional linking moieties comprise one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.

Examples of conjugate linkers include but are not limited to pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl) cyclohexane-1-carboxylate (SMCC) and 6-aminohexanoic acid (AHEX or AHA). Other conjugate linkers include but are not limited to substituted or unsubstituted C 1 -C 10 alkyl, substituted or unsubstituted C 2 -C 10 alkenyl or substituted or unsubstituted C 2 -C 10 alkynyl, wherein a nonlimiting list of preferred substituent groups includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl.

In certain embodiments, conjugate linkers comprise 1-10 linker-nucleosides. In certain embodiments, such linker-nucleosides are modified nucleosides. In certain embodiments such linker-nucleosides comprise a modified sugar moiety. In certain embodiments, linker-nucleosides are unmodified. In certain embodiments, linker-nucleosides comprise an optionally protected heterocyclic base selected from a purine, substituted purine, pyrimidine or substituted pyrimidine. In certain embodiments, a cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methylcytosine, 4-N-benzoyl-5-methylcytosine, adenine, 6-N-benzoyladenine, guanine and 2-N-isobutyrylguanine. It is typically desirable for linker-nucleosides to be cleaved from the oligomeric compound after it reaches a target tissue. Accordingly, linker-nucleosides are typically linked to one another and to the remainder of the oligomeric compound through cleavable bonds. In certain embodiments, such cleavable bonds are phosphodiester bonds.

Herein, linker-nucleosides are not considered to be part of the oligonucleotide. Accordingly, in embodiments in which an oligomeric compound comprises an oligonucleotide consisting of a specified number or range of linked nucleosides and/or a specified percent complementarity to a reference nucleic acid and the oligomeric compound also comprises a conjugate group comprising a conjugate linker comprising linker-nucleosides, those linker-nucleosides are not counted toward the length of the oligonucleotide and are not used in determining the percent complementarity of the oligonucleotide for the reference nucleic acid. For example, an oligomeric compound may comprise (1) a modified oligonucleotide consisting of 8-30 nucleosides and (2) a conjugate group comprising 1-10 linker-nucleosides that are contiguous with the nucleosides of the modified oligonucleotide. The total number of contiguous linked nucleosides in such a compound is more than 30. Alternatively, an oligomeric compound may comprise a modified oligonucleotide consisting of 8-30 nucleosides and no conjugate group. The total number of contiguous linked nucleosides in such a compound is no more than 30. Unless otherwise indicated conjugate linkers comprise no more than 10 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 5 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 3 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 2 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 1 linker-nucleoside.

In certain embodiments, it is desirable for a conjugate group to be cleaved from the oligonucleotide. For example, in certain circumstances oligomeric compounds comprising a particular conjugate moiety are better taken up by a particular cell type, but once the compound has been taken up, it is desirable that the conjugate group be cleaved to release the unconjugated oligonucleotide. Thus, certain conjugate may comprise one or more cleavable moieties, typically within the conjugate linker. In certain embodiments, a cleavable moiety is a cleavable bond. In certain embodiments, a cleavable moiety is a group of atoms comprising at least one cleavable bond. In certain embodiments, a cleavable moiety comprises a group of atoms having one, two, three, four, or more than four cleavable bonds. In certain embodiments, a cleavable moiety is selectively cleaved inside a cell or subcellular compartment, such as a lysosome. In certain embodiments, a cleavable moiety is selectively cleaved by endogenous enzymes, such as nucleases.

In certain embodiments, a cleavable bond is selected from among: an amide, an ester, an ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, or a disulfide. In certain embodiments, a cleavable bond is one or both of the esters of a phosphodiester. In certain embodiments, a cleavable moiety comprises a phosphate or phosphodiester. In certain embodiments, the cleavable moiety is a phosphate or phosphodiester linkage between an oligonucleotide and a conjugate moiety or conjugate group.

In certain embodiments, a cleavable moiety comprises or consists of one or more linker-nucleosides. In certain such embodiments, one or more linker-nucleosides are linked to one another and/or to the remainder of the oligomeric compound through cleavable bonds. In certain embodiments, such cleavable bonds are unmodified phosphodiester bonds. In certain embodiments, a cleavable moiety is a nucleoside comprising a 2′-deoxyfuranosyl that is attached to either the 3′ or 5′-terminal nucleoside of an oligonucleotide by a phosphodiester internucleoside linkage and covalently attached to the remainder of the conjugate linker or conjugate moiety by a phosphodiester or phosphorothioate linkage. In certain such embodiments, the cleavable moiety is a nucleoside comprising a 2′β-D-deoxyribosyl sugar moiety. In certain such embodiments, the cleavable moiety is 2′-deoxyadenosine.

3. Certain Cell-Targeting Conjugate Moieties

In certain embodiments, a conjugate group comprises a cell-targeting conjugate moiety. In certain embodiments a conjugate group has the general formula:

wherein n is from 1 to about 3, m is 0 when n is 1, m is 1 when n is 2 or greater, j is 1 or 0, and k is 1 or 0.

In certain embodiments, n is 1, j is 1 and k is 0. In certain embodiments, n is 1, j is 0 and k is 1. In certain embodiments, n is 1, j is 1 and k is 1. In certain embodiments, n is 2, j is 1 and k is 0. In certain embodiments, n is 2, j is 0 and k is 1. In certain embodiments, n is 2, j is 1 and k is 1. In certain embodiments, n is 3, j is 1 and k is 0. In certain embodiments, n is 3, j is 0 and k is 1. In certain embodiments, n is 3, j is 1 and k is 1.

In certain embodiments, conjugate groups comprise cell-targeting moieties that have at least one tethered ligand. In certain embodiments, cell-targeting moieties comprise two tethered ligands covalently attached to a branching group. In certain embodiments, cell-targeting moieties comprise three tethered ligands covalently attached to a branching group.

In certain embodiments, the cell-targeting moiety comprises a branching group comprising one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether and hydroxylamino groups. In certain embodiments, the branching group comprises a branched aliphatic group comprising groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether and hydroxylamino groups. In certain such embodiments, the branched aliphatic group comprises groups selected from alkyl, amino, oxo, amide and ether groups. In certain such embodiments, the branched aliphatic group comprises groups selected from alkyl, amino and ether groups. In certain such embodiments, the branched aliphatic group comprises groups selected from alkyl and ether groups. In certain embodiments, the branching group comprises a mono or polycyclic ring system.

In certain embodiments, each tether of a cell-targeting moiety comprises one or more groups selected from alkyl, substituted alkyl, ether, thioether, disulfide, amino, oxo, amide, phosphodiester, and polyethylene glycol, in any combination. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl, ether, thioether, disulfide, amino, oxo, amide, and polyethylene glycol, in any combination. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl, phosphodiester, ether, amino, oxo, and amide, in any combination. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl, ether, amino, oxo, and amid, in any combination. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl, amino, and oxo, in any combination. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl and oxo, in any combination. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl and phosphodiester, in any combination. In certain embodiments, each tether comprises at least one phosphorus linking group or neutral linking group. In certain embodiments, each tether comprises a chain from about 6 to about 20 atoms in length. In certain embodiments, each tether comprises a chain from about 10 to about 18 atoms in length. In certain embodiments, each tether comprises about 10 atoms in chain length.

In certain embodiments, each ligand of a cell-targeting moiety has an affinity for at least one type of receptor on a target cell. In certain embodiments, each ligand has an affinity for at least one type of receptor on the surface of a mammalian lung cell.

In certain embodiments, each ligand of a cell-targeting moiety is a carbohydrate, carbohydrate derivative, modified carbohydrate, polysaccharide, modified polysaccharide, or polysaccharide derivative. In certain such embodiments, the conjugate group comprises a carbohydrate cluster (see, e.g., Maier et al., “Synthesis of Antisense Oligonucleotides Conjugated to a Multivalent Carbohydrate Cluster for Cellular Targeting,” Bioconjugate Chemistry, 2003, 14, 18-29, or Rensen et al., “Design and Synthesis of Novel N-Acetylgalactosamine-Terminated Glycolipids for Targeting of Lipoproteins to the Hepatic Asiaglycoprotein Receptor,” J Med. Chem. 2004, 47, 5798-5808, which are incorporated herein by reference in their entirety). In certain such embodiments, each ligand is an amino sugar or a thio sugar. For example, amino sugars may be selected from any number of compounds known in the art, such as sialic acid, α-D-galactosamine, β-muramic acid, 2-deoxy-2-methylamino-L-glucopyranose, 4,6-dideoxy-4-formamido-2,3-di-O-methyl-D-mannopyranose, 2-deoxy-2-sulfoamino-D-glucopyranose and N-sulfo-D-glucosamine, and N-glycoloyl-α-neuraminic acid. For example, thio sugars may be selected from 5-Thio-β-D-glucopyranose, methyl 2,3,4-tri-O-acetyl-1-thio-6-O-trityl-α-D-glucopyranoside, 4-thio-β-D-galactopyranose, and ethyl 3,4,6,7-tetra-O-acetyl-2-deoxy-1,5-dithio-α-D-gluco-heptopyranoside.

In certain embodiments, oligomeric compounds described herein comprise a conjugate group found in any of the following references: Lee, Carbohydr Res, 1978, 67, 509-514; Connolly et al., J Biol Chem, 1982, 257, 939-945; Pavia et al., Int J Pep Protein Res, 1983, 22, 539-548; Lee et al., Biochem, 1984, 23, 4255-4261; Lee et al., Glycoconjugate J, 1987, 4, 317-328; Toyokuni et al., Tetrahedron Lett, 1990, 31, 2673-2676; Biessen et al., J Med Chem, 1995, 38, 1538-1546; Valentijn et al., Tetrahedron, 1997, 53, 759-770; Kim et al., Tetrahedron Lett, 1997, 38, 3487-3490; Lee et al., Bioconjug Chem, 1997, 8, 762-765; Kato et al., Glycobiol, 2001, 11, 821-829; Rensen et al., J Biol Chem, 2001, 276, 37577-37584; Lee et al., Methods Enzymol, 2003, 362, 38-43; Westerlind et al., Glycoconj J, 2004, 21, 227-241; Lee et al., Bioorg Med Chem Lett, 2006, 16(19), 5132-5135; Maierhofer et al., Bioorg Med Chem, 2007, 15, 7661-7676; Khorev et al., Bioorg Med Chem, 2008, 16, 5216-5231; Lee et al., Bioorg Med Chem, 2011, 19, 2494-2500; Kornilova et al., Analyt Biochem, 2012, 425, 43-46; Pujol et al., Angew Chemie Int Ed Engl, 2012, 51, 7445-7448; Biessen et al., J Med Chem, 1995, 38, 1846-1852; Sliedregt et al., J Med Chem, 1999, 42, 609-618; Rensen et al., J Med Chem, 2004, 47, 5798-5808; Rensen et al., Arterioscler Thromb Vasc Biol, 2006, 26, 169-175; van Rossenberg et al., Gene Ther, 2004, 11, 457-464; Sato et al., J Am Chem Soc, 2004, 126, 14013-14022; Lee et al., J Org Chem, 2012, 77, 7564-7571; Biessen et al., FASEB J, 2000, 14, 1784-1792; Rajur et al., Bioconjug Chem, 1997, 8, 935-940; Duff et al., Methods Enzymol, 2000, 313, 297-321; Maier et al., Bioconjug Chem, 2003, 14, 18-29; Jayaprakash et al., Org Lett, 2010, 12, 5410-5413; Manoharan, Antisense Nucleic Acid Drug Dev, 2002, 12, 103-128; Merwin et al., Bioconjug Chem, 1994, 5, 612-620; Tomiya et al., Bioorg Med Chem, 2013, 21, 5275-5281; International applications WO1998/013381; WO2011/038356; WO1997/046098; WO2008/098788; WO2004/101619; WO2012/037254; WO2011/120053; WO2011/100131; WO2011/163121; WO2012/177947; WO2013/033230; WO2013/075035; WO2012/083185; WO2012/083046; WO2009/082607; WO2009/134487; WO2010/144740; WO2010/148013; WO1997/020563; WO2010/088537; WO2002/043771; WO2010/129709; WO2012/068187; WO2009/126933; WO2004/024757; WO2010/054406; WO2012/089352; WO2012/089602; WO2013/166121; WO2013/165816; U.S. Pat. Nos. 4,751,219; 8,552,163; 6,908,903; 7,262,177; 5,994,517; 6,300,319; 8,106,022; 7,491,805; 7,491,805; 7,582,744; 8,137,695; 6,383,812; 6,525,031; 6,660,720; 7,723,509; 8,541,548; 8,344,125; 8,313,772; 8,349,308; 8,450,467; 8,501,930; 8,158,601; 7,262,177; 6,906,182; 6,620,916; 8,435,491; 8,404,862; 7,851,615; Published U.S. Patent Application Publications US2011/0097264; US2011/0097265; US2013/0004427; US2005/0164235; US2006/0148740; US2008/0281044; US2010/0240730; US2003/0119724; US2006/0183886; US2008/0206869; US2011/0269814; US2009/0286973; US2011/0207799; US2012/0136042; US2012/0165393; US2008/0281041; US2009/0203135; US2012/0035115; US2012/0095075; US2012/0101148; US2012/0128760; US2012/0157509; US2012/0230938; US2013/0109817; US2013/0121954; US2013/0178512; US2013/0236968; US2011/0123520; US2003/0077829; US2008/0108801; and US2009/0203132.

Compositions and Methods for Formulating Pharmaceutical Compositions

Oligomeric compounds described herein may be admixed with pharmaceutically acceptable active or inert substances for the preparation of pharmaceutical compositions. Compositions and methods for the formulation of pharmaceutical compositions are dependent upon a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.

Certain embodiments provide pharmaceutical compositions comprising one or more oligomeric compounds or a salt thereof. In certain embodiments, the oligomeric compounds comprise or consist of a modified oligonucleotide. In certain such embodiments, the pharmaceutical composition comprises a suitable pharmaceutically acceptable diluent or carrier. In certain embodiments, a pharmaceutical composition comprises a sterile saline solution and one or more oligomeric compound. In certain embodiments, such pharmaceutical composition consists of a sterile saline solution and one or more oligomeric compound. In certain embodiments, the sterile saline is pharmaceutical grade saline. In certain embodiments, a pharmaceutical composition comprises one or more oligomeric compound and sterile water. In certain embodiments, a pharmaceutical composition consists of one oligomeric compound and sterile water. In certain embodiments, the sterile water is pharmaceutical grade water. In certain embodiments, a pharmaceutical composition comprises or consists of one or more oligomeric compound and phosphate-buffered saline (PBS). In certain embodiments, a pharmaceutical composition consists of one or more oligomeric compound and sterile PBS. In certain embodiments, the sterile PBS is pharmaceutical grade PBS. Compositions and methods for the formulation of pharmaceutical compositions are dependent upon a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.

An oligomeric compound described herein complementary to a target nucleic acid can be utilized in pharmaceutical compositions by combining the oligomeric compound with a suitable pharmaceutically acceptable diluent or carrier and/or additional components such that the pharmaceutical composition is suitable for injection. In certain embodiments, a pharmaceutically acceptable diluent is phosphate buffered saline. Accordingly, in one embodiment, employed in the methods described herein is a pharmaceutical composition comprising an oligomeric compound complementary to a target nucleic acid and a pharmaceutically acceptable diluent. In certain embodiments, the pharmaceutically acceptable diluent is phosphate buffered saline. In certain embodiments, the oligomeric compound comprises or consists of a modified oligonucleotide provided herein.

Pharmaceutical compositions comprising oligomeric compounds provided herein encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other oligonucleotide which, upon administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. In certain embodiments, the oligomeric compound comprises or consists of a modified oligonucleotide. Accordingly, for example, the disclosure is also drawn to pharmaceutically acceptable salts of compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.

Certain Mechanisms

In certain embodiments, oligomeric compounds described herein comprise or consist of modified oligonucleotides. In certain such embodiments, the oligomeric compounds described herein are capable of hybridizing to a target nucleic acid, resulting in at least one antisense activity. In certain embodiments, compounds described herein selectively affect one or more target nucleic acid. Such compounds comprise a nucleobase sequence that hybridizes to one or more target nucleic acid, resulting in one or more desired antisense activity and does not hybridize to one or more non-target nucleic acid or does not hybridize to one or more non-target nucleic acid in such a way that results in a significant undesired antisense activity.

In certain antisense activities, hybridization of a compound described herein to a target nucleic acid results in recruitment of a protein that cleaves the target nucleic acid. For example, certain compounds described herein result in RNase H mediated cleavage of the target nucleic acid. RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. The DNA in such an RNA:DNA duplex need not be unmodified DNA. In certain embodiments, compounds described herein are sufficiently “DNA-like” to elicit RNase H activity. Nucleosides that are sufficiently “DNA-like” to elicit RNase H activity are referred to as DNA mimics herein. Further, in certain embodiments, one or more non-DNA-like nucleoside in in the RNA:DNA duplex is tolerated.

In certain antisense activities, compounds described herein or a portion of the compound is loaded into an RNA-induced silencing complex (RISC), ultimately resulting in cleavage of the target nucleic acid. For example, certain compounds described herein result in cleavage of the target nucleic acid by Argonaute. Compounds that are loaded into RISC are RNAi compounds. RNAi compounds may be double-stranded (siRNA) or single-stranded (ssRNA).

Antisense activities may be observed directly or indirectly. In certain embodiments, observation or detection of an antisense activity involves observation or detection of a change in an amount of a target nucleic acid or protein encoded by such target nucleic acid, a change in the ratio of splice variants of a nucleic acid or protein, and/or a phenotypic change in a cell or animal.

Certain Toxicities

For a compound to be a viable therapeutic agent, it must be safe at therapeutically relevant doses. It has become clear that toxicity of oligonucleotides can arise from one or more of several mechanisms. For example, some oligonucleotides hybridize an unintended RNA (or “off-target RNA”) resulting in reduction of the off-target RNA and the protein encoded by that off-target RNA. Such unintended protein reduction may have toxic consequences. The data disclosed herein demonstrate that toxicity can result from oligonucleotides binding certain proteins and subsequent sub-cellular localization of the oligonucleotide/protein complex. Other mechanisms of toxicity may also contribute. Of course, for an oligonucleotide to be a suitable drug for use in therapy, all of the forms or mechanisms of toxicity must be acceptably low.

Since toxicity can result from multiple mechanisms, the observed toxicity for a particular compound will typically be the most toxic mechanism or the mechanism that results in toxicity at the lowest dose for that particular compound (the “limiting toxicity”). Changes to a compound that reduce the limiting toxicity will result in a compound having an observable improvement in toxic profile. Changes that reduce a form of toxicity that is not the limiting toxicity may not result in an observable improvement in toxicity, because the improvement may be masked by the limiting toxicity. In such instances, the improvement to a non-limiting toxicity can nonetheless have value. For example, the limiting toxicity might be controlled through additional changes to the compound or through changes in dose or dose frequency or through use of a separate therapy that mitigates the limiting toxicity; at that point, a previously masked toxicity would become limiting. Alternatively, in certain circumstances, the limiting toxicity might be less relevant (for example, if the drug is intended for delivery to specific tissues not affected by the limiting toxicity or if the compound is for the treatment of severe or life-threatening indications where a certain degree of the limiting toxicity may be acceptable). In such instances, improvements to a non-limiting toxicity can have significant benefit. Further, the various forms and mechanisms of toxicity may have a cumulative effect, particularly over time. Accordingly, the beneficial effects of improvements to a particular mechanism of toxicity might be masked at an early time point where another mechanism is the limiting toxicity, but over time such masked toxicity may contribute or even predominate the overall safety profile.

In certain embodiments, oligomeric compounds of the invention have improved toxicity profiles compared to standard gapmer compounds having a gap comprising only nucleosides having 2′-β-D-deoxyribosyl sugar moieties and the same nucleobase sequence. It should be noted that some standard gapmers are suitable therapeutic agents. Toxicity is driven in part by nucleobase sequence (oligonucleotides having identical chemical modification patterns but different sequences can have vastly different safety profiles). When one attempts to modulate a particular target RNA, one might find an antisense oligonucleotide that has an acceptable safety profile at therapeutic doses. On other occasions, however, the most active/potent oligonucleotides have unacceptable toxicity. In such instances, it is desirable to modify such compounds to reduce their toxicity, ideally with no loss or only modest loss in activity/potency. In certain embodiments, modification motifs described herein reduce toxicity with little or no loss in activity/potency.

Without limitation to any particular mechanism, it is believed that certain modification motifs described herein may reduce interactions between an oligomeric compound and certain proteins. In certain embodiments, such interactions result in the limiting toxicity and so disruption of these interactions results in observable improvements in the toxicity profile. In certain embodiments, the motifs described herein may alter off-target cleavage. In certain embodiments, the disclosed motifs improve toxicity through an undefined mechanism. In certain embodiments, the motifs may improve toxicity through multiple mechanisms, including, but not limited to those described here.

Disclosed herein for comparison are certain gapmer oligonucleotides that are notably more toxic than other gapmers. These toxic gapmer oligonucleotides cause rapid delocalization of paraspeckle proteins, including p54nrb, to nucleoli, possibly due to the binding of these toxic oligonucleotides to the p54nrb protein and/or other paraspeckle proteins. Certain such toxic oligonucleotides have both more global protein binding than their nontoxic (or less toxic) counterparts and have higher binding affinities (i.e., lower Kd values) for key paraspeckle proteins, including p54nrb and RNase H1. Certain such toxic oligonucleotides, but not nontoxic (or less toxic) oligonucleotides, cause the paraspeckle proteins PSF, PSPC1, and FUS to localize to the nucleoli as well, as observed across a number of mouse and human cell types. In certain instances, the nucleolar delocalization of paraspeckle proteins is mediated by RNase H1. Importantly, in some instances, nontoxic (or less toxic) modified oligonucleotides with the same chemical modification pattern (gapmer motif) and a different sequence do not cause the delocalization of p54nrb to nucleoli. This early event leads to nucleolar stress, p53 activation, and apoptotic cell death, both in vitro across a number of mammalian cell types and in vivo in mice. These results were consistent for gapmers with toxic sequences and containing several different commonly-used chemical modifications of modified oligonucleotides, including LNA, cEt, and 2′-MOE.

In certain embodiments, the instant invention is directed towards modified oligonucleotides having chemical modifications that can alleviate the observed toxicity. In certain embodiments, such toxicity is related to protein binding and the resulting nucleolar mislocalization of proteins, such as paraspeckle proteins described above. In certain embodiments, the incorporation of a safety-enhancing nucleoside at position 2, 3 or 4 of the central region (or “gap”) of the modified oligonucleotide can reduce both global protein binding and the associated toxicity. In certain embodiments, the safety-enhancing nucleoside is a nucleoside comprising a 2′-OMe β-D-deoxyribosyl sugar moiety at position 2 of the central region. Incorporation of a nucleoside comprising a 2′-OMe-β-D-deoxyribosyl sugar moiety at position 2 of the central region in a toxic 3-10-3, 3-10-4, 4-10-3 cEt gapmer, a 3-10-3 LNA gapmer, a 5-10-5 MOE gapmer, or several cEt/MOE mixed wing gapmers reduced cellular toxicity and apoptosis in vitro and hepatoxicity in vivo across a wide variety of sequences, while having only a modest effect, if any, on antisense activity. In certain embodiments, incorporation of a nucleoside comprising a 2′-OMe-β-D-deoxyribosyl sugar moiety at position 2 of the central region also reduced delayed neurotoxicity, suggesting a common mechanism for delayed neurotoxicity and hepatoxicity. In certain embodiments, the safety-enhancing nucleoside is a nucleoside comprising a 5′-alkyl or 5′-allyl modified β-D-deoxyribosyl sugar moiety at position 3 or position 4 of the central region. In certain instances, incorporation of a nucleoside comprising a 5′-alkyl β-D-deoxyribosyl sugar moiety at position 3 or position 4 of the central region of a 3-10-3 cEt gapmer reduces cellular toxicity and apoptosis in vitro and hepatoxicity in vivo across a variety of sequences, while having a modest effect, if any, on antisense activity. In certain embodiments, the incorporation of a safety-enhancing internucleoside linkage between the nucleosides at positions 2-3 or positions 3-4 of the central region can reduce toxicity. In certain embodiments, one or more of a safety-enhancing linkages linking the nucleosides from positions 2-4 of the central region is a neutral linkage. In certain embodiments, one or more of a safety-enhancing linkages linking the nucleosides from positions 2-4 of the central region is a 2′-5′ internucleoside linkage. The instant invention extends to any chemical modification introduced at positions 2, 3 or 4 of the central region, including modifications to nucleosides and to internucleoside linkages. In certain embodiments, such modification reduces in vitro toxicity (compared to the modified oligonucleotide lacking the safety enhancing nucleoside at positions 2, 3 or 4 of the central region or lacking the safety enhancing internucleoside linkage between positions 2-3 or 3-4 of the central region) as measured by the caspase 3/7 assay and/or in vivo hepatotoxicity, as measured by ALT or AST, and/or in vivo neurotoxicity, as measured by an FOB score or accumulation of markers of glial inflammation, Aifl and GFAP.

In certain embodiments, introducing chemical modifications at positions 2, 3 or 4 of the central region can significantly reduce toxicity with only a modest loss in potency, if any. This leads to an improvement in therapeutic index for a given target sequence. In certain cases, such improvements in therapeutic index are large enough to allow further drug development based on a compound targeted to a previously-toxic (but potent) sequence.

Target Nucleic Acids, Target Regions and Nucleotide Sequences

In certain embodiments, compounds described herein comprise or consist of an oligonucleotide comprising a region that is complementary to a target nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In certain embodiments, the target nucleic acid encodes a protein. In certain such embodiments, the target nucleic acid is selected from: an mRNA and a pre-mRNA, including intronic, exonic and untranslated regions. In certain embodiments, the target RNA is an mRNA. In certain embodiments, the target nucleic acid is a pre-mRNA. In certain embodiments, a pre-mRNA and corresponding mRNA are both target nucleic acids of a single compound. In certain such embodiments, the target region is entirely within an intron of a target pre-mRNA. In certain embodiments, the target region spans an intron/exon junction. In certain embodiments, the target region is at least 50% within an intron.

Certain Compounds Having Central Region Modifications

In certain embodiments, the oligomeric compounds herein comprise a gapmer comprising one or more an altered nucleotides in the central region of the gapmer. Each of such oligomeric compounds has a corresponding parent oligomeric compound that is identical to the first oligomeric compound except that is lacking the one or more altered nucleotides in the central region of the gapmer. Examples of such parent oligomeric compounds and their corresponding identical oligomeric compounds lacking the altered nucleotide are found in Tables 1 and 2 of Example 1 as well as throughout the Examples section. In Example 1, 558807 is the parent oligonucleotide. In certain embodiments, the central region of a parent oligomeric compound comprises only phosphodiester and/or phosphorothioate internucleoside linkages, unmodified nucleobases and/or 5-methylcytosine, and unmodified, 2′β-D-deoxyribosyl sugar moieties.

In certain embodiments, the present disclosure provides oligomeric compounds that comprise a gapmer comprising one or more altered nucleotides in the central region of the gapmer that have an increased therapeutic index an/or increased tolerability compared to the corresponding parent oligomeric compounds. In certain such embodiments, the modification or modifications of the central region of the oligomeric compounds with increased therapeutic index and/or increased tolerability are particularly useful in providing oligomeric compounds having reduced toxicity without significantly altering the potency. The modifications in the central region described herein can be at any position in the central region, and examples of embodiments comprising modifications at such positions are disclosed in the numbered embodiments and Examples. In certain embodiments, the altered nucleotide is an altered nucleoside attached to a phosphorothioate or phosphodiester internucleoside linkage. In a preferred embodiment, the altered nucleotide is at positions 1-4 of the central region of the modified oligonucleotide. In another preferred embodiment, the altered nucleotide comprises a nucleoside comprising a 2′-modified sugar moiety at position 2 of the central region of the modified oligonucleotide. In another preferred embodiment, the altered nucleotide comprises a nucleoside comprising a 5′-modified sugar moiety at positions 3 or 4 of the central region of the modified oligonucleotide. In another preferred embodiment, the altered nucleotide comprises a neutral internucleoside linkage between positions 2-3 or positions 3-4 of the central region of the modified oligonucleotide.

Certain compounds described herein (e.g., modified oligonucleotides) have one or more asymmetric center and thus give rise to enantiomers, diastereomers, and other stereoisomeric configurations that may be defined, in terms of absolute stereochemistry, as (R) or (S), as α or β such as for sugar anomers, or as (D) or (L), such as for amino acids, etc. Compounds provided herein that are drawn or described as having certain stereoisomeric configurations include only the indicated compounds. Compounds provided herein that are drawn or described with undefined stereochemistry include all such possible isomers, including their stereorandom and optically pure forms. All tautomeric forms of the compounds provided herein are included unless otherwise indicated.

The compounds described herein include variations in which one or more atoms are replaced with a non-radioactive isotope or radioactive isotope of the indicated element. For example, compounds herein that comprise hydrogen atoms encompass all possible deuterium substitutions for each of the 1 H hydrogen atoms. Isotopic substitutions encompassed by the compounds herein include but are not limited to: 2 H or 3 H in place of 1 H, 13 C or 14 C in place of 12 C, 15 N in place of 14 N, 17 O or 18 O in place of 16 O, and 33 S, 34 S, 35 S, or 36 S in place of 32 S. In certain embodiments, non-radioactive isotopic substitutions may impart new properties on the oligomeric compound that are beneficial for use as a therapeutic or research tool. In certain embodiments, radioactive isotopic substitutions may make the compound suitable for research or diagnostic purposes such as imaging.

Non-Limiting Disclosure and Incorporation by Reference

Although the sequence listing accompanying this filing identifies each sequence as either “RNA” or “DNA” as required, in reality, those sequences may be modified with any combination of chemical modifications. One of skill in the art will readily appreciate that such designation as “RNA” or “DNA” to describe modified oligonucleotides is, in certain instances, arbitrary. For example, an oligonucleotide comprising a nucleoside comprising a 2′-OH sugar moiety and a thymine nucleobase could be described as a DNA having an RNA sugar, or as an RNA having a DNA nucleobase.

Accordingly, nucleic acid sequences provided herein, including, but not limited to those in the sequence listing, are intended to encompass nucleic acids containing any combination of unmodified or modified RNA and/or DNA, including, but not limited to such nucleic acids having modified nucleobases. By way of further example and without limitation, an oligonucleotide having the nucleobase sequence “ATCGATCG” encompasses any oligonucleotides having such nucleobase sequence, whether modified or unmodified, including, but not limited to, such compounds comprising RNA bases, such as those having sequence “AUCGAUCG” and those having some DNA bases and some RNA bases such as “AUCGATCG” and compounds having other modified nucleobases, such as “AT m CGAUCG,” wherein m C indicates a cytosine base comprising a methyl group at the 5-position. In certain cases, compounds comprising a uridine nucleobase and a 2′-OMe sugar moiety are compared to compounds comprising a thymidine nucleobase with a 2′β-D-deoxyribosyl sugar moiety at the same position. While these compounds have different SEQ ID NO:, they are not considered distinct sequences, and they have identical target RNA. In certain cases, compounds comprising a cytosine nucleobase and a 2′-OMe sugar moiety are compared to compounds comprising a 5-methylcytosine nucleobase and a 2′β-D-deoxyribosyl sugar moiety at the same position.

In the Examples below, modified oligonucleotides are represented by a chemistry notation, always shown in the 5′-to-3′ direction, of the format B sl B sl m B s , where “B” or “ m B” represents the nucleobase, with a superscript “m” before “B” representing a 5-methyl modification, the subscript in position “s” represents the sugar moiety, and the subscript in position “1” represents the 5′-to-3′ internucleoside linkage.

While certain compounds, compositions and methods described herein have been described with specificity in accordance with certain embodiments, the following examples serve only to illustrate the compounds described herein and are not intended to limit the same. Each of the references recited in the present application is incorporated herein by reference in its entirety.

Example 1 Effect of Position-Specific 2′-Modifications on In Vitro Activity and In Vivo Liver Toxicity of Modified Oligonucleotides Complementary to CXCL12

Modified oligonucleotides were synthesized with kkk-x-d(9)-kkk, kkk-d-x-d(8)-kkk, kkk-dd-x-d(7)-kkk or kkk-d(3)-x-d(6)-kkk sugar motifs, respectively, where “x” represents a sugar moiety having the modification indicated in the table below, “k” represents a cEt, and “d” represents an unmodified, 2′-β-D-deoxyribosyl sugar moiety. These modified oligonucleotides were compared to the otherwise identical modified oligonucleotide lacking an altered nucleotide in the central region, a 3-10-3 cEt gapmer, having three cEt nucleosides in each of the 5′ and 3′ regions and 10 DNA nucleosides in the central region. Each internucleoside linkage is a phosphorothioate. The compounds in the table below are 100% complementary to mouse CXCL12, GENBANK NT_039353.7 truncated from 69/430,515 to 69/445,350 (SEQ ID NO: 1), at position 6877 to 6892.

For in vitro activity studies, approximately 20,000 mouse 3T3-L1 cells were electroporated with 0, 27 nM, 82 nM, 247 nM, 740 nM, 2,220 nM, 6,660 nM or 20,000 nM antisense oligonucleotide. mRNA was harvested and analyzed by RT-qPCR. CXCL12 mRNA was detected with primer probe set RTS2605 (forward sequence CCAGAGCCAACGTCAAGCAT, SEQ ID NO: 9; reverse sequence: CAGCCGTGCAACAATCTGAA, SEQ ID NO: 10; probe sequence: TGAAAATCCTCAACACTCCAAACTGTGCC, SEQ ID NO: 11) and RAPTOR mRNA was detected with primer probe set RTS3420 (forward sequence GCCCTCAGAAAGCTCTGGAA, SEQ ID NO: 12; reverse sequence: TAGGGTCGAGGCTCTGCTTGT, SEQ ID NO: 13; probe sequence: CCATCGGTGCAAACCTACAGAAGCAGTATG, SEQ ID NO: 14). RAPTOR is a sentinel gene that can be indicative of toxicity, as described in US 20160160280, hereby incorporated by reference.

For acute in vivo toxicity studies, three BALB/C mice per group were administered 150 mg/kg modified oligonucleotide by subcutaneous injection and sacrificed 72 hours later. Three mice were administered an injection of saline as a control. Plasma levels of ALT were measured using an automated clinical chemistry analyzer. Increased ALT is indicative of acute liver toxicity.

For the in vitro study reported in the tables below, 3T3-L1 cells were electroporated with 27 nM, 80 nM, 250 nM, 740 nM, 2, 222 nM, 6,667 nM, or 20,000 nM of modified oligonucleotide and levels of P21 and Gadd45a were measured by RT-qPCR. Levels of Gadd45a were analyzed using primer probe set Mm00432802_ml (ThermoFisher). Levels of P21 were analyzed using primer probe set Mm04207341_ml (ThermoFisher).

For the in vitro study reported in the tables below, b.END cells were electroporated with 27 nM, 80 nM, 250 nM, 740 nM, 2, 222 nM, 6,667 nM, or 20,000 nM of modified oligonucleotide and levels of P21 were measured by RT-qPCR using primer probe set Mm04207341_ml (ThermoFisher).

For the in vivo activity and toxicity study in the table below, 2 or 3 BALB/C mice per group were administered modified oligonucleotide at 1.8 mg/kg, 5.5 mg/kg, or 16.7 mg/kg by subcutaneous injection and sacrificed after 72 hours.

For in vivo activity and toxicity study in the table below, 3 BALB/C mice per group were administered modified oligonucleotide by subcutaneous injection and sacrificed after 72 hours. Compound 558807 was dosed at 1.8, 5.5, or 16.7 mg/kg, compounds 828911, 936052 and 936053 were dosed at 1.8, 5.5, 16.7 and 50 mg/kg, and compounds 1061315 and 1070041 were dosed at 1.8, 5.5, 16.7, 50 or 150 mg/kg. Tissue were collected and mRNA was isolated and levels of CXCL12 were measured by RT-qPCR with primer probe set RTS2605 as described above. Levels of Gadd45a were analyzed using primer probe set Mm00432802 ml (ThermoFisher). Levels of P21 were analyzed using primer probe set Mm04207341_ml (ThermoFisher). Levels of Tnfrsf10b were analyzed using primer probe set Mm00457866_ml (ThermoFisher). Expression levels were normalized with Ribogreen® and are presented relative to levels in mice treated with PBS.

For the in vivo activity study in the tables below, 3 BALB/C mice per group were administered 3.37, 11, 33, or 100 mg/kg doses of modified oligonucleotide, as indicated in the table below, by subcutaneous injection and sacrificed 72 hours later. Liver mRNA was isolated an analyzed by RT-PCR as described in above. Expression levels were normalized with Ribogreen® and are expressed relative to PBS-treated control mice.

Example 2 Effect of Position-Specific 5′-Modifications on In Vitro Activity and In Vivo Liver Toxicity of Modified Oligonucleotides Complementary CXCL12

Modified oligonucleotides containing 5′-methyl, 5′-allyl, and 5′-ethyl modifications at various positions were synthesized. Procedures for the synthesis of 5′-methyl and 5′-allyl analogs are detailed in WO2013022967. Procedures for the synthesis of 5′-ethyl analogs are detailed herein below in Example 39. These modified oligonucleotides were compared to the otherwise identical modified oligonucleotide lacking a modified nucleoside in the central region, a 3-10-3 cEt modified oligonucleotide, containing three cEt nucleosides in each of the 5′ and 3′ regions and 10 unmodified DNA nucleobases in the central region. The compounds in the table below are 100% complementary to mouse CXCL12, GENBANK NT_039353.7 truncated from 69/430,515 to 69/445,350 (SEQ ID NO: 1), at position 6877 to 6892.

Experimental Procedures & Results

In vitro activity and in vivo activity and toxicity experiments were performed essentially as described in Example 1. For in vivo toxicity studies, a single BALB/C mouse per modified oligonucleotide was administered 150 mg/kg modified oligonucleotide by subcutaneous injection and sacrificed 72 hours later. For the in vivo activity study in the table below, 2 BALB/C mice per group were administered 1.8 mg/kg, 5.5 mg/kg, 16.7 mg/kg, 50 mg/kg dose of modified oligonucleotide subcutaneously and sacrificed after 72 hours. For 558807, only 1.8 mg/kg, 5.5 mg/kg, and 16.7 mg/kg doses were tested for dose response, due to acute toxicity of higher doses. Tissues were collected and liver mRNA was isolated and levels of CXCL12 were measured by RT-qPCR with primer probe set RTS2605 as described above.

For the in vivo activity and toxicity study reported in the table below, 2 BALB/C mice per group were administered 5 mg/kg or 150 mg/kg modified oligonucleotide subcutaneously and sacrificed 72 hours later. Plasma levels of ALT were measured and liver mRNA was analyzed for target reduction as in example 1 above.

For the results in the tables below, in vivo activity and toxicity experiments were performed essentially as described in Example 1. For in vivo toxicity studies, two BALB/C mice per group was administered 50 or 150 mg/kg modified oligonucleotide by subcutaneous injection and sacrificed 72 hours later. One animal was administered an injection of saline as a control. Plasma levels of ALT were measured using an automated clinical chemistry analyzer.

For the in vivo activity study in the tables below, 2 BALB/C mice per group were administered 1.8 mg/kg, 5.5 mg/kg, 16.7 mg/kg, 50 mg/kg, or 150 mg/kg doses of modified oligonucleotide, as indicated in the table below, by subcutaneous injection and sacrificed 72 hours later. For 558807, only 1.8 mg/kg, 5.5 mg/kg, and 16.7 mg/kg doses were tested for dose response, due to acute toxicity of higher doses. Liver mRNA was isolated an analyzed by RT-PCR as described in Example 1 above. Expression levels were normalized with Ribogreen® and are expressed relative to PBS-treated control mice.

Example 3 Effect of Position-Specific 2′-Modifications on In Vitro Activity and In Vivo Liver Toxicity of Modified Oligonucleotides Complementary to Factor XI

Modified oligonucleotides were synthesized as indicated in the table below, comprising an altered nucleotide at positions 1-3 of the central region. These modified oligonucleotides were compared to the otherwise identical modified oligonucleotide lacking an altered nucleotide in the central region, a 3-10-3 cEt gapmer, containing three cEt nucleosides in each of the 5′ and 3′ regions and 10 unmodified DNA nucleosides in the central region. Each internucleoside linkage is a phosphorothioate internucleoside linkage. The compounds in the table below are 100% complementary to the complement of mouse Factor XI, GENBANK NT_039460.6 truncated from 6086000 to 6111000 (SEQ ID NO: 2), at position 11699 to 11714.

Experimental Procedures & Results

For in vitro toxicity studies, 3T3-L1 cells were electroporated with 27, 80, 250, 740, 2, 222, 6, 667, or 20,000 nM of modified oligonucleotide and levels of Raptor were measured by RT-qPCR as in Example 1.

For in vivo toxicity studies, two BALB/C mice per group were administered 100 mg/kg modified oligonucleotide by subcutaneous injection and sacrificed 72 hours later. One animal was administered an injection of saline as a control. Plasma levels of ALT were measured using an automated clinical chemistry analyzer. Increased ALT is indicative of acute liver toxicity.

For the in vitro study reported in the tables below, 3T3-L1 cells were electroporated with 27, 80, 250, 740, 2, 222, 6, 667, or 20,000 nM of modified oligonucleotide and levels of P21 and Gadd45a were measured by RT-qPCR. Levels of Gadd45a were analyzed using primer probe set Mm00432802 ml (ThermoFisher). Levels of P21 were analyzed using primer probe set Mm04207341_ml (ThermoFisher).

For the in vitro study reported in the tables below, b.END cells were electroporated with 27, 80, 250, 740, 2, 222, 6, 667, or 20,000 nM of modified oligonucleotide and levels of P21 and Gadd45a were measured by RT-qPCR. Levels of Gadd45a were analyzed using primer probe set Mm00432802 ml (ThermoFisher). Levels of P21 were analyzed using primer probe set Mm04207341_ml (ThermoFisher).

For the in vivo activity study in the tables below, 3 BALB/C mice per group were administered 3.37, 11, 33, or 100 mg/kg doses of modified oligonucleotide, as indicated in the table below, by subcutaneous injection and sacrificed 72 hours later. Liver mRNA was isolated an analyzed by RT-PCR as described in Example 1 above. Expression levels were normalized with Ribogreen® and are expressed relative to PBS-treated control mice.

Example 4 Effect of Position-Specific 2′ and 5′-Modifications on In Vivo Activity and Liver Toxicity of Modified Oligonucleotides Complementary to Factor XI

Modified oligonucleotides were synthesized with 2′ or 5′ modifications as indicated in the table below. These modified oligonucleotides were compared to the otherwise identical modified oligonucleotide lacking a modified nucleoside in the central region, a 3-10-3 cEt modified oligonucleotide, containing three cEt nucleosides in each of the 5′ and 3′ regions and 10 unmodified DNA nucleobases in the central region. The compounds in the table below are 100% complementary to mouse Factor XI, the complement of GENBANK NT_039460.6 truncated from 6086000 to 6111000 (SEQ ID