Provided herein are compounds of Formula (I): [structure] and forms thereof, including compositions thereof and uses therewith for treating spinal muscular atrophy.

Description

121 parts

›CROSS-REFERENCE

This application is a U.S. national stage application of International Patent Application No. PCT/US2013/025292, filed Feb. 8, 2013, which claims the benefit of priority to U.S. Provisional Application Ser. No. 61/597,523, filed Feb. 10, 2012, which is incorporated herein by reference in its entirety and for all purposes.

The technology described herein has not been made with U.S. Government support.

›STATEMENT ON JOINT RESEARCH AGREEMENT

The subject matter disclosed was developed and the claimed invention was made by, or on behalf of, one or more parties to a joint research agreement that was in effect on or before the effective filing date of the claimed invention;

the claimed invention was made as a result of activities undertaken within the scope of the joint research agreement; and

the application for patent for the claimed invention discloses or is amended to disclose the names of the parties to the joint research agreement. The parties of the joint research agreement are PTC Therapeutics, Inc. and F. Hoffmann-La Roche AG.

›INTRODUCTION

Provided herein are compounds, compositions thereof and uses therewith for treating Spinal Muscular Atrophy.

›BACKGROUND · 1 of 2

Spinal muscular atrophy (SMA), in its broadest sense, describes a collection of inherited and acquired central nervous system (CNS) diseases characterized by progressive motor neuron loss in the spinal cord and brainstem causing muscle weakness and muscle atrophy. The most common form of SMA is caused by mutations in the Survival Motor Neuron (SMN) gene and manifests over a wide range of severity affecting infants through adults (Crawford and Pardo, Neurobiol. Dis., 1996, 3:97).

Infantile SMA is the most severe form of this neurodegenerative disorder. Symptoms include muscle weakness, poor muscle tone, weak cry, limpness or a tendency to flop, difficulty sucking or swallowing, accumulation of secretions in the lungs or throat, feeding difficulties, and increased susceptibility to respiratory tract infections. The legs tend to be weaker than the arms and developmental milestones, such as lifting the head or sitting up, cannot be reached. In general, the earlier the symptoms appear, the shorter the lifespan. As the motor neuron cells deteriorate, symptoms appear shortly afterward. The severe forms of the disease are fatal and all forms have no known cure. The course of SMA is directly related to the rate of motor neuron cell deterioration and the resulting severity of weakness. Infants with a severe form of SMA frequently succumb to respiratory disease due to weakness in the muscles that support breathing. Children with milder forms of SMA live much longer, although they may need extensive medical support, especially those at the more severe end of the spectrum. The clinical spectrum of SMA disorders has been divided into the following five groups.

(a) Type 0 SMA (In Utero SMA) is the most severe form of the disease and begins before birth. Usually, the first symptom of Type 0 SMA is reduced movement of the fetus that can first be observed between 30 and 36 weeks of pregnancy. After birth, these newborns have little movement and have difficulties with swallowing and breathing.

(b) Type 1 SMA (Infantile SMA or Werdnig-Hoffmann disease) typically presents symptoms between 0 and 6 months. This form of SMA is also very severe. Patients never achieve the ability to sit, and death usually occurs within the first 2 years without ventilatory support.

(c) Type 2 SMA (Intermediate SMA) has an age of onset at 7-18 months. Patients achieve the ability to sit unsupported, but never stand or walk unaided. Prognosis in this group is largely dependent on the degree of respiratory involvement.

(d) Type 3 SMA (Juvenile SMA or Kugelberg-Welander disease) is generally diagnosed after 18 months. Type 3 SMA individuals are able to walk independently at some point during their disease course but often become wheelchair-bound during youth or adulthood.

(e) Type 4 SMA (Adult onset SMA). Weakness usually begins in late adolescence in the tongue, hands, or feet, then progresses to other areas of the body. The course of adult SMA is much slower and has little or no impact on life expectancy.

The SMN gene has been mapped by linkage analysis to a complex region in chromosome 5q. In humans, this region contains an approximately 500 thousand base pairs (kb) inverted duplication resulting in two nearly identical copies of the SMN gene. SMA is caused by an inactivating mutation or deletion of the telomeric copy of the gene (SMN1) in both chromosomes, resulting in the loss of SMN1 gene function. However, all patients retain the centromeric copy of the gene (SMN2), and the copy number of the SMN2 gene in SMA patients generally correlates inversely with the disease severity; i.e., patients with less severe SMA have more copies of SMN2. Nevertheless, SMN2 is unable to compensate completely for the loss of SMN1 function due to alternative splicing of exon 7 caused by a translationally silent C to T mutation in exon 7. As a result, the majority of transcripts produced from SMN2 lack exon 7 (SMN2 Δ7), and encode a truncated Smn protein that has an impaired function and is rapidly degraded.

The Smn protein is thought to play a role in RNA processing and metabolism, having a well characterized function of mediating the assembly of a specific class of RNA-protein complexes termed snRNPs. Smn may have other functions in motor neurons, however its role in preventing the selective degeneration of motor neurons is not well established.

In most cases, SMA is diagnosed based on clinical symptoms and by the absence of all copies of exon 7 in the SMN1 gene, as determined by genetic testing. However, in approximately 5% of cases, SMA is caused by mutations other than a deletion of the entire SMN1 gene or other than a deletion of the entire exon 7 in the SMN1 gene, some known and others not yet defined. In such cases, when the SMN1 gene test is not feasible or the SMN1 gene sequence does not show any abnormality, other tests such as an electromyography (EMG) or muscle biopsy may be indicated.

Medical care for SMA patients at present is limited to supportive therapy including respiratory, nutritional and rehabilitation care; there is no drug known to address the underlying cause of the disease. Current treatment for SMA consists of prevention and management of the secondary effects of chronic motor unit loss. The major management issue in Type 1 SMA is the prevention and early treatment of pulmonary problems, which are the primary cause of death in the majority of the cases. While some infants afflicted with SMA grow to be adults, those with Type 1 SMA have a life expectancy of less than two years.

Several mouse models of SMA have been developed. In particular, the SMNΔ7 model (Le et al., Hum. Mol. Genet., 2005, 14:845) carries both the SMN2 gene and several copies of the SMN2Δ7 cDNA and recapitulates many of the phenotypic features of Type 1 SMA. The SMNΔ7 model can be used for both SMN2 expression studies as well as the evaluation of motor function and survival. The C/C-allele mouse model (Jackson Laboratory strain No.: 008714) provides a less severe SMA disease model, with mice having reduced levels of both SMN2 full length (SMN2 FL) mRNA and Smn protein. The C/C-allele mouse phenotype has the SMN2 gene and a hybrid mSmn1-SMN2 gene that undergoes alternative splicing, but does not have overt muscle weakness. The C/C-allele mouse model is used for SMN2 expression studies.

›BACKGROUND · 2 of 2

As a result of improved understanding of the genetic basis and pathophysiology of SMA, several strategies for treatment have been explored, but none have yet demonstrated success in the clinic.

Gene replacement of SMN1, using viral delivery vectors, and cell replacement, using differentiated SMN1 +/+ stem cells, have demonstrated efficacy in animal models of SMA. More research is needed to determine the safety and immune response and to address the requirement for the initiation of treatment at the neonatal stage before these approaches can be applied to humans.

Correction of alternative splicing of SMN2 in cultured cells has also been achieved using synthetic nucleic acids as therapeutic agents: (i) antisense oligonucleotides that target sequence elements in SMN2 pre-mRNA and shift the outcome of the splicing reaction toward the generation of full length SMN2 mRNA (Passini et al., Sci. Transl. Med., 2011, 3:72ra18; and, Hua et al., Nature, 2011, 478:123) and (ii) trans-splicing RNA molecules that provide a fully functional RNA sequence that replace the mutant fragment during splicing and generate a full length SMN1 mRNA (Coady and Lorson, J Neurosci., 2010, 30:126).

Other approaches under exploration include searching for drugs that increase Smn levels, enhance residual Smn function, or compensate for loss of Smn. Aminoglycosides have been shown to enhance expression of stabilized Smn protein produced from SMN2 Δ7 mRNA by promoting the translational read-through of the aberrant stop codon, but have poor central nervous system penetration and are toxic after repeated dosing. Chemotherapeutic agents, such as aclarubicin, have been shown to increase Smn protein in cell culture; however, the toxicity profile of these drugs prohibits long-term use in SMA patients. Some drugs under clinical investigation for the treatment of SMA include transcription activators such as histone deacetylase (“HDAC”) inhibitors (e.g., butyrates, valproic acid, and hydroxyurea), and mRNA stabilizers (mRNA decapping inhibitor RG3039 from Repligen), intended to increase the amount of total RNA transcribed from the SMN2 gene. However, the use of HDAC inhibitors or mRNA stabilizers does not address the underlying cause of SMA and may result in a global increase in transcription and gene expression with potential safety problems in humans.

In an alternative approach, neuroprotective agents such as olesoxime have been chosen for investigation. Such strategies are not aimed at increasing the production of functional Smn for the treatment of SMA, but instead are being explored to protect the Smn-deficient motor neurons from neurodegeneration.

A system designed to identify compounds that increase the inclusion of exon 7 of SMN into RNA transcribed from the SMN2 gene and certain benzooxazole and benzoisoxazole compounds identified thereby have been described in International Application PCT/US2009/003238 filed May 27, 2009 (published as International Publication Number WO2009/151546 and United States Publication Number US2011/0086833). A system designed to identify compounds that produce a stabilized Smn protein from SMN2 Δ7 mRNA and certain isoindolinone compounds identified thereby have been described in International Application PCT/US2009/004625 filed Aug. 13, 2009 (published as International Publication Number WO2010/019236 and United States Publication Number US2011/0172284). Each of the foregoing documents is herein incorporated in their entirety and for all purposes.

All other documents referred to herein are incorporated by reference into the present application as though fully set forth herein.

Despite the progress made in understanding the genetic basis and pathophysiology of SMA, there remains a need to identify compounds that alter the course of spinal muscular atrophy, one of the most devastating childhood neurological diseases.

›SUMMARY · 1 of 4

In one aspect, provided herein are compounds of Formula (I):

or a form thereof, wherein w 1 , w 2 , w 3 , w 4 , w 5 , w 6 and w 7 are as defined herein. In one embodiment, provided herein is a pharmaceutical composition comprising a compound of Formula (I) or a form thereof, and a pharmaceutically acceptable carrier, excipient or diluent. In a specific embodiment, provided herein is a compound of Formula (I) or a form thereof, or a pharmaceutical composition thereof for treating spinal muscular atrophy (SMA).

SMA is caused by deletion or mutation of the SMN1 gene, resulting in selective degeneration of Smn-deficient motor neurons. Although human subjects retain several copies of the SMN2 gene, the small amount of functional Smn protein expressed from SMN2 does not fully compensate for the loss of Smn that would have been expressed from the SMN1 gene. The compounds, compositions thereof and uses therewith described herein are based, in part, on the Applicants discovery that a compound of Formula (I) increases the inclusion of exon 7 of SMN2 into mRNA that is transcribed from an SMN2 minigene. The minigene reproduces the alternative splicing reaction of exon 7 of SMN2 which results in exon 7 skipping in the majority of SMN2 transcripts. Thus, compounds of Formula (I) or a form thereof may be used to modulate inclusion of exon 7 of SMN2 into mRNA that is transcribed from the SMN2 gene. Applicants have also discovered that a compound of Formula (I) increases the inclusion of exon 7 of SMN1 into mRNA that is transcribed from an SMN1 minigene. Thus, compounds of Formula (I) or a form thereof may be used to modulate inclusion of exon 7 of SMN1 into mRNA that is transcribed from the SMN1 gene.

In a specific embodiment, provided herein are compounds of Formula (I) or a form thereof that may be used to modulate the inclusion of exon 7 of SMN2 into mRNA that is transcribed from the SMN2 gene. In another specific embodiment, provided herein are compounds of Formula (I) or a form thereof that may be used to modulate the inclusion of exon 7 of SMN1 into mRNA that is transcribed from the SMN1 gene. In yet another embodiment, provided herein are compounds of Formula (I) or a form thereof that may be used to modulate the inclusion of exon 7 of SMN1 and SMN2 into mRNA that is transcribed from the SMN1 and SMN2 genes, respectively.

In another aspect, provided herein is the use of a compound of Formula (I) or a form thereof for treating SMA. In a specific embodiment, provided herein is a method for treating SMA in a human subject in need thereof, comprising administering to the subject an effective amount of a compound of Formula (I) or a form thereof. The compound of Formula (I) or a form thereof is preferably administered to a human subject in a pharmaceutical composition. In another specific embodiment, provided herein is the use of a compound of Formula (I) for treating SMA, wherein the compound enhances the inclusion of exon 7 of SMN2 into mRNA that is transcribed from the SMN2 gene. Without being limited by theory, compounds of Formula (I) enhance inclusion of exon 7 of SMN2 into mRNA that is transcribed from the SMN2 gene and increase levels of Smn protein produced from the SMN2 gene, and thus can be used to treat SMA in a human subject in need thereof.

In another aspect, provided herein are primers and/or probes described below in the Biological Examples (e.g., SMN primers such as SEQ ID NO. 1, 7, 8, 11 or 13, and/or SEQ ID NO. 2, 9 or 12, and/or SMN probes such as a SEQ ID NO. 3 or 10) and the use of those primers and/or probes. In a specific embodiment, provided herein is an isolated nucleotide sequence comprising SEQ ID NO. 1, 2, 3, 7, 8, 9, 10, 11, 12 or 13. In another specific embodiment, provided herein is an isolated nucleotide sequence consisting essentially of SEQ ID NO. 1, 2, 3, 7, 8, 9, 10, 11, 12 or 13. In another specific embodiment, provided herein is an isolated nucleotide sequence consisting of SEQ ID NO. 1, 2, 3, 7, 8, 9, 10, 11, 12 or 13.

In certain embodiments, the amount of mRNA that is transcribed from the SMN1 gene and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2 may be used as a biomarker for SMA, such as disclosed herein. In other embodiments, the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 may be used as a biomarker for treating a patient with a compound, such as disclosed herein. In a specific embodiment, the patient is an SMA patient. In another specific embodiment, the patient is not an SMA patient.

In certain embodiments, the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 as well as the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2 may be used as biomarkers for treating a patient with a compound, such as disclosed herein. In a specific embodiment, the patient is an SMA patient. In another specific embodiment, the patient is not an SMA patient.

In accordance with these embodiments, an SMN primer(s) and/or an SMN probe described below may be used in assays, such as PCR (e.g., qPCR), rolling circle amplification, and RT-PCR (e.g., endpoint RT-PCR and/or RT-qPCR) to assess and/or quantify the amount of mRNA that is transcribed from the SMN1 gene and/or SMN2 gene and does or does not include exon 7 of SMN1 and/or SMN2.

In a specific embodiment, a primer and/or probe described below in the Biological Examples (e.g., SMN primers such as SEQ ID NO. 1, 7, 8, 11 or 13 and/or SEQ ID NO. 2, 9 or 12, and/or SMN probes such as a SEQ ID NO. 3 or 10) is used in an assay, such as RT-PCR, RT-qPCR, endpoint RT-PCR, PCR, qPCR, rolling circle amplification, Northern blot or Southern blot (e.g., an assay such as described below in the Biological Examples), to determine whether a compound (e.g., a compound of Formula (I) or a form thereof) enhances the inclusion of exon 7 of SMN2 into mRNA that is transcribed from an SMN2 gene.

›SUMMARY · 2 of 4

In another embodiment, a primer and/or probe described below in the Biological Examples (e.g., SMN primers such as SEQ ID NO. 7, 11 or 13 and/or SEQ ID NO. 9 or 12, and/or SMN probes such as a SEQ ID NO. 3 or 10) is used in an assay, such as RT-PCR, RT-qPCR, endpoint RT-PCR, PCR, qPCR, rolling circle amplification, Northern blot or Southern blot (e.g., an assay such as described below in the Biological Examples), to monitor the amount of mRNA that is transcribed from the SMN2 gene and includes exon 7 of SMN2 in a patient sample. In a specific embodiment, the patient is an SMA patient. In another specific embodiment, the patient is not an SMA patient.

In another embodiment, a primer and/or probe described below in the Biological Examples (e.g., SMN primers such as SEQ ID NO. 7, 11 or 13 and/or SEQ ID NO. 9 or 12, and/or SMN probes such as a SEQ ID NO. 3 or 10) is used in an assay, such as RT-PCR, RT-qPCR, endpoint RT-PCR, PCR, qPCR, rolling circle amplification, Northern blot or Southern blot (e.g., an assay such as described below in the Biological Examples), to monitor the amount of mRNA that is transcribed from the SMN1 gene and includes exon 7 of SMN1 in a patient sample. In a specific embodiment, the patient is an SMA patient. In another specific embodiment, the patient is not an SMA patient.

In another embodiment, a primer and/or probe described below in the Biological Examples (e.g., SMN primers such as SEQ ID NO. 7, 11 or 13 and/or SEQ ID NO. 9 or 12, and/or SMN probes such as a SEQ ID NO. 3 or 10) is used in an assay, such as RT-PCR, RT-qPCR, endpoint RT-PCR, PCR, qPCR, rolling circle amplification, Northern blot or Southern blot (e.g., an assay such as described below in the Biological Examples), to monitor the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 in a patient sample. In a specific embodiment, the patient is an SMA patient. In another specific embodiment, the patient is not an SMA patient.

In another embodiment, a primer and/or probe described below in the Biological Examples (e.g., SMN primers such as SEQ ID NO. 7, 8, 11 or 13 and/or SEQ ID NO. 9 or 12, and/or SMN probes such as a SEQ ID NO. 3 or 10) is used in an assay, such as RT-PCR, RT-qPCR, endpoint RT-PCR, PCR, qPCR, rolling circle amplification, Northern blot or Southern blot (e.g., an assay such as described below in the Biological Examples), to monitor a patient's response to a compound (e.g., a compound of Formula (I) or a form thereof). In a specific embodiment, the patient is an SMA patient. In another specific embodiment, the patient is not an SMA patient.

In another embodiment, provided herein is a method for determining whether a compound (e.g., a compound of Formula (I) disclosed herein) enhances the inclusion of exon 7 of SMN2 into mRNA that is transcribed from the SMN2 gene, comprising (a) contacting mRNA that is transcribed from an SMN2 minigene described herein or in International Application PCT/US2009/004625, filed Aug. 13, 2009 (published as International Publication Number WO2010/019236) or United States Publication Number US2011/0172284 in the presence of a compound (e.g., a compound of Formula (I) disclosed herein) with a primer(s) described herein (e.g., SEQ ID NO. 1 and/or 2) along with applicable components for, e.g., RT-PCR, RT-qPCR, PCR, endpoint RT-PCR, qPCR or rolling circle amplification; and (b) detecting the amount of mRNA that is transcribed from the minigene and includes exon 7 of the SMN2, wherein (1) an increase in the amount of mRNA that is transcribed from the minigene and includes exon 7 of SMN2 in the presence of the compound relative to the amount of mRNA that is transcribed from the minigene and includes exon 7 of SMN2 in the absence of the compound indicates that the compound enhances inclusion of exon 7 of SMN2 into mRNA that is transcribed from the SMN2 gene; and (2) no change or no substantial change in the amount of mRNA that is transcribed from the minigene and includes exon 7 of SMN2 in the presence of the compound relative to the amount of mRNA that is transcribed from the minigene and includes exon 7 of SMN2 in the absence of the compound indicates that the compound does not enhance the inclusion of exon 7 of SMN2 into mRNA that is transcribed from the SMN2 gene.

In another embodiment, provided herein is a method for determining whether a compound (e.g., a compound of Formula (I) disclosed herein) enhances the inclusion of exon 7 of SMN1 into mRNA that is transcribed from the SMN1 gene, comprising (a) contacting mRNA that is transcribed from an SMN1 minigene described in International Application PCT/US2009/004625, filed Aug. 13, 2009 (published as International Publication Number WO2010/019236) or United States Publication Number US2011/0172284 in the presence of a compound (e.g., a compound of Formula (I) disclosed herein) with a primer(s) described herein (e.g., SEQ ID NO. 1 and/or 2) along with applicable components for, e.g., RT-PCR, RT-qPCR, PCR, endpoint RT-PCR, qPCR or rolling circle amplification; and (b) detecting the amount of mRNA that is transcribed from the minigene and includes exon 7 of the SMN1, wherein (1) an increase in the amount of mRNA that is transcribed from the minigene and includes exon 7 of SMN1 in the presence of the compound relative to the amount of mRNA that is transcribed from the minigene and includes exon 7 of SMN1 in the absence of the compound indicates that the compound enhances inclusion of exon 7 of SMN1 into mRNA that is transcribed from the SMN1 gene; and (2) no change or no substantial change in the amount of mRNA that is transcribed from the minigene and includes exon 7 of SMN1 in the presence of the compound relative to the amount of mRNA that is transcribed from the minigene and includes exon 7 of SMN1 in the absence of the compound indicates that the compound does not enhance the inclusion of exon 7 of SMN1 into mRNA that is transcribed from the SMN1 gene.

›SUMMARY · 3 of 4

In another embodiment, provided herein is a method for determining whether a compound (e.g., a compound of Formula (I) disclosed herein) enhances the inclusion of exon 7 of SMN2 into mRNA that is transcribed from the SMN2 gene, comprising (a) contacting mRNA that is transcribed from an SMN2 minigene described herein or in International Application PCT/US2009/004625, filed Aug. 13, 2009 (published as International Publication Number WO2010/019236) or United States Publication Number US2011/0172284 in the presence of a compound (e.g., a compound of Formula (I) disclosed herein) with a probe described herein (e.g., SEQ ID NO. 3 or 10) along with applicable components for, e.g., RT-PCR, RT-qPCR, endpoint RT-PCR, PCR, qPCR, rolling circle amplification and, as applicable, Northern blot or Southern blot; and (b) detecting the amount of mRNA that is transcribed from the minigene and includes exon 7 of the SMN2, wherein (1) an increase in the amount of mRNA that is transcribed from the minigene and includes exon 7 of SMN2 in the presence of the compound relative to the amount of mRNA that is transcribed from the minigene and includes exon 7 of SMN2 in the absence of the compound indicates that the compound enhances inclusion of exon 7 of SMN2 into mRNA that is transcribed from the SMN2 gene; and (2) no change or no substantial change in the amount of mRNA that is transcribed from the minigene and includes exon 7 of SMN2 in the presence of the compound relative to the amount of mRNA that is transcribed from the minigene and includes exon 7 of SMN2 in the absence of the compound indicates that the compound does not enhance the inclusion of exon 7 of SMN2 into mRNA that is transcribed from the SMN2 gene.

In another embodiment, provided herein is a method for determining whether a compound (e.g., a compound of Formula (I) disclosed herein) enhances the inclusion of exon 7 of SMN1 into mRNA that is transcribed from the SMN1 gene, comprising (a) contacting mRNA that is transcribed from an SMN1 minigene described in International Application PCT/US2009/004625, filed Aug. 13, 2009 (published as International Publication Number WO2010/019236) or United States Publication Number US2011/0172284 in the presence of a compound (e.g., a compound of Formula (I) disclosed herein) with a probe described herein (e.g., SEQ ID NO. 3 or 10) along with applicable components for, e.g., RT-PCR, RT-qPCR, endpoint RT-PCR, PCR, qPCR, rolling circle amplification and, as applicable, Northern blot or Southern blot; and (b) detecting the amount of mRNA that is transcribed from the minigene and includes exon 7 of the SMN1, wherein (1) an increase in the amount of mRNA that is transcribed from the minigene and includes exon 7 of SMN1 in the presence of the compound relative to the amount of mRNA that is transcribed from the minigene and includes exon 7 of SMN1 in the absence of the compound indicates that the compound enhances inclusion of exon 7 of SMN1 into mRNA that is transcribed from the SMN1 gene; and (2) no change or no substantial change in the amount of mRNA that is transcribed from the minigene and includes exon 7 of SMN1 in the presence of the compound relative to the amount of mRNA that is transcribed from the minigene and includes exon 7 of SMN1 in the absence of the compound indicates that the compound does not enhance the inclusion of exon 7 of SMN2 into mRNA that is transcribed from the SMN2 gene.

In another embodiment, provided herein is a method for determining whether a compound (e.g., a compound of Formula (I) disclosed herein) enhances the inclusion of exon 7 of SMN2 into mRNA that is transcribed from the SMN2 gene, comprising (a) contacting mRNA that is transcribed from an SMN2 minigene described herein or in International Application PCT/US2009/004625, filed Aug. 13, 2009 (published as International Publication Number WO2010/019236) or United States Publication Number US2011/0172284 in the presence of a compound (e.g., a compound of Formula (I) disclosed herein) with a primer(s) (e.g., SEQ ID NO. 1 or 2) and/or a probe described herein (e.g., SEQ ID NO. 3 or 10) along with applicable components for, e.g, RT-PCR, RT-qPCR, endpoint RT-PCR, PCR, qPCR, rolling circle amplification and, as applicable, Northern blot or Southern blot; and (b) detecting the amount of mRNA that is transcribed from the minigene and includes exon 7 of the SMN2, wherein (1) an increase in the amount of mRNA that is transcribed from the minigene and includes exon 7 of SMN2 in the presence of the compound relative to the amount of mRNA that is transcribed from the minigene and includes exon 7 of SMN2 in the absence of the compound indicates that the compound enhances inclusion of exon 7 of SMN2 into mRNA that is transcribed from the SMN2 gene; and (2) no change or no substantial change in the amount of mRNA that is transcribed from the minigene and includes exon 7 of SMN2 in the presence of the compound relative to the amount of mRNA that is transcribed from the minigene and includes exon 7 of SMN2 in the absence of the compound indicates that the compound does not enhance the inclusion of exon 7 of SMN2 into mRNA that is transcribed from the SMN2 gene.

In another embodiment, provided herein is a method for determining whether a compound (e.g., a compound of Formula (I) disclosed herein) enhances the inclusion of exon 7 of SMN1 into mRNA that is transcribed from the SMN1 gene, comprising (a) contacting mRNA that is transcribed from an SMN1 minigene described in International Application PCT/US2009/004625, filed Aug. 13, 2009 (published as International Publication Number WO2010/019236) or United States Publication Number US2011/0172284 in the presence of a compound (e.g., a compound of Formula (I) disclosed herein) with a primer(s) (e.g., SEQ ID NO. 1 or 2) and/or a probe described herein (e.g., SEQ ID NO. 3 or 10) along with applicable components for, e.g, RT-PCR, RT-qPCR, endpoint RT-PCR, PCR, qPCR, rolling circle amplification and, as applicable, Northern blot or Southern blot; and (b) detecting the amount of mRNA that is transcribed from the minigene and includes exon 7 of the SMN1, wherein (1) an increase in the amount of mRNA that is transcribed from the minigene and includes exon 7 of SMN1 in the presence of the compound relative to the amount of mRNA that is transcribed from the minigene and includes exon 7 of SMN1 in the absence of the compound indicates that the compound enhances inclusion of exon 7 of SMN1 into mRNA that is transcribed from the SMN1 gene; and (2) no change or no substantial change in the amount of mRNA that is transcribed from the minigene and includes exon 7 of SMN1 in the presence of the compound relative to the amount of mRNA that is transcribed from the minigene and includes exon 7 of SMN1 in the absence of the compound indicates that the compound does not enhance the inclusion of exon 7 of SMN1 into mRNA that is transcribed from the SMN1 gene.

›SUMMARY · 4 of 4

In another aspect, provided herein are kits comprising a primer and/or probe described below in the Biological Examples (e.g., SMN primers such as SEQ ID NO. 1, 7, 8, 11 or 13 and/or SEQ ID NO. 2, 9 or 12, and/or SMN probes such as a SEQ ID NO. 3 or 10) and the use thereof.

›BRIEF DESCRIPTION OF THE FIGURES · 1 of 2

FIG. 1 , referenced in Biological Example 1, is a schematic drawing of the SMN2-A minigene construct, which produces two alternatively spliced mRNA transcripts: a full length mRNA that contains exon 7 and a Δ7 mRNA that lacks exon 7. The adenine nucleotide inserted in exon 7 of SMN2-A after nucleic residue 48 is represented by the letter “A.” Alternatively, the nucleotide may also be selected from cytosine or thymine. Due to the insertion of one nucleotide (A, C, or T) after nucleic residue 48, the full length mRNA does not contain a stop codon in the SMN open reading frame, whereas the Δ7 mRNA has a stop codon in Exon 8 that is indicated by the word “Stop.”

FIG. 2 , referenced in Biological Example 1, provides the DNA sequence of the minigene from the SMN2-A minigene construct SEQ ID NO. 21 ( FIG. 2 a ). As shown in FIG. 2 b , the following sub-sequences can be found:

1-70: 5′UTR (deg); 71-79: exon 6: start codon and BamHI site (atgggatcc); 80-190: exon 6; 191-5959: intron 6; 5960-6014: exon 7 with the adenine nucleotide “A” insert (position 6008); 6015-6458: intron 7; 6459-6481: part of exon 8; 6482-8146: BamHI site (sequence at the 5′ end), luciferase coding sequence starting with codon 2 (without initiation codon), NotI site (sequence at the 3′ end), TAA stop codon; and 8147-8266: 3′UTR (deg).

To generate the SMN1 version of the minigene, the sixth nucleotide of exon 7 (a thymine residue) of the SMN2-A minigene construct is changed to cytosine using site directed mutagenesis. Thus, similar to the SMN2-A minigene construct, the SMN1 minigene construct has a single adenine residue inserted after nucleic residue 48 of exon 7. The SMN1 minigene construct is referred to as SMN1-A. Similarly, the nucleotide inserted in the SMN1 minigene construct after nucleic residue 48 of exon 7 may also be selected alternatively from cytosine or thymine.

FIG. 3 , referenced in Biological Example 2, shows the correction of SMN2 minigene alternative splicing in cells treated with rising concentrations of Compound 6 ( FIG. 3 a ) and Compound 170 ( FIG. 3 b ) over a 24 hr period. The levels of full length SMN2 minigene mRNA were quantified using reverse transcription-quantitative PCR (RT-qPCR). The level of full length SMN2 minigene mRNA in compound-treated samples was normalized to that in vehicle-treated samples and plotted as a function of the compound concentration.

FIG. 4 , referenced in Biological Example 3, shows the correction of SMN2 alternative splicing in Type 1 SMA patient fibroblasts treated with rising concentrations of Compound 6 ( FIG. 4 a ) and Compound 170 ( FIG. 4 b ) over a 24 hr period. The levels of full length and Δ7 SMN2 mRNA were quantified using RT-qPCR. The levels of full length and Δ7 SMN2 mRNA in compound-treated samples were normalized to those in vehicle-treated samples and plotted as a function of the compound concentration.

FIG. 5 , referenced in Biological Example 4, shows the correction of SMN2 alternative splicing in Type 1 SMA patient fibroblasts treated with rising concentrations of Compound 6 ( FIG. 5 a ) and Compound 170 ( FIG. 5 b ) over a 24 hr period. The full length and Δ7 SMN2 mRNA were amplified using reverse transcription-end point PCR (RT-PCR) and PCR products were separated using agarose gel electrophoresis. The top and bottom bands correspond to the full length and Δ7 SMN2 mRNA respectively. The intensity of each band is proportional to the amount of RNA present in the sample.

FIG. 6 , referenced in Biological Example 5, shows the correction of SMN2 alternative splicing (in both the SMN2 gene and the hybrid mouse Smn1-SMN2 gene) in brain and muscle tissues in a C/C-allele SMA mouse model resulting from treatment for 10 days twice per day (BID) with 10 mg/kg of Compound 6 ( FIG. 6 a ) and Compound 170 ( FIG. 6 b ). The levels of full length and Δ7 SMN2 mRNA were quantified using RT-qPCR, the combined full length and Δ7 SMN2 mRNA quantity was set to 1, and fractional quantities of full length and Δ7 SMN2 were calculated.

FIG. 7 , referenced in Biological Example 6, shows the correction of SMN2 alternative splicing (in both the SMN2 gene and the hybrid mouse Smn1-SMN2 gene) in brain and muscle tissues in a C/C-allele SMA mouse model resulting from treatment for 10 days BID with 10 mg/kg of Compound 6 ( FIG. 7 a ) and Compound 170 ( FIG. 7 b ). The full length and Δ7 SMN2 mRNA were amplified using RT-PCR. The PCR products were separated using agarose gel electrophoresis. The top and bottom bands correspond to the full length and Δ7 SMN2 mRNA, respectively. The intensity of each band is proportional to the amount of RNA present in the sample.

FIG. 8 , referenced in Biological Example 7, shows a dose dependent increase in Smn protein expression in SMA Type 1 human fibroblast cells treated over a 48 hour period with Compound 6 ( FIG. 8 a ) and Compound 170 ( FIG. 8 b ).

FIG. 9 , referenced in Biological Example 8, shows an increase in nuclear speckle counts (gems) in Type 1 SMA patient fibroblasts treated with Compound 6 ( FIG. 9 a ) and Compound 170 ( FIG. 9 b ) over a 48 hour period. Speckles were counted using fluorescence microscopy. The number of speckles in compound-treated samples was normalized to that in vehicle-treated samples and plotted as a function of the compound concentration.

FIG. 10 , referenced in Biological Example 9, shows an increase in Smn protein expression (black circles) in motor neurons generated from iPS cells generated from Type 1 SMA patient fibroblasts treated with Compound 6 ( FIG. 10 ). The level of Smn protein was quantified using Smn immunostaining and confocal fluorescence microscopy. The level of Smn protein in compound-treated samples was normalized to that in vehicle-treated samples and plotted as a function of the compound concentration.

FIG. 11 , referenced in Biological Example 11, shows increased Smn protein expression in brain, spinal cord, and muscle tissues in a C/C-allele SMA mouse model resulting from treatment for 10 days BID with 100 mg/kg of Compound 6 ( FIG. 11 a , for n=10) and 10 mg/kg of Compound 170 ( FIG. 11 b , for n=5). The p value by ANOVA in each Figure is indicated with three stars (***) for p<0.001.

›BRIEF DESCRIPTION OF THE FIGURES · 2 of 2

FIG. 12 , referenced in Biological Example 12, shows a dose dependent increase in Smn protein expression in tissues in a neonatal Δ7 SMA mouse model resulting from treatment for 7 days once per day (QD) with Compound 6 (brain, FIG. 12 a ; spinal cord, FIG. 12 b ; muscle, FIG. 12 c ; and skin, FIG. 12 d , for n=6 to 9) and Compound 170 (brain, FIG. 12 e ; spinal cord, FIG. 12 f ; muscle, FIG. 12 g , for n=7). The p value by ANOVA in each Figure is indicated with one star (*) for p<0.05, two stars (**) for p<0.01 and three stars (***) for p<0.001.

FIG. 13 , referenced in Biological Example 13, shows differences in body weight in a neonatal Δ7 SMA mouse model resulting from treatment up to Postnatal Day (PND) 59 with Compound 6 ( FIG. 13 a ) and until PND 92 with Compound 170 ( FIG. 13 b ).

FIG. 14 , referenced in Biological Example 14, shows an improved righting reflex in a neonatal Δ7 SMA mouse model resulting from treatment with Compound 6 ( FIG. 14 a ) and Compound 170 ( FIG. 14 b ).

FIG. 15 , referenced in Biological Example 15, shows improved survival in a neonatal Δ7 SMA mouse model resulting from treatment with Compound 6 ( FIG. 15 a ) and Compound 170 ( FIG. 15 b ).

FIG. 16 , referenced in Biological Example 15, shows increased Smn protein expression in brain, spinal cord, and muscle tissues in a Δ7 SMA mouse model resulting from treatment with Compound 6 until PND 156 ( FIG. 16 a ) and with Compound 170 until PND 185 ( FIG. 16 b ) relative to vehicle treated and age-matched heterozygous mice, respectively.

FIG. 17 , referenced in Biological Example 16, shows a dose dependent increase in SMN1 minigene FL mRNA and a dose dependent decrease in SMN1 minigene Δ7 mRNA in HEK293H human cells treated over a 7 hour period with Compound 6 ( FIG. 17 a ) and Compound 170 ( FIG. 17 b ). The full length and Δ7 SMN1 minigene mRNA were each amplified using RT-PCR and the resulting PCR products were separated using agarose gel electrophoresis. The top and bottom bands correspond to the full length and Δ7 SMN1 minigene mRNA, respectively. The intensity of each band is proportional to the amount of RNA present in the sample.

›DETAILED DESCRIPTION · 1 of 2

Provided herein are compounds of Formula (I):

or a form thereof, wherein:

w 1 and w 5 are independently C—R a or N;

w 2 is C—R b or N;

w 3 , w 4 and w 7 are independently C—R 1 , C—R 2 , C—R a or N;

w 6 is C—R 1 , C—R 2 , C—R c or N;

wherein one of w 3 , w 4 , w 6 and w 7 is C—R 1 and one other of w 3 , w 4 , w 6 and w 7 is C—R 2 , provided that,

when w 3 is C—R 1 , then w 6 is C—R 2 and w 4 and w 7 are independently C—R a or N; or,

when w 3 is C—R 2 , then w 6 is C—R 1 and w 4 and w 7 are independently C—R a or N; or,

when w 4 is C—R 1 , then w 7 is C—R 2 and w 3 is C—R a or N and w 6 is C—R c or N; or,

when w 4 is C—R 2 , then w 7 is C—R 1 and w 3 is C—R a or N and w 6 is C—R c or N; and,

wherein any one, two or three of w 1 , w 2 , w 3 , w 4 , w 5 , w 6 and w 7 may optionally be N;

R 1 is C 1-8 alkyl, amino, C 1-8 alkyl-amino, (C 1-8 alkyl) 2 -amino, C 1-8 alkoxy-C 1-8 alkyl-amino, (C 1-8 alkoxy-C 1-8 alkyl) 2 -amino, (C 1-8 alkoxy-C 1-8 alkyl)(C 1-8 alkyl)amino, amino-C 1-8 alkyl, C 1-8 alkyl-amino-C 1-8 alkyl, (C 1-8 alkyl) 2 -amino-C 1-8 alkyl, C 1-8 alkoxy-C 1-8 alkyl-amino-C 1-8 alkyl, (C 1-8 alkoxy-C 1-8 alkyl) 2 -amino-C 1-8 alkyl, (C 1-8 alkoxy-C 1-8 alkyl)(C 1-8 alkyl)amino-C 1-8 alkyl, amino-C 1-8 alkyl-amino, (amino-C 1-8 alkyl) 2 -amino, (amino-C 1-8 alkyl)(C 1-8 alkyl)amino, C 1-8 alkyl-amino-C 1-8 alkyl-amino, (C 1-8 alkyl-amino-C 1-8 alkyl) 2 -amino, (C 1-8 alkyl-amino-C 1-8 alkyl)(C 1-8 alkyl)amino, (C 1-8 alkyl) 2 -amino-C 1-8 alkyl-amino, [(C 1-8 alkyl) 2 -amino-C 1-8 alkyl](C 1-8 alkyl)amino, amino-C 1-8 alkoxy, C 1-8 alkyl-amino-C 1-8 alkoxy, (C 1-8 alkyl) 2 -amino-C 1-8 alkoxy, C 1-8 alkoxy-C 1-8 alkyl-amino-C 1-8 alkoxy, C 1-8 alkoxy-C 1-8 alkyl-amino-C 1-8 alkoxy, (C 1-8 alkoxy-C 1-8 alkyl)(C 1-8 alkyl)amino-C 1-8 alkoxy, amino-C 2-8 alkenyl, C 1-8 alkyl-amino-C 2-8 alkenyl, (C 1-8 alkyl) 2 -amino-C 2-8 alkenyl, amino-C 2-8 alkynyl, C 1-8 alkyl-amino-C 2-8 alkynyl, (C 1-8 alkyl) 2 -amino-C 2-8 alkynyl, halo-C 1-8 alkyl-amino, (halo-C 1-8 alkyl) 2 -amino, (halo-C 1-8 alkyl)(C 1-8 alkyl)amino, hydroxy-C 1-8 alkyl, hydroxy-C 1-8 alkoxy-C 1-8 alkyl, hydroxy-C 1-8 alkyl-amino, (hydroxy-C 1-8 alkyl) 2 -amino, (hydroxy-C 1-8 alkyl)(C 1-8 alkyl)amino, hydroxy-C 1-8 alkyl-amino-C 1-8 alkyl, (hydroxy-C 1-8 alkyl) 2 -amino-C 1-8 alkyl, (hydroxy-C 1-8 alkyl)(C 1-8 alkyl)amino-C 1-8 alkyl, hydroxy-C 1-8 alkyl-amino-C 1-8 alkoxy, (hydroxy-C 1-8 alkyl) 2 -amino-C 1-8 alkoxy, (hydroxy-C 1-8 alkyl)(C 1-8 alkyl)amino-C 1-8 alkoxy, hydroxy-C 1-8 alkyl-amino-C 1-8 alkyl-amino, (hydroxy-C 1-8 alkyl-amino-C 1-8 alkyl) 2 -amino, (hydroxy-C 1-8 alkyl) 2 -amino-C 1-8 alkyl-amino, (hydroxy-C 1-8 alkyl-amino-C 1-8 alkyl)(C 1-8 alkyl)amino, (hydroxy-C 1-8 alkyl)(C 1-8 alkyl)amino-C 1-8 alkyl-amino, [(hydroxy-C 1-8 alkyl) 2 -amino-C 1-8 alkyl](C 1-8 alkyl)amino, [(hydroxy-C 1-8 alkyl)(C 1-8 alkyl)amino-C 1-8 alkyl](C 1-8 alkyl)amino, heterocyclyl, heterocyclyl-C 1-8 alkyl, heterocyclyl-C 1-8 alkoxy, heterocyclyl-amino, (heterocyclyl)(C 1-8 alkyl)amino, heterocyclyl-amino-C 1-8 alkyl, heterocyclyl-C 1-8 alkyl-amino, (heterocyclyl-C 1-8 alkyl) 2 -amino, (heterocyclyl-C 1-8 alkyl)(C 1-8 alkyl)amino, heterocyclyl-C 1-8 alkyl-amino-C 1-8 alkyl, (heterocyclyl-C 1-8 alkyl) 2 -amino-C 1-8 alkyl, (heterocyclyl-C 1-8 alkyl)(C 1-8 alkyl)amino-C 1-8 alkyl, heterocyclyl-oxy, heterocyclyl-carbonyl, heterocyclyl-carbonyl-oxy, C 3-14 cycloalkyl, aryl-C 1-8 alkyl-amino, (aryl-C 1-8 alkyl) 2 -amino, (aryl-C 1-8 alkyl)(C 1-8 alkyl)amino, aryl-C 1-8 alkyl-amino-C 1-8 alkyl, (aryl-C 1-8 alkyl) 2 -amino-C 1-8 alkyl, (aryl-C 1-8 alkyl)(C 1-8 alkyl)amino-C 1-8 alkyl, heteroaryl, heteroaryl-C 1-8 alkyl, heteroaryl-C 1-8 alkoxy, heteroaryl-amino, heteroaryl-C 1-8 alkyl-amino, (heteroaryl-C 1-8 alkyl) 2 -amino, (heteroaryl-C 1-8 alkyl)(C 1-8 alkyl)amino, heteroaryl-C 1-8 alkyl-amino-C 1-8 alkyl, (heteroaryl-C 1-8 alkyl) 2 -amino-C 1-8 alkyl or (heteroaryl-C 1-8 alkyl)(C 1-8 alkyl)amino-C 1-8 alkyl;

wherein, each instance of heterocyclyl, C 3-14 cycloalkyl, aryl and heteroaryl is optionally substituted with one, two or three R 3 substituents and optionally, with one additional R 4 substituent; or,

wherein, each instance of heterocyclyl, C 3-14 cycloalkyl, aryl and heteroaryl is optionally substituted with one, two, three or four R 3 substituents;

R 2 is aryl, aryl-amino, aryl-amino-carbonyl, heterocyclyl, heteroaryl or heteroaryl-amino;

wherein, each instance of aryl, heterocyclyl and heteroaryl is optionally substituted with one, two or three R 6 substituents and optionally, with one additional R 7 substituent;

R a is, in each instance, independently selected from hydrogen, halogen or C 1-8 alkyl;

R b is hydrogen, halogen, C 1-8 alkyl or C 1-8 alkoxy;

R c is hydrogen, halogen or C 1-8 alkyl;

R 3 is, in each instance, independently selected from cyano, halogen, hydroxy, oxo, C 1-8 alkyl, halo-C 1-8 alkyl, C 1-8 alkyl-carbonyl, C 1-8 alkoxy, halo-C 1-8 alkoxy, C 1-8 alkoxy-C 1-8 alkyl, C 1-8 alkoxy-carbonyl, amino, C 1-8 alkyl-amino, (C 1-8 alkyl) 2 -amino, amino-C 1-8 alkyl, C 1-8 alkyl-amino-C 1-8 alkyl, (C 1-8 alkyl) 2 -amino-C 1-8 alkyl, amino-C 1-8 alkyl-amino, C 1-8 alkyl-amino-C 1-8 alkyl-amino, (C 1-8 alkyl-amino-C 1-8 alkyl) 2 -amino, (C 1-8 alkyl) 2 -amino-C 1-8 alkyl-amino, [(C 1-8 alkyl) 2 -amino-C 1-8 alkyl] 2 -amino, (C 1-8 alkyl-amino-C 1-8 alkyl)(C 1-8 alkyl)amino, [(C 1-8 alkyl) 2 -amino-C 1-8 alkyl](C 1-8 alkyl)amino, C 1-8 alkoxy-C 1-8 alkyl-amino, (C 1-8 alkoxy-C 1-8 alkyl) 2 -amino, (C 1-8 alkoxy-C 1-8 alkyl)(C 1-8 alkyl)amino, C 1-8 alkyl-carbonyl-amino, C 1-8 alkoxy-carbonyl-amino, hydroxy-C 1-8 alkyl, hydroxy-C 1-8 alkoxy-C 1-8 alkyl, hydroxy-C 1-8 alkyl-amino, (hydroxy-C 1-8 alkyl) 2 -amino or (hydroxy-C 1-8 alkyl)(C 1-8 alkyl)amino;

R 4 is C 3-14 cycloalkyl, C 3-14 cycloalkyl-C 1-8 alkyl, C 3-14 cycloalkyl-amino, aryl-C 1-8 alkyl, aryl-C 1-8 alkoxy-carbonyl, aryl-sulfonyloxy-C 1-8 alkyl, heterocyclyl or heterocyclyl-C 1-8 alkyl; wherein, each instance of C 3-14 cycloalkyl, aryl and heterocyclyl is optionally substituted with one, two or three R 5 substituents;

›DETAILED DESCRIPTION · 2 of 2

R 5 is, in each instance, independently selected from halogen, hydroxy, cyano, nitro, C 1-8 alkyl, halo-C 1-8 alkyl, C 1-8 alkoxy, halo-C 1-8 alkoxy, amino, C 1-8 alkyl-amino, (C 1-8 alkyl) 2 -amino or C 1-8 alkyl-thio;

R 6 is, in each instance, independently selected from halogen, hydroxy, cyano, nitro, C 1-8 alkyl, C 2-8 alkenyl, halo-C 1-8 alkyl, hydroxy-C 1-8 alkyl, C 1-8 alkoxy, halo-C 1-8 alkoxy, C 1-8 alkoxy-C 1-8 alkyl, amino, C 1-8 alkyl-amino, (C 1-8 alkyl) 2 -amino or C 1-8 alkyl-thio; and,

R 7 is C 3-14 cycloalkyl, C 3-14 cycloalkyl-oxy, aryl, heterocyclyl or heteroaryl.

›EMBODIMENTS · 1 of 13

In one embodiment of a compound of Formula (I), w 1 is C—R a .

In another embodiment of a compound of Formula (I), w 1 is N.

In one embodiment of a compound of Formula (I), w 2 is C—R b .

In another embodiment of a compound of Formula (I), w 2 is N.

In one embodiment of a compound of Formula (I), w 3 is C—R a .

In another embodiment of a compound of Formula (I), w 3 is N.

In one embodiment of a compound of Formula (I), w 4 is C—R a .

In another embodiment of a compound of Formula (I), w 4 is N.

In one embodiment of a compound of Formula (I), w 5 is C—R a .

In another embodiment of a compound of Formula (I), w 5 is N.

In one embodiment of a compound of Formula (I), w 6 is C—R c .

In another embodiment of a compound of Formula (I), w 6 is N.

In one embodiment of a compound of Formula (I), w 7 is C—R a .

In another embodiment of a compound of Formula (I), w 7 is N.

In one embodiment of a compound of Formula (I), w 3 is C—R 1 and w 6 is C—R 2 .

In another embodiment of a compound of Formula (I), w 3 is C—R 2 and w 6 is C—R 1 .

In one embodiment of a compound of Formula (I), w 4 is C—R 1 and w 7 is C—R 2 .

In another embodiment of a compound of Formula (I), w 4 is C—R 2 and w 7 is C—R 1 .

In one embodiment of a compound of Formula (I), w 3 is C—R 1 , w 6 is C—R 2 and w 1 , w 4 , w 5 and w 7 are independently C—R a or N and w 2 is C—R b or N.

In another embodiment of a compound of Formula (I), w 3 is C—R 2 , w 6 is C—R 1 and w 1 , w 4 , w 5 and w 7 are independently C—R a or N and w 2 is C—R b or N.

In one embodiment of a compound of Formula (I), w 4 is C—R 1 , w 7 is C—R 2 , w 1 , w 3 and w 5 are independently C—R a or N, w 2 is C—R b or N and w 6 is C—R c or N.

In another embodiment of a compound of Formula (I), w 4 is C—R 2 , w 7 is C—R 1 , w 1 , w 3 and w 5 are independently C—R a or N, w 2 is C—R b or N and w 6 is C—R c or N.

In one embodiment of a compound of Formula (I), w 1 and w 2 are N.

In one embodiment of a compound of Formula (I), w 1 and w 3 are N.

In one embodiment of a compound of Formula (I), w 1 and w 4 are N.

In one embodiment of a compound of Formula (I), w 1 and w 5 are N.

In one embodiment of a compound of Formula (I), w 1 and w 6 are N.

In one embodiment of a compound of Formula (I), w 1 and w 7 are N.

In one embodiment of a compound of Formula (I),

R 1 is C 1-8 alkyl, amino, C 1-8 alkyl-amino, (C 1-8 alkyl) 2 -amino, C 1-8 alkoxy-C 1-8 alkyl-amino, (C 1-8 alkoxy-C 1-8 alkyl) 2 -amino, (C 1-8 alkoxy-C 1-8 alkyl)(C 1-8 alkyl)amino, amino-C 1-8 alkyl, C 1-8 alkyl-amino-C 1-8 alkyl, (C 1-8 alkyl) 2 -amino-C 1-8 alkyl, C 1-8 alkoxy-C 1-8 alkyl-amino-C 1-8 alkyl, (C 1-8 alkoxy-C 1-8 alkyl) 2 -amino-C 1-8 alkyl, (C 1-8 alkoxy-C 1-8 alkyl)(C 1-8 alkyl)amino-C 1-8 alkyl, amino-C 1-8 alkyl-amino, (amino-C 1-8 alkyl) 2 -amino, (amino-C 1-8 alkyl)(C 1-8 alkyl)amino, C 1-8 alkyl-amino-C 1-8 alkyl-amino, (C 1-8 alkyl-amino-C 1-8 alkyl) 2 -amino, (C 1-8 alkyl-amino-C 1-8 alkyl)(C 1-8 alkyl)amino, (C 1-8 alkyl) 2 -amino-C 1-8 alkyl-amino, [(C 1-8 alkyl) 2 -amino-C 1-8 alkyl](C 1-8 alkyl)amino, amino-C 1-8 alkoxy, C 1-8 alkyl-amino-C 1-8 alkoxy, (C 1-8 alkyl) 2 -amino-C 1-8 alkoxy, C 1-8 alkoxy-C 1-8 alkyl-amino-C 1-8 alkoxy, (C 1-8 alkoxy-C 1-8 alkyl) 2 -amino-C 1-8 alkoxy, (C 1-8 alkoxy-C 1-8 alkyl)(C 1-8 alkyl)amino-C 1-8 alkoxy, amino-C 2-8 alkenyl, C 1-8 alkyl-amino-C 2-8 alkenyl, (C 1-8 alkyl) 2 -amino-C 2-8 alkenyl, amino-C 2-8 alkynyl, C 1-8 alkyl-amino-C 2-8 alkynyl, (C 1-8 alkyl) 2 -amino-C 2-8 alkynyl, halo-C 1-8 alkyl-amino, (halo-C 1-8 alkyl) 2 -amino, (halo-C 1-8 alkyl)(C 1-8 alkyl)amino, hydroxy-C 1-8 alkyl, hydroxy-C 1-8 alkoxy-C 1-8 alkyl, hydroxy-C 1-8 alkyl-amino, (hydroxy-C 1-8 alkyl) 2 -amino, (hydroxy-C 1-8 alkyl)(C 1-8 alkyl)amino, hydroxy-C 1-8 alkyl-amino-C 1-8 alkyl, (hydroxy-C 1-8 alkyl) 2 -amino-C 1-8 alkyl, (hydroxy-C 1-8 alkyl)(C 1-8 alkyl)amino-C 1-8 alkyl, hydroxy-C 1-8 alkyl-amino-C 1-8 alkoxy, (hydroxy-C 1-8 alkyl) 2 -amino-C 1-8 alkoxy, (hydroxy-C 1-8 alkyl)(C 1-8 alkyl)amino-C 1-8 alkoxy, hydroxy-C 1-8 alkyl-amino-C 1-8 alkyl-amino, (hydroxy-C 1-8 alkyl-amino-C 1-8 alkyl) 2 -amino, (hydroxy-C 1-8 alkyl) 2 -amino-C 1-8 alkyl-amino, (hydroxy-C 1-8 alkyl-amino-C 1-8 alkyl)(C 1-8 alkyl)amino, (hydroxy-C 1-8 alkyl)(C 1-8 alkyl)amino-C 1-8 alkyl-amino, [(hydroxy-C 1-8 alkyl) 2 -amino-C 1-8 alkyl](C 1-8 alkyl)amino, [(hydroxy-C 1-8 alkyl)(C 1-8 alkyl)amino-C 1-8 alkyl](C 1-8 alkyl)amino, heterocyclyl, heterocyclyl-C 1-8 alkyl, heterocyclyl-C 1-8 alkoxy, heterocyclyl-amino, (heterocyclyl)(C 1-8 alkyl)amino, heterocyclyl-amino-C 1-8 alkyl, heterocyclyl-C 1-8 alkyl-amino, (heterocyclyl-C 1-8 alkyl) 2 -amino, (heterocyclyl-C 1-8 alkyl)(C 1-8 alkyl)amino, heterocyclyl-C 1-8 alkyl-amino-C 1-8 alkyl, (heterocyclyl-C 1-8 alkyl) 2 -amino-C 1-8 alkyl, (heterocyclyl-C 1-8 alkyl)(C 1-8 alkyl)amino-C 1-8 alkyl, heterocyclyl-oxy, heterocyclyl-carbonyl, heterocyclyl-carbonyl-oxy, C 3-14 cycloalkyl, aryl-C 1-8 alkyl-amino, (aryl-C 1-8 alkyl) 2 -amino, (aryl-C 1-8 alkyl)(C 1-8 alkyl)amino, aryl-C 1-8 alkyl-amino-C 1-8 alkyl, (aryl-C 1-8 alkyl) 2 -amino-C 1-8 alkyl, (aryl-C 1-8 alkyl)(C 1-8 alkyl)amino-C 1-8 alkyl, heteroaryl, heteroaryl-C 1-8 alkyl, heteroaryl-C 1-8 alkoxy, heteroaryl-amino, heteroaryl-C 1-8 alkyl-amino, (heteroaryl-C 1-8 alkyl) 2 -amino, (heteroaryl-C 1-8 alkyl)(C 1-8 alkyl)amino, heteroaryl-C 1-8 alkyl-amino-C 1-8 alkyl, (heteroaryl-C 1-8 alkyl) 2 -amino-C 1-8 alkyl or (heteroaryl-C 1-8 alkyl)(C 1-8 alkyl)amino-C 1-8 alkyl; wherein, each instance of heterocyclyl, C 3-14 cycloalkyl, aryl and heteroaryl is optionally substituted with R 3 and R 4 substituents.

In another embodiment of a compound of Formula (I),

R 1 is amino, (C 1-8 alkyl) 2 -amino, C 1-8 alkoxy-C 1-8 alkyl-amino, (C 1-8 alkoxy-C 1-8 alkyl) 2 -amino, amino-C 1-8 alkyl, C 1-8 alkyl-amino-C 1-8 alkyl, (C 1-8 alkyl) 2 -amino-C 1-8 alkyl, C 1-8 alkoxy-C 1-8 alkyl-amino-C 1-8 alkyl, (C 1-8 alkoxy-C 1-8 alkyl) 2 -amino-C 1-8 alkyl, (C 1-8 alkoxy-C 1-8 alkyl)(C 1-8 alkyl)amino-C 1-8 alkyl, amino-C 1-8 alkyl-amino, (amino-C 1-8 alkyl) 2 -amino, (amino-C 1-8 alkyl)(C 1-8 alkyl)amino, C 1-8 alkyl-amino-C 1-8 alkyl-amino, (C 1-8 alkyl-amino-C 1-8 alkyl) 2 -amino, (C 1-8 alkyl-amino-C 1-8 alkyl)(C 1-8 alkyl)amino, (C 1-8 alkyl) 2 -amino-C 1-8 alkyl-amino, [(C 1-8 alkyl) 2 -amino-C 1-8 alkyl](C 1-8 alkyl)amino, amino-C 1-8 alkoxy, C 1-8 alkyl-amino-C 1-8 alkoxy, (C 1-8 alkyl) 2 -amino-C 1-8 alkoxy, C 1-8 alkoxy-C 1-8 alkyl-amino-C 1-8 alkoxy, (C 1-8 alkoxy-C 1-8 alkyl) 2 -amino-C 1-8 alkoxy, (C 1-8 alkoxy-C 1-8 alkyl)(C 1-8 alkyl)amino-C 1-8 alkoxy, amino-C 2-8 alkenyl, C 1-8 alkyl-amino-C 2-8 alkenyl, (C 1-8 alkyl) 2 -amino-C 2-8 alkenyl, amino-C 2-8 alkynyl, C 1-8 alkyl-amino-C 2-8 alkynyl, (C 1-8 alkyl) 2 -amino-C 2-8 alkynyl, halo-C 1-8 alkyl-amino, (halo-C 1-8 alkyl) 2 -amino, (halo-C 1-8 alkyl)(C 1-8 alkyl)amino, hydroxy-C 1-8 alkyl, hydroxy-C 1-8 alkoxy-C 1-8 alkyl, hydroxy-C 1-8 alkyl-amino, (hydroxy-C 1-8 alkyl) 2 -amino, (hydroxy-C 1-8 alkyl)(C 1-8 alkyl)amino, hydroxy-C 1-8 alkyl-amino-C 1-8 alkyl, (hydroxy-C 1-8 alkyl) 2 -amino-C 1-8 alkyl, (hydroxy-C 1-8 alkyl)(C 1-8 alkyl)amino-C 1-8 alkyl, hydroxy-C 1-8 alkyl-amino-C 1-8 alkoxy, (hydroxy-C 1-8 alkyl) 2 -amino-C 1-8 alkoxy, (hydroxy-C 1-8 alkyl)(C 1-8 alkyl)amino-C 1-8 alkoxy, hydroxy-C 1-8 alkyl-amino-C 1-8 alkyl-amino, (hydroxy-C 1-8 alkyl-amino-C 1-8 alkyl) 2 -amino, (hydroxy-C 1-8 alkyl) 2 -amino-C 1-8 alkyl-amino, (hydroxy-C 1-8 alkyl-amino-C 1-8 alkyl)(C 1-8 alkyl)amino, (hydroxy-C 1-8 alkyl)(C 1-8 alkyl)amino-C 1-8 alkyl-amino, [(hydroxy-C 1-8 alkyl) 2 -amino-C 1-8 alkyl](C 1-8 alkyl)amino, [(hydroxy-C 1-8 alkyl)(C 1-8 alkyl)amino-C 1-8 alkyl](C 1-8 alkyl)amino, heterocyclyl, heterocyclyl-C 1-8 alkyl, heterocyclyl-C 1-8 alkoxy, heterocyclyl-amino, (heterocyclyl)(C 1-8 alkyl)amino, heterocyclyl-amino-C 1-8 alkyl, heterocyclyl-C 1-8 alkyl-amino, (heterocyclyl-C 1-8 alkyl) 2 -amino, (heterocyclyl-C 1-8 alkyl)(C 1-8 alkyl)amino, heterocyclyl-C 1-8 alkyl-amino-C 1-8 alkyl, (heterocyclyl-C 1-8 alkyl) 2 -amino-C 1-8 alkyl, (heterocyclyl-C 1-8 alkyl)(C 1-8 alkyl)amino-C 1-8 alkyl, heterocyclyl-oxy, heterocyclyl-carbonyl, heterocyclyl-carbonyl-oxy, C 3-14 cycloalkyl, aryl-C 1-8 alkyl-amino, (aryl-C 1-8 alkyl) 2 -amino, (aryl-C 1-8 alkyl)(C 1-8 alkyl)amino, aryl-C 1-8 alkyl-amino-C 1-8 alkyl, (aryl-C 1-8 alkyl) 2 -amino-C 1-8 alkyl, (aryl-C 1-8 alkyl)(C 1-8 alkyl)amino-C 1-8 alkyl, heteroaryl, heteroaryl-C 1-8 alkyl, heteroaryl-C 1-8 alkoxy, heteroaryl-C 1-8 alkyl-amino, (heteroaryl-C 1-8 alkyl) 2 -amino, (heteroaryl-C 1-8 alkyl)(C 1-8 alkyl)amino, heteroaryl-C 1-8 alkyl-amino-C 1-8 alkyl, (heteroaryl-C 1-8 alkyl) 2 -amino-C 1-8 alkyl or (heteroaryl-C 1-8 alkyl)(C 1-8 alkyl)amino-C 1-8 alkyl; wherein, each instance of heterocyclyl, C 3-14 cycloalkyl, aryl and heteroaryl is optionally substituted with R 3 and R 4 substituents.

›EMBODIMENTS · 2 of 13

In another embodiment of a compound of Formula (I),

In another embodiment of a compound of Formula (I), R 1 is heterocyclyl optionally substituted with R 3 and R 4 substituents.

In another embodiment of a compound of Formula (I), R 1 is C 3-14 cycloalkyl optionally substituted with R 3 and R 4 substituents.

In another embodiment of a compound of Formula (I),

In another embodiment of a compound of Formula (I), R 1 is aryl-C 1-8 alkyl-amino optionally substituted with R 3 and R 4 substituents.

In another embodiment of a compound of Formula (I),

In another embodiment of a compound of Formula (I), R 1 is heteroaryl optionally substituted with R 3 and R 4 substituents.

In one embodiment of a compound of Formula (I),

R 1 is heterocyclyl selected from azetidinyl, tetrahydrofuranyl, pyrrolidinyl, piperidinyl, piperazinyl, 1,4-diazepanyl, 1,2,5,6-tetrahydropyridinyl, 1,2,3,6-tetrahydropyridinyl, hexahydropyrrolo[3,4-b]pyrrol-(1H)-yl, (3aS,6aS)-hexahydropyrrolo[3,4-b]pyrrol-(1H)-yl, (3aR,6aR)-hexahydropyrrolo[3,4-b]pyrrol-(1H)-yl, hexahydropyrrolo[3,4-b]pyrrol-(2H)-yl, (3aS,6aS)-hexahydropyrrolo[3,4-b]pyrrol-(2H)-yl, hexahydropyrrolo[3,4-c]pyrrol-(1H)-yl, (3aR,6aS)-hexahydropyrrolo[3,4-c]pyrrol-(1H)-yl, octahydro-5H-pyrrolo[3,2-c]pyridinyl, octahydro-6H-pyrrolo[3,4-b]pyridinyl, (4aR,7aR)-octahydro-6H-pyrrolo[3,4-b]pyridinyl, (4aS,7aS)-octahydro-6H-pyrrolo[3,4-b]pyridinyl, hexahydropyrrolo[1,2-a]pyrazin-(2H)-one, hexahydropyrrolo[1,2-a]pyrazin-(1H)-yl, (7R,8aS)-hexahydropyrrolo[1,2-a]pyrazin-(1H)-yl, (8aS)-hexahydropyrrolo[1,2-a]pyrazin-(1H)-yl, (8aR)-hexahydropyrrolo[1,2-a]pyrazin-(1H)-yl, (8aS)-octahydropyrrolo[1,2-a]pyrazin-(1H)-yl, (8aR)-octahydropyrrolo[1,2-a]pyrazin-(1H)-yl, octahydro-2H-pyrido[1,2-a]pyrazinyl, 3-azabicyclo[3.1.0]hexyl, (1R,5S)-3-azabicyclo[3.1.0]hexyl, 8-azabicyclo[3.2.1]octyl, (1R,5S)-8-azabicyclo[3.2.1]octyl, 8-azabicyclo[3.2.1]oct-2-enyl, (1R,5S)-8-azabicyclo[3.2.1]oct-2-enyl, 9-azabicyclo[3.3.1]nonyl, (1R,5S)-9-azabicyclo[3.3.1]nonyl, 2,5-diazabicyclo[2.2.1]heptyl, (1S,4S)-2,5-diazabicyclo[2.2.1]heptyl, 2,5-diazabicyclo[2.2.2]octyl, 3,8-diazabicyclo[3.2.1]octyl, (1R,5S)-3,8-diazabicyclo[3.2.1]octyl, 1,4-diazabicyclo[3.2.2]nonyl, azaspiro[3.3]heptyl, 2,6-diazaspiro[3.3]heptyl, 2,7-diazaspiro[3.5]nonyl, 5,8-diazaspiro[3.5]nonyl, 2,7-diazaspiro[4.4]nonyl or 6,9-diazaspiro[4.5]decyl; wherein, each instance of heterocyclyl is optionally substituted with R 3 and R 4 substituents.

›EMBODIMENTS · 3 of 13

In another embodiment of a compound of Formula (I),

R 1 is heterocyclyl selected from azetidin-1-yl, tetrahydrofuran-3-yl, pyrrolidin-1-yl, piperidin-1-yl, piperidin-4-yl, piperazin-1-yl, 1,4-diazepan-1-yl, 1,2,5,6-tetrahydropyridin-5-yl, 1,2,3,6-tetrahydropyridin-4-yl, hexahydropyrrolo[3,4-b]pyrrol-1(2H)-yl, (3aS,6aS)-hexahydropyrrolo[3,4-b]pyrrol-1(2H)-yl, (3aS,6aS)-hexahydropyrrolo[3,4-b]pyrrol-5(1H)-yl, (3aR,6aR)-hexahydropyrrolo[3,4-b]pyrrol-5(1H)-yl, hexahydropyrrolo[3,4-c]pyrrol-2(1H)-yl, (3aR,6aS)-hexahydropyrrolo[3,4-c]pyrrol-2(1H)-yl, octahydro-5H-pyrrolo[3,2-c]pyridin-5-yl, octahydro-6H-pyrrolo[3,4-b]pyridin-6-yl, (4aR,7aR)-octahydro-6H-pyrrolo[3,4-b]pyridin-6-yl, (4aS,7aS)-octahydro-6H-pyrrolo[3,4-b]pyridin-6-yl, hexahydropyrrolo[1,2-a]pyrazin-6(2H)-one, hexahydropyrrolo[1,2-a]pyrazin-2(1H)-yl, (7R,8aS)-hexahydropyrrolo[1,2-a]pyrazin-2(1H)-yl, (8aS)-hexahydropyrrolo[1,2-a]pyrazin-2(1H)-yl, (8aR)-hexahydropyrrolo[1,2-a]pyrazin-2(1H)-yl, (8aS)-octahydropyrrolo[1,2-a]pyrazin-2(1H)-yl, (8aR)-octahydropyrrolo[1,2-a]pyrazin-2(1H)-yl, octahydro-2H-pyrido[1,2-a]pyrazin-2-yl, 3-azabicyclo[3.1.0]hex-3-yl, 8-azabicyclo[3.2.1]oct-3-yl, (1R,5S)-8-azabicyclo[3.2.1]oct-3-yl, 8-azabicyclo[3.2.1]oct-2-en-3-yl, (1R,5S)-8-azabicyclo[3.2.1]oct-2-en-3-yl, 9-azabicyclo[3.3.1]non-3-yl, (1R,5S)-9-azabicyclo[3.3.1]non-3-yl, 2,5-diazabicyclo[2.2.1]hept-2-yl, (1S,4S)-2,5-diazabicyclo[2.2.1]hept-2-yl, 2,5-diazabicyclo[2.2.2]oct-2-yl, 3,8-diazabicyclo[3.2.1]oct-3-yl, (1R,5S)-3,8-diazabicyclo[3.2.1]oct-3-yl, 1,4-diazabicyclo[3.2.2]non-4-yl, azaspiro[3.3]hept-2-yl, 2,6-diazaspiro[3.3]hept-2-yl, 2,7-diazaspiro[3.5]non-7-yl, 5,8-diazaspiro[3.5]non-8-yl, 2,7-diazaspiro[4.4]non-2-yl or 6,9-diazaspiro[4.5]dec-9-yl; wherein, each instance of heterocyclyl is optionally substituted with R 3 and R 4 substituents.

In another embodiment of a compound of Formula (I),

R 1 is substituted heterocyclyl selected from 4-methyl-1,4-diazepan-1-yl, (3aS,6aS)-1-methylhexahydropyrrolo[3,4-b]pyrrol-5(1H)-yl, (3aS,6aS)-5-methylhexahydropyrrolo[3,4-b]pyrrol-1(2H)-yl, (3aR,6aR)-1-methylhexahydropyrrolo[3,4-b]pyrrol-5(1H)-yl, (3aR,6aS)-5-methylhexahydropyrrolo[3,4-c]pyrrol-2(1H)-yl, (3aR,6aS)-5-(2-hydroxyethyl)hexahydropyrrolo[3,4-c]pyrrol-2(1H)-yl, (3aR,6aS)-5-(propan-2-yl)hexahydropyrrolo[3,4-c]pyrrol-2(1H)-yl, (3aR,6aS)-5-ethylhexahydropyrrolo[3,4-c]pyrrol-2(1H)-yl, (4aR,7aR)-1-methyloctahydro-6H-pyrrolo[3,4-b]pyridin-6-yl, (4aR,7aR)-1-ethyloctahydro-6H-pyrrolo[3,4-b]pyridin-6-yl, (4aR,7aR)-1-(2-hydroxyethyl)octahydro-6H-pyrrolo[3,4-b]pyridin-6-yl, (4aS,7aS)-1-methyloctahydro-6H-pyrrolo[3,4-b]pyridin-6-yl, (4aS,7aS)-1-(2-hydroxyethyl)octahydro-6H-pyrrolo[3,4-b]pyridin-6-yl, (7R,8aS)-7-hydroxyhexahydropyrrolo[1,2-a]pyrazin-2(1H)-yl, (8aS)-8a-methyloctahydropyrrolo[1,2-a]pyrazin-2(1H)-yl, (8aR)-8a-methyloctahydropyrrolo[1,2-a]pyrazin-2(1H)-yl, (1R,5S,6s)-6-(dimethylamino)-3-azabicyclo[3.1.0]hex-3-yl, (1R,5S)-8-methyl-8-azabicyclo[3.2.1]oct-3-yl, 9-methyl-9-azabicyclo[3.3.1]non-3-yl, (3-exo)-9-methyl-9-azabicyclo[3.3.1]non-3-yl, (1R,5S)-9-methyl-9-azabicyclo[3.3.1]non-3-yl, (1S,4S)-5-methyl-2,5-diazabicyclo[2.2.1]hept-2-yl or (1S,4S)-5-ethyl-2,5-diazabicyclo[2.2.1]hept-2-yl.

In one embodiment of a compound of Formula (I), R 1 is heterocyclyl-C 1-8 alkyl, wherein heterocyclyl is selected from morpholinyl, piperidinyl, piperazinyl, imidazolyl or pyrrolidinyl; and, wherein, each instance of heterocyclyl is optionally substituted with R 3 and R 4 substituents.

In another embodiment of a compound of Formula (I), R 1 is heterocyclyl-C 1-8 alkyl selected from morpholin-4-yl-methyl, morpholin-4-yl-ethyl, morpholin-4-yl-propyl, piperidin-1-yl-methyl, piperazin-1-yl-methyl, piperazin-1-yl-ethyl, piperazin-1-yl-propyl, piperazin-1-yl-butyl, imidazol-1-yl-methyl, imidazol-1-yl-ethyl, imidazol-1-yl-propyl, imidazol-1-yl-butyl, pyrrolidin-1-yl-methyl, pyrrolidin-1-yl-ethyl, pyrrolidin-1-yl-propyl or pyrrolidin-1-yl-butyl; wherein, each instance of heterocyclyl is optionally substituted with R 3 and R 4 substituents.

In one embodiment of a compound of Formula (I), R 1 is heterocyclyl-C 1-8 alkoxy, wherein heterocyclyl is selected from pyrrolidinyl, piperidinyl or morpholinyl; and, wherein, each instance of heterocyclyl is optionally substituted with R 3 and R 4 substituents.

In another embodiment of a compound of Formula (I), R 1 is heterocyclyl-C 1-8 alkoxy selected from pyrrolidin-2-yl-methoxy, pyrrolidin-2-yl-ethoxy, pyrrolidin-1-yl-methoxy, pyrrolidin-1-yl-ethoxy, piperidin-1-yl-methoxy, piperidin-1-yl-ethoxy, morpholin-4-yl-methoxy or morpholin-4-yl-ethoxy; wherein, each instance of heterocyclyl is optionally substituted with R 3 and R 4 substituents.

In one embodiment of a compound of Formula (I), R 1 is heterocyclyl-amino, wherein heterocyclyl is selected from azetidinyl, pyrrolidinyl, piperidinyl, 9-azabicyclo[3.3.1]nonyl or (1R,5S)-9-azabicyclo[3.3.1]nonyl; and, wherein, each instance of heterocyclyl is optionally substituted with R 3 and R 4 substituents.

In another embodiment of a compound of Formula (I), R 1 is heterocyclyl-amino selected from azetidin-3-yl-amino, pyrrolidin-3-yl-amino, piperidin-4-yl-amino, 9-azabicyclo[3.3.1]non-3-yl-amino, (1R,5S)-9-azabicyclo[3.3.1]non-3-yl-amino, 9-methyl-9-azabicyclo[3.3.1]non-3-yl-amino, (3-exo)-9-methyl-9-azabicyclo[3.3.1]non-3-yl-amino or (1R,5S)-9-methyl-9-azabicyclo[3.3.1]non-3-yl-amino; wherein, each instance of heterocyclyl is optionally substituted with R 3 and R 4 substituents.

In one embodiment of a compound of Formula (I), R 1 is (heterocyclyl)(C 1-8 alkyl)amino, wherein heterocyclyl is selected from pyrrolidinyl or piperidinyl; and, wherein, each instance of heterocyclyl is optionally substituted with R 3 and R 4 substituents.

In another embodiment of a compound of Formula (I), R 1 is (heterocyclyl)(C 1-8 alkyl)amino selected from (pyrrolidin-3-yl)(methyl)amino or (piperidin-4-yl)(methyl)amino; wherein, each instance of heterocyclyl is optionally substituted with R 3 and R 4 substituents.

In one embodiment of a compound of Formula (I), R 1 is heterocyclyl-amino-C 1-8 alkyl, wherein heterocyclyl is selected from tetrahydrofuranyl; and, wherein, each instance of heterocyclyl is optionally substituted with R 3 and R 4 substituents.

›EMBODIMENTS · 4 of 13

In another embodiment of a compound of Formula (I), R 1 is heterocyclyl-amino-C 1-8 alkyl, selected from 3-(tetrahydrofuran-3-yl-amino)propyl; wherein, each instance of heterocyclyl is optionally substituted with R 3 and R 4 substituents.

In one embodiment of a compound of Formula (I), R 1 is heterocyclyl-C 1-8 alkyl-amino-C 1-8 alkyl, wherein heterocyclyl is selected from tetrahydrofuranyl, thienyl or pyridinyl; and, wherein, each instance of heterocyclyl is optionally substituted with R 3 and R 4 substituents.

In another embodiment of a compound of Formula (I), R 1 is heterocyclyl-C 1-8 alkyl-amino-C 1-8 alkyl, selected from 3-[(tetrahydrofuran-2-ylmethyl)amino]propyl, 3-[(thienyl-3-ylmethyl)amino]propyl, 3-[(pyridin-2-ylmethyl)amino]propyl or 3-[(pyridin-4-ylmethyl)amino]propyl; wherein, each instance of heterocyclyl is optionally substituted with R 3 and R 4 substituents.

In one embodiment of a compound of Formula (I), R 1 is heterocyclyl-oxy, wherein heterocyclyl is selected from pyrrolidinyl or piperidinyl; and, wherein, each instance of heterocyclyl is optionally substituted with R 3 and R 4 substituents.

In another embodiment of a compound of Formula (I), R 1 is heterocyclyl-oxy selected from pyrrolidin-3-yl-oxy or piperidin-4-yl-oxy; wherein, each instance of heterocyclyl is optionally substituted with R 3 and R 4 substituents.

In one embodiment of a compound of Formula (I), R 1 is heterocyclyl-carbonyl, wherein heterocyclyl is selected from piperazinyl; and, wherein, each instance of heterocyclyl is optionally substituted with R 3 and R 4 substituents.

In another embodiment of a compound of Formula (I), R 1 is heterocyclyl-carbonyl selected from piperazin-1-yl-carbonyl; wherein, each instance of heterocyclyl is optionally substituted with R 3 and R 4 substituents.

In one embodiment of a compound of Formula (I), R 1 is heterocyclyl-carbonyl-oxy, wherein heterocyclyl is selected from piperazinyl; and, wherein, each instance of heterocyclyl is optionally substituted with R 3 and R 4 substituents.

In another embodiment of a compound of Formula (I), R 1 is heterocyclyl-carbonyl-oxy selected from piperazin-1-yl-carbonyl-oxy; wherein, each instance of heterocyclyl is optionally substituted with R 3 and R 4 substituents.

In one embodiment of a compound of Formula (I), R 1 is C 3-14 cycloalkyl selected from cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cyclohexenyl or cycloheptyl; wherein, each instance of C 3-14 cycloalkyl is optionally substituted with R 3 and R 4 substituents.

In another embodiment of a compound of Formula (I), R 1 is C 3-8 cycloalkyl selected from cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cyclohexenyl or cycloheptyl; wherein, each instance of C 3-8 cycloalkyl is optionally substituted with R 3 and R 4 substituents.

In one embodiment of a compound of Formula (I), R 1 is aryl-C 1-8 alkyl-amino-C 1-8 alkyl, wherein aryl is selected from phenyl; and, wherein, each instance of aryl is optionally substituted with R 3 and R 4 substituents.

In another embodiment of a compound of Formula (I), R 1 is aryl-C 1-8 alkyl-amino-C 1-8 alkyl selected from 3-(benzylamino)propyl; wherein, each instance of aryl is optionally substituted with R 3 and R 4 substituents.

In one embodiment of a compound of Formula (I), R 1 is heteroaryl, wherein heteroaryl is selected from pyridinyl; and, wherein, each instance of heteroaryl is optionally substituted with R 3 and R 4 substituents.

In another embodiment of a compound of Formula (I), R 1 is heteroaryl selected from pyridin-4-yl; wherein, each instance of heteroaryl is optionally substituted with R 3 and R 4 substituents.

In one embodiment of a compound of Formula (I), R 1 is heteroaryl-C 1-8 alkyl, wherein heteroaryl is selected from 1H-imidazolyl; and, wherein, each instance of heteroaryl is optionally substituted with R 3 and R 4 substituents.

In another embodiment of a compound of Formula (I), R 1 is heteroaryl-C 1-8 alkyl selected from 1H-imidazol-1-yl-methyl; wherein, each instance of heteroaryl is optionally substituted with R 3 and R 4 substituents.

In one embodiment of a compound of Formula (I), R 1 is (heteroaryl-C 1-8 alkyl)(C 1-8 alkyl)amino, wherein heteroaryl is selected from pyridinyl; and, wherein, each instance of heteroaryl is optionally substituted with R 3 and R 4 substituents.

In another embodiment of a compound of Formula (I), R 1 is (heteroaryl-C 1-8 alkyl)(C 1-8 alkyl)amino selected from (pyridin-3-ylmethyl)(methyl)amino; wherein, each instance of heteroaryl is optionally substituted with R 3 and R 4 substituents.

In one embodiment of a compound of Formula (I), R 1 is heteroaryl-C 1-8 alkyl-amino-C 1-8 alkyl, wherein heteroaryl is selected from thienyl or pyridinyl; and, wherein, each instance of heteroaryl is optionally substituted with R 3 and R 4 substituents.

In another embodiment of a compound of Formula (I), R 1 is heteroaryl-C 1-8 alkyl-amino-C 1-8 alkyl selected from thien-3-yl-methyl-amino-propyl, pyridin-2-yl-methyl-amino-propyl, pyridin-3-yl-methyl-amino-propyl or pyridin-4-yl-methyl-amino-propyl; wherein, each instance of heteroaryl is optionally substituted with R 3 and R 4 substituents.

In one embodiment of a compound of Formula (I), R 3 is selected from cyano, halogen, hydroxy, oxo, C 1-8 alkyl, halo-C 1-8 alkyl, C 1-8 alkyl-carbonyl, C 1-8 alkoxy, halo-C 1-8 alkoxy, C 1-8 alkoxy-C 1-8 alkyl, C 1-8 alkoxy-carbonyl, amino, C 1-8 alkyl-amino, (C 1-8 alkyl) 2 -amino, amino-C 1-8 alkyl, C 1-8 alkyl-amino-C 1-8 alkyl, (C 1-8 alkyl) 2 -amino-C 1-8 alkyl, amino-C 1-8 alkyl-amino, C 1-8 alkyl-amino-C 1-8 alkyl-amino, (C 1-8 alkyl) 2 -amino-C 1-8 alkyl-amino, C 1-8 alkoxy-C 1-8 alkyl-amino, C 1-8 alkyl-carbonyl-amino, C 1-8 alkoxy-carbonyl-amino, hydroxy-C 1-8 alkyl, hydroxy-C 1-8 alkoxy-C 1-8 alkyl, hydroxy-C 1-8 alkyl-amino, (hydroxy-C 1-8 alkyl) 2 -amino or (hydroxy-C 1-8 alkyl)(C 1-8 alkyl)amino.

In another embodiment of a compound of Formula (I), R 3 is selected from cyano, halogen, hydroxy, oxo, C 1-8 alkyl, halo-C 1-8 alkyl, C 1-8 alkoxy, C 1-8 alkoxy-C 1-8 alkyl, C 1-8 alkoxy-carbonyl, amino, C 1-8 alkyl-amino, (C 1-8 alkyl) 2 -amino, amino-C 1-8 alkyl, C 1-8 alkyl-amino-C 1-8 alkyl, (C 1-8 alkyl) 2 -amino-C 1-8 alkyl, C 1-8 alkyl-amino-C 1-8 alkyl-amino, C 1-8 alkoxy-C 1-8 alkyl-amino, C 1-8 alkoxy-carbonyl-amino, hydroxy-C 1-8 alkyl, hydroxy-C 1-8 alkoxy-C 1-8 alkyl, hydroxy-C 1-8 alkyl-amino, (hydroxy-C 1-8 alkyl) 2 -amino or (hydroxy-C 1-8 alkyl)(C 1-8 alkyl)amino.

›EMBODIMENTS · 5 of 13

In one embodiment of a compound of Formula (I), R 3 is C 1-8 alkyl selected from methyl, ethyl, propyl, isopropyl or tert-butyl.

In another embodiment of a compound of Formula (I), R 3 is C 1-8 alkyl selected from ethyl, propyl, isopropyl or tert-butyl.

In one embodiment of a compound of Formula (I), R 3 is halo-C 1-8 alkyl selected from trihalo-methyl, dihalo-methyl, halo-methyl, trihalo-ethyl, dihalo-ethyl, halo-ethyl, trihalo-propyl, dihalo-propyl or halo-propyl; wherein, halo is selected from fluoro, chloro, bromo or iodo.

In another embodiment of a compound of Formula (I), R 3 is halo-C 1-8 alkyl selected from trihalo-methyl, dihalo-methyl, halo-methyl, trihalo-ethyl, dihalo-ethyl, trihalo-propyl or dihalo-propyl; wherein, halo is selected from fluoro, chloro, bromo or iodo.

In one embodiment of a compound of Formula (I), R 3 is hydroxy-C 1-8 alkyl selected from hydroxy-methyl, hydroxy-ethyl, hydroxy-propyl, dihydroxy-propyl, hydroxy-butyl or dihydroxy-butyl.

In another embodiment of a compound of Formula (I), R 3 is hydroxy-C 1-8 alkyl selected from hydroxy-methyl, dihydroxy-propyl, hydroxy-butyl or dihydroxy-butyl.

In one embodiment of a compound of Formula (I), R 3 is C 1-8 alkoxy selected from methoxy, ethoxy, propoxy or isopropoxy.

In one embodiment of a compound of Formula (I), R 3 is halo-C 1-8 alkoxy selected from trihalo-methoxy, dihalo-methoxy, halo-methoxy, trihalo-ethoxy, dihalo-ethoxy, halo-ethoxy, trihalo-propoxy, dihalo-propoxy or halo-propoxy; wherein, halo is selected from fluoro, chloro, bromo or iodo.

In one embodiment of a compound of Formula (I), R 3 is C 1-8 alkoxy-carbonyl-amino selected from methoxy-carbonyl-amino, ethoxy-carbonyl-amino, propoxy-carbonyl-amino, isopropoxy-carbonyl-amino, tert-butoxy-carbonyl-amino.

In one embodiment of a compound of Formula (I), R 4 is C 3-14 cycloalkyl selected from cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl or cycloheptyl; wherein, each instance of C 3-14 cycloalkyl is optionally substituted with R 5 substituents.

In another embodiment of a compound of Formula (I), R 4 is C 3-8 cycloalkyl selected from cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl or cycloheptyl; wherein, each instance of C 3-8 cycloalkyl is optionally substituted with R 5 substituents.

In one embodiment of a compound of Formula (I), R 4 is C 3-14 cycloalkyl-C 1-8 alkyl, wherein C 3-14 cycloalkyl is selected from cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl or cycloheptyl; and, wherein, each instance of C 3-14 cycloalkyl is optionally substituted with R 5 substituents.

In another embodiment of a compound of Formula (I), R 4 is C 3-8 cycloalkyl-C 1-8 alkyl, wherein C 3-8 cycloalkyl is selected from cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl or cycloheptyl; and, wherein, each instance of C 3-8 cycloalkyl is optionally substituted with R 5 substituents.

In one embodiment of a compound of Formula (I), R 4 is C 3-14 cycloalkyl-amino, wherein C 3-14 cycloalkyl is selected from cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl or cycloheptyl; and, wherein, each instance of C 3-14 cycloalkyl is optionally substituted with R 5 substituents.

In another embodiment of a compound of Formula (I), R 4 is C 3-8 cycloalkyl-amino, wherein C 3-8 cycloalkyl is selected from cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl or cycloheptyl; and, wherein, each instance of C 3-8 cycloalkyl is optionally substituted with R 5 substituents.

In one embodiment of a compound of Formula (I), R 4 is aryl-C 1-8 alkyl, aryl-C 1-8 alkoxy-carbonyl or aryl-sulfonyloxy-C 1-8 alkyl, wherein aryl is selected from phenyl; and, wherein, each instance of aryl is optionally substituted with R 5 substituents.

In another embodiment of a compound of Formula (I), R 4 is aryl-C 1-8 alkyl or aryl-C 1-8 alkoxy-carbonyl, wherein each instance of aryl is optionally substituted with R 5 substituents.

In one embodiment of a compound of Formula (I), R 4 is heterocyclyl selected from oxetanyl, pyrrolidinyl, piperidinyl, piperazinyl, 1,3-dioxanyl or morpholinyl, wherein each instance of heterocyclyl is optionally substituted with R 5 substituents.

In another embodiment of a compound of Formula (I), R 4 is heterocyclyl selected from oxetan-3-yl, pyrrolidin-1-yl, piperidin-1-yl, piperazin-1-yl, 1,3-dioxan-5-yl or morpholin-4-yl, wherein each instance of heterocyclyl is optionally substituted with R 5 substituents.

In one embodiment of a compound of Formula (I), R 4 is heterocyclyl-C 1-8 alkyl, wherein each instance of heterocyclyl is selected from pyrrolidinyl or piperidinyl; and, wherein, each instance of heterocyclyl is optionally substituted with R 5 substituents.

In another embodiment of a compound of Formula (I), R 4 is heterocyclyl-C 1-8 alkyl selected from pyrrolidin-1-yl-C 1-8 alkyl or piperidin-1-yl-C 1-8 alkyl, wherein each instance of heterocyclyl is optionally substituted with R 5 substituents.

In one embodiment of a compound of Formula (I), R 5 is selected from halogen, hydroxy, cyano, nitro, halo-C 1-8 alkyl, C 1-8 alkoxy, halo-C 1-8 alkoxy, amino, C 1-8 alkyl-amino, (C 1-8 alkyl) 2 -amino or C 1-8 alkyl-thio; wherein, halogen and halo is selected from fluoro, chloro, bromo or iodo.

In one embodiment of a compound of Formula (I), R 5 is hydroxy.

In one embodiment of a compound of Formula (I), R 5 is C 1-8 alkyl selected from methyl, ethyl, propyl, isopropyl, n-butyl or tert-butyl.

In another embodiment of a compound of Formula (I), R 5 is C 1-8 alkyl selected from ethyl, propyl, isopropyl or tert-butyl.

In one embodiment of a compound of Formula (I), R 5 is halo-C 1-8 alkyl selected from trihalo-methyl, dihalo-methyl, halo-methyl, trihalo-ethyl, dihalo-ethyl, halo-ethyl, trihalo-propyl, dihalo-propyl or halo-propyl; wherein, halo is selected from fluoro, chloro, bromo or iodo.

In one embodiment of a compound of Formula (I), R 5 is C 1-8 alkoxy selected from methoxy, ethoxy, propoxy or isopropoxy.

In one embodiment of a compound of Formula (I), R 5 is halo-C 1-8 alkoxy selected from trihalo-methoxy, dihalo-methoxy, halo-methoxy, trihalo-ethoxy, dihalo-ethoxy, halo-ethoxy, trihalo-propoxy, dihalo-propoxy or halo-propoxy; wherein, halo is selected from fluoro, chloro, bromo or iodo.

›EMBODIMENTS · 6 of 13

In one embodiment of a compound of Formula (I), R 2 is aryl selected from phenyl optionally substituted with R 6 and R 7 substituents.

In one embodiment of a compound of Formula (I), R 2 is aryl-amino, wherein aryl is selected from phenyl; and, wherein, each instance of aryl is optionally substituted with R 6 and R 7 substituents.

In another embodiment of a compound of Formula (I), R 2 is aryl-amino selected from phenyl-amino; wherein, each instance of aryl is optionally substituted with R 6 and R 7 substituents.

In one embodiment of a compound of Formula (I), R 2 is aryl-amino-carbonyl, wherein aryl is selected from phenyl; and, wherein, each instance of aryl is optionally substituted with R 6 and R 7 substituents.

In another embodiment of a compound of Formula (I), R 2 is aryl-amino-carbonyl selected from phenyl-amino-carbonyl; wherein, each instance of aryl is optionally substituted with R 6 and R 7 substituents.

In one embodiment of a compound of Formula (I),

R 2 is heterocyclyl selected from 1,2,3,6-tetrahydropyridinyl, 1,3-benzodioxolyl or 2,3-dihydro-1,4-benzodioxinyl; wherein, each instance of heterocyclyl is optionally substituted with R 6 and R 7 substituents.

In another embodiment of a compound of Formula (I),

R 2 is heterocyclyl selected from 1,2,3,6-tetrahydropyridin-4-yl, 1,3-benzodioxol-5-yl or 2,3-dihydro-1,4-benzodioxin-6-yl; wherein, each instance of heterocyclyl is optionally substituted with R 6 and R 7 substituents.

In one embodiment of a compound of Formula (I),

R 2 is heteroaryl selected from thienyl, 1H-pyrazolyl, 1H-imidazolyl, 1,3-thiazolyl, 1,2,4-oxadiazolyl, 1,3,4-oxadiazolyl, pyridinyl, pyrimidinyl, 1H-indolyl, 2H-indolyl, 1H-indazolyl, 2H-indazolyl, indolizinyl, benzofuranyl, benzothienyl, 1H-benzimidazolyl, 1,3-benzothiazolyl, 1,3-benzoxazolyl, 9H-purinyl, furo[3,2-b]pyridinyl, furo[3,2-c]pyridinyl, furo[2,3-c]pyridinyl, thieno[3,2-c]pyridinyl, thieno[2,3-d]pyrimidinyl, 1H-pyrrolo[2,3-b]pyridinyl, 1H-pyrrolo[2,3-c]pyridinyl, pyrrolo[1,2-a]pyrimidinyl, pyrrolo[1,2-a]pyrazinyl, pyrrolo[1,2-b]pyridazinyl, pyrazolo[1,5-a]pyridinyl, pyrazolo[1,5-a]pyrazinyl, imidazo[1,2-a]pyridinyl, imidazo[1,2-a]pyrimidinyl, imidazo[1,2-c]pyrimidinyl, imidazo[1,2-b]pyridazinyl, imidazo[1,2-a]pyrazinyl, imidazo[2,1-b][1,3]thiazolyl, imidazo[2,1-b][1,3,4]thiadiazolyl, [1,3]oxazolo[4,5-b]pyridinyl or quinoxalinyl; wherein, each instance of heteroaryl is optionally substituted with R 6 and R 7 substituents.

In another embodiment of a compound of Formula (I),

R 2 is heteroaryl selected from thien-2-yl, thien-3-yl, 1H-pyrazol-3-yl, 1H-pyrazol-4-yl, 1H-pyrazol-5-yl, 1H-imidazol-1-yl, 1H-imidazol-4-yl, 1,3-thiazol-2-yl, 1,2,4-oxadiazol-3-yl, 1,3,4-oxadiazol-2-yl, pyridin-2-yl, pyridin-3-yl, pyridin-4-yl, pyrimidin-4-yl, 1H-indol-3-yl, 1H-indol-4-yl, 1H-indol-5-yl, 1H-indol-6-yl, 1H-indazol-5-yl, 2H-indazol-5-yl, indolizin-2-yl, benzofuran-2-yl, benzofuran-5-yl, benzothien-2-yl, benzothien-3-yl, 1H-benzimidazol-2-yl, 1H-benzimidazol-6-yl, 1,3-benzoxazol-2-yl, 1,3-benzoxazol-5-yl, 1,3-benzoxazol-6-yl, 1,3-benzothiazol-2-yl, 1,3-benzothiazol-5-yl, 1,3-benzothiazol-6-yl, 9H-purin-8-yl, furo[3,2-b]pyridin-2-yl, furo[3,2-c]pyridin-2-yl, furo[2,3-c]pyridin-2-yl, thieno[3,2-c]pyridin-2-yl, thieno[2,3-d]pyrimidin-6-yl, 1H-pyrrolo[2,3-b]pyridin-5-yl, 1H-pyrrolo[2,3-c]pyridin-4-yl, pyrrolo[1,2-a]pyrimidin-7-yl, pyrrolo[1,2-a]pyrazin-7-yl, pyrrolo[1,2-b]pyridazin-2-yl, pyrazolo[1,5-a]pyridin-2-yl, pyrazolo[1,5-a]pyrazin-2-yl, imidazo[1,2-a]pyridin-2-yl, imidazo[1,2-a]pyridin-6-yl, imidazo[1,2-a]pyrimidin-2-yl, imidazo[1,2-a]pyrimidin-6-yl, imidazo[1,2-c]pyrimidin-2-yl, imidazo[1,2-b]pyridazin-2-yl, imidazo[1,2-a]pyrazin-2-yl, imidazo[2,1-b][1,3]thiazol-6-yl, imidazo[2,1-b][1,3,4]thiadiazol-6-yl, [1,3]oxazolo[4,5-b]pyridin-2-yl or quinoxalin-2-yl; wherein, each instance of heteroaryl is optionally substituted with R 6 and R 7 substituents.

In another embodiment of a compound of Formula (I),

R 2 is substituted heteroaryl selected from 4-methylthien-2-yl, 1-methyl-1H-pyrazol-3-yl, 4-methyl-1H-pyrazol-3-yl, 1-phenyl-1H-pyrazol-3-yl, 1-phenyl-1H-imidazol-4-yl, 2-methyl-1-(pyridin-2-yl)-1H-imidazol-4-yl, 4-methyl-1,3-thiazol-2-yl, 4-(trifluoromethyl)-1,3-thiazol-2-yl, 4-phenyl-1,3-thiazol-2-yl, 5-phenyl-1,2,4-oxadiazol-3-yl, 3-fluoropyridin-4-yl, 6-fluoropyridin-2-yl, 2-chloropyridin-4-yl, 4-chloropyridin-3-yl, 5-chloropyridin-2-yl, 6-methylpyridin-3-yl, 2-(trifluoromethyl)pyridin-3-yl, 4-(trifluoromethyl)pyridin-2-yl, 6-(trifluoromethyl)pyridin-2-yl, 2-methoxypyridin-4-yl, 4-methoxypyridin-3-yl, 6-methoxypyridin-2-yl, 2-ethoxypyridin-3-yl, 6-ethoxypyridin-2-yl, 6-(propan-2-yloxy)pyridin-2-yl, 6-(dimethylamino)pyridin-3-yl, 6-(methylsulfanyl)pyridin-2-yl, 6-(cyclobutyloxy)pyridin-2-yl, 6-(pyrrolidin-1-yl)pyridin-2-yl, 2-methylpyrimidin-4-yl, 2-(propan-2-yl)pyrimidin-4-yl, 2-cyclopropylpyrimidin-4-yl, 1-methyl-1H-indol-3-yl, 2-methyl-2H-indazol-5-yl, 2-methyl-1-benzofuran-5-yl, 1-methyl-1H-benzimidazol-2-yl, 4-methyl-1H-benzimidazol-2-yl 5-fluoro-1H-benzimidazol-2-yl, 4-fluoro-1,3-benzoxazol-2-yl, 5-fluoro-1,3-benzoxazol-2-yl, 4-chloro-1,3-benzoxazol-2-yl, 4-iodo-1,3-benzoxazol-2-yl, 2-methyl-1,3-benzoxazol-6-yl, 4-methyl-1,3-benzoxazol-2-yl, 4-(trifluoromethyl)-1,3-benzoxazol-2-yl, 7-(trifluoromethyl)-1,3-benzoxazol-2-yl, 2-methyl-1,3-benzothiazol-2-yl, 2-methyl-1,3-benzothiazol-5-yl, 2-methyl-1,3-benzothiazol-6-yl, 4-chloro-1,3-benzothiazol-2-yl, 7-chloro-1,3-benzothiazol-2-yl, 4-(trifluoromethyl)-1,3-benzothiazol-2-yl, 5-methylfuro[3,2-b]pyridin-2-yl, 4,6-dimethylfuro[3,2-c]pyridin-2-yl, 5,7-dimethylfuro[2,3-c]pyridin-2-yl, 4,6-dimethylthieno[3,2-c]pyridin-2-yl, 2,4-dimethylthieno[2,3-d]pyrimidin-6-yl, 1-methylpyrrolo[1,2-a]pyrazin-7-yl, 3-methylpyrrolo[1,2-a]pyrazin-7-yl, 1,3-dimethylpyrrolo[1,2-a]pyrazin-7-yl, 2-methylpyrrolo[1,2-b]pyridazin-2-yl, 4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl, 5-methylpyrazolo[1,5-a]pyridin-2-yl, 4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl, 2-chloroimidazo[2,1-b][1,3]thiazol-6-yl, 2-methylimidazo[2,1-b][1,3]thiazol-6-yl, 3-methylimidazo[2,1-b][1,3]thiazol-6-yl, 2-ethylimidazo[2,1-b][1,3]thiazol-6-yl, 2-methylimidazo[2,1-b][1,3,4]thiadiazol-6-yl, 6-cyanoimidazo[1,2-a]pyridin-2-yl (also referred to as 2-imidazo[1,2-a]pyridine-6-carbonitrile), 6-fluoroimidazo[1,2-a]pyridin-2-yl, 8-fluoroimidazo[1,2-a]pyridin-2-yl, 6,8-difluoroimidazo[1,2-a]pyridin-2-yl, 7-(trifluoromethyl)imidazo[1,2-a]pyridin-2-yl, 8-(trifluoromethyl)imidazo[1,2-a]pyridin-2-yl, 6-chloroimidazo[1,2-a]pyridin-2-yl, 7-chloroimidazo[1,2-a]pyridin-2-yl, 8-chloroimidazo[1,2-a]pyridin-2-yl, 8-bromoimidazo[1,2-a]pyridin-2-yl, 2-methylimidazo[1,2-a]pyridin-2-yl, 5-methylimidazo[1,2-a]pyridin-2-yl, 6-methylimidazo[1,2-a]pyridin-2-yl, 7-methylimidazo[1,2-a]pyridin-2-yl, 8-methylimidazo[1,2-a]pyridin-2-yl, 7-ethylimidazo[1,2-a]pyridin-2-yl, 8-ethylimidazo[1,2-a]pyridin-2-yl, 6,8-dimethylimidazo[1,2-a]pyridin-2-yl, 8-ethyl-6-methylimidazo[1,2-a]pyridin-2-yl, 7-methoxyimidazo[1,2-a]pyridin-2-yl, 8-methoxyimidazo[1,2-a]pyridin-2-yl, 6-fluoro-8-methylimidazo[1,2-a]pyridin-2-yl, 8-fluoro-6-methylimidazo[1,2-a]pyridin-2-yl, 8-chloro-6-methylimidazo[1,2-a]pyridin-2-yl, 6-methyl-8-nitroimidazo[1,2-a]pyridin-2-yl, 8-cyclopropylimidazo[1,2-a]pyridin-2-yl, 2-methylimidazo[1,2-a]pyridin-6-yl, 2-ethylimidazo[1,2-a]pyridin-6-yl, 2,3-dimethylimidazo[1,2-a]pyridin-6-yl, 2,8-dimethylimidazo[1,2-a]pyridin-6-yl, 2-(trifluoromethyl)imidazo[1,2-a]pyridin-6-yl, 8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl, 8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl, 6-fluoroimidazo[1,2-a]pyrimidin-2-yl, 6-chloroimidazo[1,2-a]pyrimidin-2-yl, 6-methylimidazo[1,2-a]pyrimidin-2-yl, 7-methylimidazo[1,2-a]pyrimidin-2-yl, 2-methylimidazo[1,2-a]pyrimidin-6-yl, 6-methylimidazo[1,2-b]pyridazin-2-yl, 2-methyl-3-(1,2,3,6-tetrahydropyridin-4-yl)imidazo[1,2-b]pyridazin-6-yl, 6-methylimidazo[1,2-a]pyrazin-2-yl, 8-methylimidazo[1,2-a]pyrazin-2-yl, 6,8-dimethylimidazo[1,2-a]pyrazin-2-yl, 6-chloro-8-methylimidazo[1,2-a]pyrazin-2-yl, 6-methyl-8-(trifluoromethyl)imidazo[1,2-a]pyrazin-2-yl, 8-(methylsulfanyl)imidazo[1,2-a]pyrazin-2-yl, 2-methylimidazo[2,1-b][1,3]thiazol-6-yl, 3-methylimidazo[2,1-b][1,3]thiazol-6-yl or 2-methylimidazo[2,1-b][1,3,4]thiadiazol-6-yl.

›EMBODIMENTS · 7 of 13

In another embodiment of a compound of Formula (I),

R 2 is heteroaryl selected from furo[3,2-b]pyridinyl, furo[3,2-c]pyridinyl, furo[2,3-c]pyridinyl, thieno[3,2-c]pyridinyl, thieno[2,3-d]pyrimidinyl, 1H-pyrrolo[2,3-b]pyridinyl, 1H-pyrrolo[2,3-c]pyridinyl, pyrrolo[1,2-a]pyrimidinyl, pyrrolo[1,2-a]pyrazinyl, pyrrolo[1,2-b]pyridazinyl, pyrazolo[1,5-a]pyridinyl, pyrazolo[1,5-a]pyrazinyl, imidazo[1,2-a]pyridinyl, imidazo[1,2-a]pyrimidinyl, imidazo[1,2-a]pyrimidinyl, imidazo[1,2-b]pyridazinyl, imidazo[1,2-a]pyrazinyl, imidazo[2,1-b][1,3]thiazolyl, imidazo[2,1-b][1,3,4]thiadiazolyl, [1,3]oxazolo[4,5-b]pyridinyl or quinoxalinyl; wherein, each instance of heteroaryl is optionally substituted with R 6 and R 7 substituents.

In one embodiment of a compound of Formula (I), R 2 is heteroaryl-amino, wherein heteroaryl is selected from pyridinyl or pyrimidinyl; and, wherein, each instance of heteroaryl is optionally substituted with R 6 and R 7 substituents.

In another embodiment of a compound of Formula (I), R 2 is heteroaryl-amino selected from pyridin-2-yl-amino, pyridin-3-yl-amino or pyrimidin-2-yl-amino; wherein, each instance of heteroaryl is optionally substituted with R 6 and R 7 substituents.

In one embodiment of a compound of Formula (I), R 6 is selected from halogen, hydroxy, cyano, nitro, C 1-8 alkyl, halo-C 1-8 alkyl, hydroxy-C 1-8 alkyl, C 1-8 alkoxy, halo-C 1-8 alkoxy, C 1-8 alkoxy-C 1-8 alkyl, (C 1-8 alkyl) 2 -amino or C 1-8 alkyl-thio; wherein, halogen and halo is selected from fluoro, chloro, bromo or iodo.

In one embodiment of a compound of Formula (I), R 6 is C 1-8 alkyl selected from methyl, ethyl, propyl, isopropyl or tert-butyl.

In another embodiment of a compound of Formula (I), R 6 is C 1-8 alkyl selected from ethyl, propyl, isopropyl or tert-butyl.

In one embodiment of a compound of Formula (I), R 6 is C 2-8 alkenyl selected from ethenyl, allyl or buta-1,3-dienyl.

In another embodiment of a compound of Formula (I), R 6 is C 2-8 alkenyl selected from ethenyl or allyl.

In one embodiment of a compound of Formula (I), R 6 is halo-C 1-8 alkyl selected from trihalo-methyl, dihalo-methyl, halo-methyl, trihalo-ethyl, dihalo-ethyl, halo-ethyl, trihalo-propyl, dihalo-propyl or halo-propyl; wherein, halo is selected from fluoro, chloro, bromo or iodo.

In one embodiment of a compound of Formula (I), R 6 is hydroxy-C 1-8 alkyl selected from hydroxy-methyl, hydroxy-ethyl, hydroxy-propyl, dihydroxy-propyl, hydroxy-butyl or dihydroxy-butyl.

In another embodiment of a compound of Formula (I), R 6 is hydroxy-C 1-8 alkyl selected from hydroxy-methyl, dihydroxy-propyl, hydroxy-butyl or dihydroxy-butyl.

In one embodiment of a compound of Formula (I), R 6 is C 1-8 alkoxy selected from methoxy, ethoxy, propoxy or isopropoxy.

In one embodiment of a compound of Formula (I), R 6 is halo-C 1-8 alkoxy selected from trihalo-methoxy, dihalo-methoxy, halo-methoxy, trihalo-ethoxy, dihalo-ethoxy, halo-ethoxy, trihalo-propoxy, dihalo-propoxy or halo-propoxy; wherein, halo is selected from fluoro, chloro, bromo or iodo.

In one embodiment of a compound of Formula (I), R 7 is C 3-14 cycloalkyl, C 3-14 cycloalkyl-oxy, aryl, heterocyclyl or heteroaryl; wherein C 3-14 cycloalkyl is selected from cyclopropyl or cyclobutoxy; wherein aryl is selected from phenyl; wherein heterocyclyl is selected from oxetanyl, pyrrolidinyl or 1,2,3,6-tetrahydropyridinyl; and, wherein heteroaryl is selected from thienyl or pyridinyl.

In another embodiment of a compound of Formula (I), R 7 is C 3-14 cycloalkyl or C 3-14 cycloalkyl-oxy, wherein each instance of C 3-14 cycloalkyl is selected from cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl or cycloheptyl.

In another embodiment of a compound of Formula (I), R 7 is C 3-8 cycloalkyl or C 3-8 cycloalkyl-oxy, wherein each instance of C 3-8 cycloalkyl is selected from cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl or cycloheptyl.

In one embodiment of a compound of Formula (I), R 7 is aryl selected from phenyl.

In one embodiment of a compound of Formula (I), R 7 is heterocyclyl selected from oxetanyl, pyrrolidinyl or 1,2,3,6-tetrahydropyridinyl.

In another embodiment of a compound of Formula (I), R 7 is heterocyclyl selected from oxetan-3-yl, pyrrolidin-1-yl or 1,2,3,6-tetrahydropyridin-4-yl.

In one embodiment of a compound of Formula (I), R 7 is heteroaryl selected from thienyl or pyridinyl.

In another embodiment of a compound of Formula (I), R 7 is heteroaryl selected from pyridinyl.

In one embodiment of a compound of Formula (I), R 7 is heteroaryl selected from thien-2-yl or pyridin-2-yl.

In another embodiment of a compound of Formula (I), R 7 is heteroaryl selected from pyridin-2-yl.

In one embodiment of a compound of Formula (I), R c is hydrogen or C 1-8 alkyl.

In another embodiment of a compound of Formula (I),

R 1 is heterocyclyl, heterocyclyl-C 1-8 alkyl, heterocyclyl-C 1-8 alkoxy, heterocyclyl-amino, (heterocyclyl)(C 1-8 alkyl)amino, heterocyclyl-amino-C 1-8 alkyl, heterocyclyl-C 1-8 alkyl-amino, (heterocyclyl-C 1-8 alkyl) 2 -amino, (heterocyclyl-C 1-8 alkyl)(C 1-8 alkyl)amino, heterocyclyl-C 1-8 alkyl-amino-C 1-8 alkyl, (heterocyclyl-C 1-8 alkyl) 2 -amino-C 1-8 alkyl, (heterocyclyl-C 1-8 alkyl)(C 1-8 alkyl)amino-C 1-8 alkyl, heterocyclyl-oxy, heterocyclyl-carbonyl, heterocyclyl-carbonyl-oxy, C 3-14 cycloalkyl, aryl-C 1-8 alkyl-amino, (aryl-C 1-8 alkyl) 2 -amino, (aryl-C 1-8 alkyl)(C 1-8 alkyl)amino, aryl-C 1-8 alkyl-amino-C 1-8 alkyl, (aryl-C 1-8 alkyl) 2 -amino-C 1-8 alkyl, (aryl-C 1-8 alkyl)(C 1-8 alkyl)amino-C 1-8 alkyl, heteroaryl, heteroaryl-C 1-8 alkyl, heteroaryl-C 1-8 alkoxy, heteroaryl-amino, heteroaryl-C 1-8 alkyl-amino, (heteroaryl-C 1-8 alkyl) 2 -amino, (heteroaryl-C 1-8 alkyl)(C 1-8 alkyl)amino, heteroaryl-C 1-8 alkyl-amino-C 1-8 alkyl, (heteroaryl-C 1-8 alkyl) 2 -amino-C 1-8 alkyl or (heteroaryl-C 1-8 alkyl)(C 1-8 alkyl)amino-C 1-8 alkyl; wherein, each instance of heterocyclyl, C 3-14 cycloalkyl, aryl and heteroaryl is optionally substituted with R 3 and R 4 substituents; and, wherein, heterocyclyl is selected from azetidinyl, tetrahydrofuranyl, pyrrolidinyl, piperidinyl, piperazinyl, 1,4-diazepanyl, 1,2,5,6-tetrahydropyridinyl, 1,2,3,6-tetrahydropyridinyl, hexahydropyrrolo[3,4-b]pyrrol-(1H)-yl, (3aS,6aS)-hexahydropyrrolo[3,4-b]pyrrol-(1H)-yl, (3aR,6aR)-hexahydropyrrolo[3,4-b]pyrrol-(1H)-yl, hexahydropyrrolo[3,4-b]pyrrol-(2H)-yl, (3aS,6aS)-hexahydropyrrolo[3,4-b]pyrrol-(2H)-yl, hexahydropyrrolo[3,4-c]pyrrol-(1H)-yl, (3aR,6aS)-hexahydropyrrolo[3,4-c]pyrrol-(1H)-yl, octahydro-5H-pyrrolo[3,2-c]pyridinyl, octahydro-6H-pyrrolo[3,4-b]pyridinyl, (4aR,7aR)-octahydro-6H-pyrrolo[3,4-b]pyridinyl, (4aS,7aS)-octahydro-6H-pyrrolo[3,4-b]pyridinyl, hexahydropyrrolo[1,2-a]pyrazin-(2H)-one, hexahydropyrrolo[1,2-a]pyrazin-(1H)-yl, (7R,8aS)-hexahydropyrrolo[1,2-a]pyrazin-(1H)-yl, (8aS)-hexahydropyrrolo[1,2-a]pyrazin-(1H)-yl, (8aR)-hexahydropyrrolo[1,2-a]pyrazin-(1H)-yl, (8aS)-octahydropyrrolo[1,2-a]pyrazin-(1H)-yl, (8aR)-octahydropyrrolo[1,2-a]pyrazin-(1H)-yl, octahydro-2H-pyrido[1,2-a]pyrazinyl, 3-azabicyclo[3.1.0]hexyl, (1R,5S)-3-azabicyclo[3.1.0]hexyl, 8-azabicyclo[3.2.1]octyl, (1R,5S)-8-azabicyclo[3.2.1]octyl, 8-azabicyclo[3.2.1]oct-2-enyl, (1R,5S)-8-azabicyclo[3.2.1]oct-2-enyl, 9-azabicyclo[3.3.1]nonyl, (1R,5S)-9-azabicyclo[3.3.1]nonyl, 2,5-diazabicyclo[2.2.1]heptyl, (1S,4S)-2,5-diazabicyclo[2.2.1]heptyl, 2,5-diazabicyclo[2.2.2]octyl, 3,8-diazabicyclo[3.2.1]octyl, (1R,5S)-3,8-diazabicyclo[3.2.1]octyl, 1,4-diazabicyclo[3.2.2]nonyl, azaspiro[3.3]heptyl, 2,6-diazaspiro[3.3]heptyl, 2,7-diazaspiro[3.5]nonyl, 5,8-diazaspiro[3.5]nonyl, 2,7-diazaspiro[4.4]nonyl or 6,9-diazaspiro[4.5]decyl.

›EMBODIMENTS · 8 of 13

In another embodiment of a compound of Formula (I),

R 2 is aryl, aryl-amino, aryl-amino-carbonyl, heterocyclyl, heteroaryl or heteroaryl-amino; wherein, aryl is phenyl; wherein, heterocyclyl is selected from 1,2,3,6-tetrahydropyridinyl, 1,3-benzodioxolyl or 2,3-dihydro-1,4-benzodioxinyl; wherein, heteroaryl is selected from thienyl, 1H-pyrazolyl, 1H-imidazolyl, 1,3-thiazolyl, 1,2,4-oxadiazolyl, 1,3,4-oxadiazolyl, pyridinyl, pyrimidinyl, 1H-indolyl, 2H-indolyl, 1H-indazolyl, 2H-indazolyl, indolizinyl, benzofuranyl, benzothienyl, 1H-benzimidazolyl, 1,3-benzothiazolyl, 1,3-benzoxazolyl, 9H-purinyl, furo[3,2-b]pyridinyl, furo[3,2-c]pyridinyl, furo[2,3-c]pyridinyl, thieno[3,2-c]pyridinyl, thieno[2,3-d]pyrimidinyl, 1H-pyrrolo[2,3-b]pyridinyl, 1H-pyrrolo[2,3-c]pyridinyl, pyrrolo[1,2-a]pyrimidinyl, pyrrolo[1,2-a]pyrazinyl, pyrrolo[1,2-b]pyridazinyl, pyrazolo[1,5-a]pyridinyl, pyrazolo[1,5-a]pyrazinyl, imidazo[1,2-a]pyridinyl, imidazo[1,2-a]pyrimidinyl, imidazo[1,2-c]pyrimidinyl, imidazo[1,2-b]pyridazinyl, imidazo[1,2-a]pyrazinyl, imidazo[2,1-b][1,3]thiazolyl, imidazo[2,1-b][1,3,4]thiadiazolyl, [1,3]oxazolo[4,5-b]pyridinyl or quinoxalinyl; and, wherein, each instance of aryl, heterocyclyl and heteroaryl is optionally substituted with R 6 and R 7 substituents.

In another embodiment of a compound of Formula (I),

R 1 is heterocyclyl, heterocyclyl-C 1-8 alkyl, heterocyclyl-C 1-8 alkoxy, heterocyclyl-amino, (heterocyclyl)(C 1-8 alkyl)amino, heterocyclyl-amino-C 1-8 alkyl, heterocyclyl-C 1-8 alkyl-amino, (heterocyclyl-C 1-8 alkyl) 2 -amino, (heterocyclyl-C 1-8 alkyl)(C 1-8 alkyl)amino, heterocyclyl-C 1-8 alkyl-amino-C 1-8 alkyl, (heterocyclyl-C 1-8 alkyl) 2 -amino-C 1-8 alkyl, (heterocyclyl-C 1-8 alkyl)(C 1-8 alkyl)amino-C 1-8 alkyl, heterocyclyl-oxy, heterocyclyl-carbonyl, heterocyclyl-carbonyl-oxy, C 3-14 cycloalkyl, aryl-C 1-8 alkyl-amino, (aryl-C 1-8 alkyl) 2 -amino, (aryl-C 1-8 alkyl)(C 1-8 alkyl)amino, aryl-C 1-8 alkyl-amino-C 1-8 alkyl, (aryl-C 1-8 alkyl) 2 -amino-C 1-8 alkyl, (aryl-C 1-8 alkyl)(C 1-8 alkyl)amino-C 1-8 alkyl, heteroaryl, heteroaryl-C 1-8 alkyl, heteroaryl-C 1-8 alkoxy, heteroaryl-amino, heteroaryl-C 1-8 alkyl-amino, (heteroaryl-C 1-8 alkyl) 2 -amino, (heteroaryl-C 1-8 alkyl)(C 1-8 alkyl)amino, heteroaryl-C 1-8 alkyl-amino-C 1-8 alkyl, (heteroaryl-C 1-8 alkyl) 2 -amino-C 1-8 alkyl or (heteroaryl-C 1-8 alkyl)(C 1-8 alkyl)amino-C 1-8 alkyl; wherein, heterocyclyl is selected from azetidinyl, tetrahydrofuranyl, pyrrolidinyl, piperidinyl, piperazinyl, 1,4-diazepanyl, 1,2,5,6-tetrahydropyridinyl, 1,2,3,6-tetrahydropyridinyl, hexahydropyrrolo[3,4-b]pyrrol-(1H)-yl, (3aS,6aS)-hexahydropyrrolo[3,4-b]pyrrol-(1H)-yl, (3aR,6aR)-hexahydropyrrolo[3,4-b]pyrrol-(1H)-yl, hexahydropyrrolo[3,4-b]pyrrol-(2H)-yl, (3aS,6aS)-hexahydropyrrolo[3,4-b]pyrrol-(2H)-yl, hexahydropyrrolo[3,4-c]pyrrol-(1H)-yl, (3aR,6aS)-hexahydropyrrolo[3,4-c]pyrrol-(1H)-yl, octahydro-5H-pyrrolo[3,2-c]pyridinyl, octahydro-6H-pyrrolo[3,4-b]pyridinyl, (4aR,7aR)-octahydro-6H-pyrrolo[3,4-b]pyridinyl, (4aS,7aS)-octahydro-6H-pyrrolo[3,4-b]pyridinyl, hexahydropyrrolo[1,2-a]pyrazin-(2H)-one, hexahydropyrrolo[1,2-a]pyrazin-(1H)-yl, (7R,8aS)-hexahydropyrrolo[1,2-a]pyrazin-(1H)-yl, (8aS)-hexahydropyrrolo[1,2-a]pyrazin-(1H)-yl, (8aR)-hexahydropyrrolo[1,2-a]pyrazin-(1H)-yl, (8aS)-octahydropyrrolo[1,2-a]pyrazin-(1H)-yl, (8aR)-octahydropyrrolo[1,2-a]pyrazin-(1H)-yl, octahydro-2H-pyrido[1,2-a]pyrazinyl, 3-azabicyclo[3.1.0]hexyl, (1R,5S)-3-azabicyclo[3.1.0]hexyl, 8-azabicyclo[3.2.1]octyl, (1R,5S)-8-azabicyclo[3.2.1]octyl, 8-azabicyclo[3.2.1]oct-2-enyl, (1R,5S)-8-azabicyclo[3.2.1]oct-2-enyl, 9-azabicyclo[3.3.1]nonyl, (1R,5S)-9-azabicyclo[3.3.1]nonyl, 2,5-diazabicyclo[2.2.1]heptyl, (1S,4S)-2,5-diazabicyclo[2.2.1]heptyl, 2,5-diazabicyclo[2.2.2]octyl, 3,8-diazabicyclo[3.2.1]octyl, (1R,5S)-3,8-diazabicyclo[3.2.1]octyl, 1,4-diazabicyclo[3.2.2]nonyl, azaspiro[3.3]heptyl, 2,6-diazaspiro[3.3]heptyl, 2,7-diazaspiro[3.5]nonyl, 5,8-diazaspiro[3.5]nonyl, 2,7-diazaspiro[4.4]nonyl or 6,9-diazaspiro[4.5]decyl; and, wherein, each instance of heterocyclyl, C 3-14 cycloalkyl, aryl and heteroaryl is optionally substituted with R 3 and R 4 substituents; and R 2 is aryl, aryl-amino, aryl-amino-carbonyl, heterocyclyl, heteroaryl or heteroaryl-amino; wherein, heterocyclyl is selected from 1,2,3,6-tetrahydropyridin-4-yl, 1,3-benzodioxol-5-yl or 2,3-dihydro-1,4-benzodioxin-6-yl; wherein, heteroaryl is selected from thienyl, 1H-pyrazolyl, 1H-imidazolyl, 1,3-thiazolyl, 1,2,4-oxadiazolyl, 1,3,4-oxadiazolyl, pyridinyl, pyrimidinyl, 1H-indolyl, 2H-indolyl, 1H-indazolyl, 2H-indazolyl, indolizinyl, benzofuranyl, benzothienyl, 1H-benzimidazolyl, 1,3-benzothiazolyl, 1,3-benzoxazolyl, 9H-purinyl, furo[3,2-b]pyridinyl, furo[3,2-c]pyridinyl, furo[2,3-c]pyridinyl, thieno[3,2-c]pyridinyl, thieno[2,3-d]pyrimidinyl, 1H-pyrrolo[2,3-b]pyridinyl, 1H-pyrrolo[2,3-c]pyridinyl, pyrrolo[1,2-a]pyrimidinyl, pyrrolo[1,2-a]pyrazinyl, pyrrolo[1,2-b]pyridazinyl, pyrazolo[1,5-a]pyridinyl, pyrazolo[1,5-a]pyrazinyl, imidazo[1,2-a]pyridinyl, imidazo[1,2-a]pyrimidinyl, imidazo[1,2-c]pyrimidinyl, imidazo[1,2-b]pyridazinyl, imidazo[1,2-a]pyrazinyl, imidazo[2,1-b][1,3]thiazolyl, imidazo[2,1-b][1,3,4]thiadiazolyl, [1,3]oxazolo[4,5-b]pyridinyl or quinoxalinyl; and, wherein, each instance of heterocyclyl and heteroaryl is optionally substituted with R 6 and R 7 substituents.

In another embodiment of a compound of Formula (I),

R 1 is C 1-8 alkyl, amino, C 1-8 alkyl-amino, (C 1-8 alkyl) 2 -amino, C 1-8 alkoxy-C 1-8 alkyl-amino, (C 1-8 alkoxy-C 1-8 alkyl) 2 -amino, (C 1-8 alkoxy-C 1-8 alkyl)(C 1-8 alkyl)amino, amino-C 1-8 alkyl, C 1-8 alkyl-amino-C 1-8 alkyl, (C 1-8 alkyl) 2 -amino-C 1-8 alkyl, C 1-8 alkoxy-C 1-8 alkyl-amino-C 1-8 alkyl, (C 1-8 alkoxy-C 1-8 alkyl) 2 -amino-C 1-8 alkyl, (C 1-8 alkoxy-C 1-8 alkyl)(C 1-8 alkyl)amino-C 1-8 alkyl, amino-C 1-8 alkyl-amino, (amino-C 1-8 alkyl) 2 -amino, (amino-C 1-8 alkyl)(C 1-8 alkyl)amino, C 1-8 alkyl-amino-C 1-8 alkyl-amino, (C 1-8 alkyl-amino-C 1-8 alkyl) 2 -amino, (C 1-8 alkyl-amino-C 1-8 alkyl)(C 1-8 alkyl)amino, (C 1-8 alkyl) 2 -amino-C 1-8 alkyl-amino, [(C 1-8 alkyl) 2 -amino-C 1-8 alkyl](C 1-8 alkyl)amino, amino-C 1-8 alkoxy, C 1-8 alkyl-amino-C 1-8 alkoxy, (C 1-8 alkyl) 2 -amino-C 1-8 alkoxy, C 1-8 alkoxy-C 1-8 alkyl-amino-C 1-8 alkoxy, (C 1-8 alkoxy-C 1-8 alkyl) 2 -amino-C 1-8 alkoxy, (C 1-8 alkoxy-C 1-8 alkyl)(C 1-8 alkyl)amino-C 1-8 alkoxy, amino-C 2-8 alkenyl, C 1-8 alkyl-amino-C 2-8 alkenyl, (C 1-8 alkyl) 2 -amino-C 2-8 alkenyl, amino-C 2-8 alkynyl, C 1-8 alkyl-amino-C 2-8 alkynyl, (C 1-8 alkyl) 2 -amino-C 2-8 alkynyl, halo-C 1-8 alkyl-amino, (halo-C 1-8 alkyl) 2 -amino, (halo-C 1-8 alkyl)(C 1-8 alkyl)amino, hydroxy-C 1-8 alkyl, hydroxy-C 1-8 alkoxy-C 1-8 alkyl, hydroxy-C 1-8 alkyl-amino, (hydroxy-C 1-8 alkyl) 2 -amino, (hydroxy-C 1-8 alkyl)(C 1-8 alkyl)amino, hydroxy-C 1-8 alkyl-amino-C 1-8 alkyl, (hydroxy-C 1-8 alkyl) 2 -amino-C 1-8 alkyl, (hydroxy-C 1-8 alkyl)(C 1-8 alkyl)amino-C 1-8 alkyl, hydroxy-C 1-8 alkyl-amino-C 1-8 alkoxy, (hydroxy-C 1-8 alkyl) 2 -amino-C 1-8 alkoxy, (hydroxy-C 1-8 alkyl)(C 1-8 alkyl)amino-C 1-8 alkoxy, hydroxy-C 1-8 alkyl-amino-C 1-8 alkyl-amino, (hydroxy-C 1-8 alkyl-amino-C 1-8 alkyl) 2 -amino, (hydroxy-C 1-8 alkyl) 2 -amino-C 1-8 alkyl-amino, (hydroxy-C 1-8 alkyl-amino-C 1-8 alkyl)(C 1-8 alkyl)amino, (hydroxy-C 1-8 alkyl)(C 1-8 alkyl)amino-C 1-8 alkyl-amino, [(hydroxy-C 1-8 alkyl) 2 -amino-C 1-8 alkyl](C 1-8 alkyl)amino or [(hydroxy-C 1-8 alkyl)(C 1-8 alkyl)amino-C 1-8 alkyl](C 1-8 alkyl)amino; and R 2 is aryl, aryl-amino, aryl-amino-carbonyl, heterocyclyl, heteroaryl or heteroaryl-amino, wherein, each instance of aryl, heterocyclyl and heteroaryl is optionally substituted with R 6 and R 7 substituents.

›EMBODIMENTS · 9 of 13

In another embodiment of a compound of Formula (I),

R 1 is heterocyclyl optionally substituted with R 3 and R 4 substituents; and R 2 is aryl, aryl-amino, aryl-amino-carbonyl, heterocyclyl, heteroaryl or heteroaryl-amino, wherein, each instance of aryl, heterocyclyl and heteroaryl is optionally substituted with R 6 and R 7 substituents.

In another embodiment of a compound of Formula (I),

R 1 is C 3-14 cycloalkyl optionally substituted with R 3 and R 4 substituents; and R 2 is aryl, aryl-amino, aryl-amino-carbonyl, heterocyclyl, heteroaryl or heteroaryl-amino, wherein, each instance of aryl, heterocyclyl and heteroaryl is optionally substituted with R 6 and R 7 substituents.

In another embodiment of a compound of Formula (I),

R 1 is aryl-C 1-8 alkyl-amino, (aryl-C 1-8 alkyl) 2 -amino, (aryl-C 1-8 alkyl)(C 1-8 alkyl)amino, aryl-C 1-8 alkyl-amino-C 1-8 alkyl, (aryl-C 1-8 alkyl) 2 -amino-C 1-8 alkyl or (aryl-C 1-8 alkyl)(C 1-8 alkyl)amino-C 1-8 alkyl; wherein, each instance of aryl is optionally substituted with R 3 and R 4 substituents; and R 2 is aryl, aryl-amino, aryl-amino-carbonyl, heterocyclyl, heteroaryl or heteroaryl-amino, wherein, each instance of aryl, heterocyclyl and heteroaryl is optionally substituted with R 6 and R 7 substituents.

In another embodiment of a compound of Formula (I),

R 1 is aryl-C 1-8 alkyl-amino optionally substituted with R 3 and R 4 substituents; and R 2 is aryl, aryl-amino, aryl-amino-carbonyl, heterocyclyl, heteroaryl or heteroaryl-amino, wherein, each instance of aryl, heterocyclyl and heteroaryl is optionally substituted with R 6 and R 7 substituents.

In another embodiment of a compound of Formula (I),

R 1 is heteroaryl, heteroaryl-C 1-8 alkyl, heteroaryl-C 1-8 alkoxy, heteroaryl-amino, heteroaryl-C 1-8 alkyl-amino, (heteroaryl-C 1-8 alkyl) 2 -amino, (heteroaryl-C 1-8 alkyl)(C 1-8 alkyl)amino, heteroaryl-C 1-8 alkyl-amino-C 1-8 alkyl, (heteroaryl-C 1-8 alkyl) 2 -amino-C 1-8 alkyl or (heteroaryl-C 1-8 alkyl)(C 1-8 alkyl)amino-C 1-8 alkyl; wherein, each instance of heterocyclyl, C 3-14 cycloalkyl, aryl and heteroaryl is optionally substituted with R 3 and R 4 substituents; and R 2 is aryl, aryl-amino, aryl-amino-carbonyl, heterocyclyl, heteroaryl or heteroaryl-amino, wherein, each instance of aryl, heterocyclyl and heteroaryl is optionally substituted with R 6 and R 7 substituents.

In another embodiment of a compound of Formula (I),

R 1 is heteroaryl optionally substituted with R 3 and R 4 substituents; and R 2 is aryl, aryl-amino, aryl-amino-carbonyl, heterocyclyl, heteroaryl or heteroaryl-amino, wherein, each instance of aryl, heterocyclyl and heteroaryl is optionally substituted with R 6 and R 7 substituents.

An embodiment of the compound of Formula (I) is a compound selected from Formula (II), Formula (III), Formula (IV), Formula (V), Formula (VI), Formula (VII), Formula (VIII), Formula (IX), Formula (X), Formula (XI), Formula (XII), Formula (XIII) or Formula (XIV):

or a form thereof.

In an embodiment of the compound of Formula (I), w 3 is C—R 1 , w 6 is C—R 2 , w 1 , w 4 , w 5 and w 7 are independently C—R a or N and w 2 is C—R b or N.

In another embodiment of the compound of Formula (I), w 3 is C—R 2 , w 6 is C—R 1 , w 1 , w 4 , w 5 and w 7 are independently C—R a or N and w 2 is C—R b or N.

In another embodiment of the compound of Formula (I), w 4 is C—R 1 , w 7 is C—R 2 , w 1 , w 3 and w 5 are independently C—R a or N, w 2 is C—R b or N and w 6 is C—R c or N.

In another embodiment of the compound of Formula (I), w 4 is C—R 2 , w 7 is C—R 1 , w 1 , w 3 and w 5 are independently C—R a or N, w 2 is C—R b or N and w 6 is C—R c or N.

In an embodiment of the compound of Formula (II), w 3 is C—R 1 , w 6 is C—R 2 , w 4 , w 5 and w 7 are independently C—R a or N and w 2 is C—R b or N.

›EMBODIMENTS · 10 of 13

In another embodiment of the compound of Formula (II), w 3 is C—R 2 , w 6 is C—R 1 , w 4 , w 5 and w 7 are independently C—R a or N and w 2 is C—R b or N.

In another embodiment of the compound of Formula (II), w 4 is C—R 1 , w 7 is C—R 2 , w 3 and w 5 are independently C—R a or N, w 2 is C—R b or N and w 6 is C—R c or N.

In another embodiment of the compound of Formula (II), w 4 is C—R 2 , w 7 is C—R 1 , w 3 and w 5 are independently C—R a or N, w 2 is C—R b or N and w 6 is C—R c or N.

In an embodiment of the compound of Formula (III), w 3 is C—R 1 , w 6 is C—R 2 and w 1 , w 4 , w 5 and w 7 are independently C—R a or N.

In another embodiment of the compound of Formula (III), w 3 is C—R 2 , w 6 is C—R 1 and w 1 , w 4 , w 5 and w 7 are independently C—R a or N.

In another embodiment of the compound of Formula (III), w 4 is C—R 1 , w 7 is C—R 2 , w 1 , w 3 and w 5 are independently C—R a or N and w 6 is C—R c or N.

In another embodiment of the compound of Formula (III), w 4 is C—R 2 , w 7 is C—R 1 , w 1 , w 3 and w 5 are independently C—R a or N and w 6 is C—R c or N.

In an embodiment of the compound of Formula (IV), w 4 is C—R 1 , w 7 is C—R 2 , w 1 and w 5 are independently C—R a or N, w 2 is C—R b or N and w 6 is C—R c or N.

In another embodiment of the compound of Formula (IV), w 4 is C—R 2 , w 7 is C—R 1 , w 1 and w 5 are independently C—R a or N, w 2 is C—R b or N and w 6 is C—R c or N.

In an embodiment of the compound of Formula (V), w 3 is C—R 1 , w 6 is C—R 2 , w 1 , w 5 and w 7 are independently C—R a or N and w 2 is C—R b or N.

In another embodiment of the compound of Formula (V), w 3 is C—R 2 , w 6 is C—R 1 , w 1 , w 5 and w 7 are independently C—R a or N and w 2 is C—R b or N.

In an embodiment of the compound of Formula (VI), w 3 is C—R 1 , w 6 is C—R 2 , w 1 , w 4 and w 7 are independently C—R a or N and w 2 is C—R b or N.

In another embodiment of the compound of Formula (VI), w 3 is C—R 2 , w 6 is C—R 1 , w 1 , w 4 and w 7 are independently C—R a or N and w 2 is C—R b or N.

In another embodiment of the compound of Formula (VI), w 4 is C—R 1 , w 7 is C—R 2 , w 1 and w 3 are independently C—R a or N, w 2 is C—R b or N and w 6 is C—R c or N.

In another embodiment of the compound of Formula (VI), w 4 is C—R 2 , w 7 is C—R 1 , w 1 and w 3 are independently C—R a or N, w 2 is C—R b or N and w 6 is C—R c or N.

In another embodiment of the compound of Formula (VII), w 4 is C—R 1 , w 7 is C—R 2 , w 1 , w 3 and w 5 are C—R a or N and w 2 is C—R b or N.

In another embodiment of the compound of Formula (VII), w 4 is C—R 2 , w 7 is C—R 1 , w 1 , w 3 and w 5 are C—R a or N and w 2 is C—R b or N.

In another embodiment of the compound of Formula (VIII), w 3 is C—R 1 , w 6 is C—R 2 , w 1 , w 4 and w 5 are C—R a or N and w 2 is C—R b or N.

In another embodiment of the compound of Formula (VIII), w 3 is C—R 2 , w 6 is C—R 1 , w 1 , w 4 and w 5 are C—R a or N and w 2 is C—R b or N.

In an embodiment of the compound of Formula (IX), w 3 is C—R 1 , w 6 is C—R 2 , w 4 and w 7 are independently C—R a or N and w 2 is C—R b or N.

In another embodiment of the compound of Formula (IX), w 3 is C—R 2 , w 6 is C—R 1 , w 4 and w 7 are independently C—R a or N and w 2 is C—R b or N.

In another embodiment of the compound of Formula (IX), w 4 is C—R 1 , w 7 is C—R 2 , w 2 is C—R b or N, w 3 is C—R a or N and w 6 is C—R c or N.

In another embodiment of the compound of Formula (IX), w 4 is C—R 2 , w 7 is C—R 1 , w 2 is C—R b or N, w 3 is C—R a or N and w 6 is C—R c or N.

In an embodiment of the compound of Formula (X), w 3 is C—R 1 , w 6 is C—R 2 , w 2 is C—R b or N and w 5 and w 7 are independently C—R a or N.

In another embodiment of the compound of Formula (X), w 3 is C—R 2 , w 6 is C—R 1 , w 2 is C—R b or N and w 5 and w 7 are independently C—R a or N.

In an embodiment of the compound of Formula (XI), w 4 is C—R 1 , w 7 is C—R 2 , w 2 is C—R b or N, w 5 is C—R a or N and w 6 is C—R c or N.

In another embodiment of the compound of Formula (XI), w 4 is C—R 2 , w 7 is C—R 1 , w 2 is C—R b or N, w 5 is C—R a or N and w 6 is C—R c or N.

In an embodiment of the compound of Formula (XII), w 3 is C—R 1 , w 6 is C—R 2 and w 4 , w 5 and w 7 are independently C—R a or N.

In another embodiment of the compound of Formula (XII), w 3 is C—R 2 , w 6 is C—R 1 and w 4 , w 5 and w 7 are independently C—R a or N.

In another embodiment of the compound of Formula (XII), w 4 is C—R 1 , w 7 is C—R 2 , w 3 and w 5 are independently C—R a or N and w 6 is C—R c or N.

In another embodiment of the compound of Formula (XII), w 4 is C—R 2 , w 7 is C—R 1 , w 3 and w 5 are independently C—R a or N and w 6 is C—R c or N.

In an embodiment of the compound of Formula (XIII), w 3 is C—R 1 , w 6 is C—R 2 , w 2 is C—R b or N and w 4 and w 5 are independently C—R a or N.

In another embodiment of the compound of Formula (XIII), w 3 is C—R 2 , w 6 is C—R 1 , w 2 is C—R b or N and w 4 and w 5 are independently C—R a or N.

In an embodiment of the compound of Formula (XIV), w 4 is C—R 1 , w 7 is C—R 2 , w 2 is C—R b or N and w 3 and w 5 are independently C—R a or N.

In another embodiment of the compound of Formula (XIV), w 4 is C—R 2 , w 7 is C—R 1 , w 2 is C—R b or N and w 3 and w 5 are independently C—R a or N.

Another embodiment of the compound of Formula (I) is a compound selected from Formula (II), Formula (III), Formula (IX), Formula (XI) or Formula (XII):

or a form thereof.

Another embodiment of the compound of Formula (I) is a compound of Formula (II):

or a form thereof.

Another embodiment of the compound of Formula (I) is a compound of Formula (III):

or a form thereof.

Another embodiment of the compound of Formula (I) is a compound of Formula (IV):

or a form thereof.

Another embodiment of the compound of Formula (I) is a compound of Formula (V):

or a form thereof.

Another embodiment of the compound of Formula (I) is a compound of Formula (VI):

or a form thereof.

Another embodiment of the compound of Formula (I) is a compound of Formula (VII):

or a form thereof.

Another embodiment of the compound of Formula (I) is a compound of Formula (VIII):

›EMBODIMENTS · 11 of 13

or a form thereof.

Another embodiment of the compound of Formula (I) is a compound of Formula (IX):

or a form thereof.

Another embodiment of the compound of Formula (I) is a compound of Formula (X):

or a form thereof.

Another embodiment of the compound of Formula (I) is a compound of Formula (XI):

or a form thereof.

Another embodiment of the compound of Formula (I) is a compound of Formula (XII):

or a form thereof.

Another embodiment of the compound of Formula (I) is a compound of Formula (XIII):

or a form thereof.

Another embodiment of the compound of Formula (I) is a compound of Formula (XIV):

or a form thereof.

An embodiment of the compound of Formula (I), Formula (II), Formula (III), Formula (IV), Formula (V), Formula (VI), Formula (VII), Formula (VIII), Formula (IX), Formula (X), Formula (XI), Formula (XII), Formula (XIII) or Formula (XIV) is a compound selected from Formula (Ia), Formula (IIa), Formula (IIIa), Formula (IVa), Formula (Va), Formula (VIa), Formula (VIIa), Formula (VIIIa), Formula (IXa), Formula (Xa), Formula (XIa), Formula (XIIa), Formula (XIIIa) or Formula (XIVa), respectively:

or a form thereof.

In an embodiment of the compound of Formula (Ia), one of w 3 , w 4 , w 6 and w 7 is C—R 1 and one other of w 3 , w 4 , w 6 and w 7 is C—R 2 , provided that,

when w 3 is C—R 1 , then w 6 is C—R 2 and w 4 and w 7 are independently C—R a or N; or,

when w 3 is C—R 2 , then w 6 is C—R 1 and w 4 and w 7 are independently C—R a or N; or,

when w 4 is C—R 1 , then w 7 is C—R 2 and w 3 is C—R a or N and w 6 is C—R c or N; or,

when w 4 is C—R 2 , then w 7 is C—R 1 and w 3 is C—R a or N and w 6 is C—R c or N.

In an embodiment of the compound of Formula (IIa), one of w 3 , w 4 , w 6 and w 7 is C—R 1 and one other of w 3 , w 4 , w 6 and w 7 is C—R 2 , provided that,

when w 3 is C—R 1 , then w 6 is C—R 2 and w 4 and w 7 are independently C—R a or N; or,

when w 3 is C—R 2 , then w 6 is C—R 1 and w 4 and w 7 are independently C—R a or N; or,

when w 4 is C—R 1 , then w 7 is C—R 2 and w 3 is C—R a or N and w 6 is C—R c or N; or,

when w 4 is C—R 2 , then w 7 is C—R 1 and w 3 is C—R a or N and w 6 is C—R c or N.

In an embodiment of the compound of Formula (IIIa), one of w 3 , w 4 , w 6 and w 7 is C—R 1 and one other of w 3 , w 4 , w 6 and w 7 is C—R 2 , provided that,

when w 3 is C—R 1 , then w 6 is C—R 2 and w 4 and w 7 are independently C—R a or N; or,

when w 3 is C—R 2 , then w 6 is C—R 1 and w 4 and w 7 are independently C—R a or N; or,

when w 4 is C—R 1 , then w 7 is C—R 2 and w 3 is C—R a or N and w 6 is C—R c or N; or,

when w 4 is C—R 2 , then w 7 is C—R 1 and w 3 is C—R a or N and w 6 is C—R c or N.

In an embodiment of the compound of Formula (IVa), one of w 4 and w 7 is C—R 1 and the other is C—R 2 , provided that, when w 4 is C—R 1 , then w 7 is C—R 2 ; or, when w 4 is C—R 2 , then w 7 is C—R 1 .

In an embodiment of the compound of Formula (Va), one of w 3 and w 6 is C—R 1 and the other is C—R 2 , provided that, when w 3 is C—R 1 , then w 6 is C—R 2 ; or, when w 3 is C—R 2 , then w 6 is C—R 1 .

In an embodiment of the compound of Formula (VIa), one of w 3 , w 4 , w 6 and w 7 is C—R 1 and one other of w 3 , w 4 , w 6 and w 7 is C—R 2 , provided that,

when w 3 is C—R 1 , then w 6 is C—R 2 and w 4 and w 7 are independently C—R a or N; or,

when w 3 is C—R 2 , then w 6 is C—R 1 and w 4 and w 7 are independently C—R a or N; or,

when w 4 is C—R 1 , then w 7 is C—R 2 and w 3 is C—R a or N and w 6 is C—R c or N; or,

when w 4 is C—R 2 , then w 7 is C—R 1 and w 3 is C—R a or N and w 6 is C—R c or N.

In an embodiment of the compound of Formula (VIIa), one of w 4 and w 7 is C—R 1 and the other is C—R 2 , provided that, when w 4 is C—R 1 , then w 7 is C—R 2 ; or, when w 4 is C—R 2 , then w 7 is C—R 1 .

In an embodiment of the compound of Formula (VIIIa), one of w 3 and w 6 is C—R 1 and the other is C—R 2 , provided that, when w 3 is C—R 1 , then w 6 is C—R 2 ; or, when w 3 is C—R 2 , then w 6 is C—R 1 .

In an embodiment of the compound of Formula (IXa), one of w 3 , w 4 , w 6 and w 7 is C—R 1 and one other of w 3 , w 4 , w 6 and w 7 is C—R 2 , provided that,

when w 3 is C—R 1 , then w 6 is C—R 2 and w 4 and w 7 are independently C—R a or N; or,

when w 3 is C—R 2 , then w 6 is C—R 1 and w 4 and w 7 are independently C—R a or N; or,

when w 4 is C—R 1 , then w 7 is C—R 2 and w 3 is C—R a or N and w 6 is C—R c or N; or,

when w 4 is C—R 2 , then w 7 is C—R 1 and w 3 is C—R a or N and w 6 is C—R c or N.

In an embodiment of the compound of Formula (Xa), one of w 3 and w 6 is C—R 1 and the other is C—R 2 , provided that, when w 3 is C—R 1 , then w 6 is C—R 2 ; or, when w 3 is C—R 2 , then w 6 is C—R 1 .

In an embodiment of the compound of Formula (XIa), one of w 4 and w 7 is C—R 1 and the other is C—R 2 , provided that, when w 4 is C—R 1 , then w 7 is C—R 2 ; or, when w 4 is C—R 2 , then w 7 is C—R 1 .

In an embodiment of the compound of Formula (XIIa), one of w 3 , w 4 , w 6 and w 7 is C—R 1 and one other of w 3 , w 4 , w 6 and w 7 is C—R 2 , provided that,

when w 3 is C—R 1 , then w 6 is C—R 2 and w 4 and w 7 are independently C—R a or N; or,

when w 3 is C—R 2 , then w 6 is C—R 1 and w 4 and w 7 are independently C—R a or N; or,

when w 4 is C—R 1 , then w 7 is C—R 2 and w 3 is C—R a or N and w 6 is C—R c or N; or,

when w 4 is C—R 2 , then w 7 is C—R 1 and w 3 is C—R a or N and w 6 is C—R c or N.

In an embodiment of the compound of Formula (XIIIa), one of w 3 and w 6 is C—R 1 and the other is C—R 2 , provided that, when w 3 is C—R 1 , then w 6 is C—R 2 ; or, when w 3 is C—R 2 , then w 6 is C—R 1 .

In an embodiment of the compound of Formula (XIVa), one of w 4 and w 7 is C—R 1 and the other is C—R 2 , provided that, when w 4 is C—R 1 , then w 7 is C—R 2 ; or, when w 4 is C—R 2 , then w 7 is C—R 1 .

An embodiment of the compound of Formula (I), Formula (II), Formula (III), Formula (IX), Formula (XI) or Formula (XII) is a compound selected from Formula (Ia), Formula (IIa), Formula (IIIa), Formula (IXa), Formula (XIa) or Formula (XIIa), respectively:

or a form thereof.

›EMBODIMENTS · 12 of 13

Another embodiment of the compound of Formula (I) is a compound of Formula (Ia):

or a form thereof.

Another embodiment of the compound of Formula (II) is a compound of Formula (IIa):

or a form thereof.

Another embodiment of the compound of Formula (III) is a compound of Formula (IIIa):

or a form thereof.

Another embodiment of the compound of Formula (IV) is a compound of Formula (IVa):

or a form thereof.

Another embodiment of the compound of Formula (V) is a compound of Formula (Va):

or a form thereof.

Another embodiment of the compound of Formula (VI) is a compound of Formula (VIa):

or a form thereof.

Another embodiment of the compound of Formula (VII) is a compound of Formula (VIIa):

or a form thereof.

Another embodiment of the compound of Formula (VIII) is a compound of Formula (VIIIa):

or a form thereof.

Another embodiment of the compound of Formula (IX) is a compound of Formula (IXa):

or a form thereof.

Another embodiment of the compound of Formula (X) is a compound of Formula (Xa):

or a form thereof.

Another embodiment of the compound of Formula (XI) is a compound of Formula (XIa):

or a form thereof.

Another embodiment of the compound of Formula (XII) is a compound of Formula (XIIa):

or a form thereof.

Another embodiment of the compound of Formula (XIII) is a compound of Formula (XIIIa):

or a form thereof.

Another embodiment of the compound of Formula (XIV) is a compound of Formula (XIVa):

or a form thereof.

An embodiment of the compound of Formula (Ia) is a compound of Formula (Ia1), Formula (Ia2), Formula (Ia3) or Formula (Ia4):

or a form thereof.

An embodiment of the compound of Formula (IIa) is a compound of Formula (IIa1), Formula (IIa2), Formula (IIa3) or Formula (IIa4):

or a form thereof.

An embodiment of the compound of Formula (IIIa) is a compound of Formula (IIIa1), Formula (IIIa2), Formula (IIIa3) or Formula (IIIa4):

or a form thereof.

An embodiment of the compound of Formula (IVa) includes a compound of Formula (IVa1) or Formula (IVa2):

or a form thereof.

An embodiment of the compound of Formula (Va) is a compound of Formula (Va1) or Formula (Va2):

or a form thereof.

An embodiment of the compound of Formula (VIa) is a compound of Formula (VIa1), Formula (VIa2), Formula (VIa3) or Formula (VIa4):

or a form thereof.

An embodiment of the compound of Formula (VIIa) includes a compound of Formula (VIIa1) or Formula (VIIa2):

or a form thereof.

An embodiment of the compound of Formula (VIIIa) is a compound of Formula (VIIIa1) or Formula (VIIIa2):

or a form thereof.

An embodiment of the compound of Formula (IXa) is a compound of Formula (IXa1), Formula (IXa2), Formula (IXa3) or Formula (IXa4):

or a form thereof.

An embodiment of the compound of Formula (Xa) is a compound of Formula (Xa1) or Formula (Xa2):

or a form thereof.

An embodiment of the compound of Formula (XIa) is a compound of Formula (XIa1) or Formula (XIa2):

or a form thereof.

An embodiment of the compound of Formula (XIIa) is a compound of Formula (XIIa1), Formula (XIIa2), Formula (XIIa3) or Formula (XIIa4):

or a form thereof.

An embodiment of the compound of Formula (XIIIa) is a compound of Formula (XIIIa1) or Formula (XIIIa2):

or a form thereof.

An embodiment of the compound of Formula (XIVa) is a compound of Formula (XIVa1) or Formula (XIVa2):

or a form thereof.

An embodiment of the compound of Formula (Ia) is a compound of Formula (Ia1):

or a form thereof.

An embodiment of the compound of Formula (Ia) is a compound of Formula (Ia2):

or a form thereof.

An embodiment of the compound of Formula (Ia) is a compound of Formula (Ia3):

or a form thereof.

An embodiment of the compound of Formula (Ia) is a compound of Formula (Ia4):

or a form thereof.

An embodiment of the compound of Formula (IIa) is a compound of Formula (IIa1):

or a form thereof.

An embodiment of the compound of Formula (IIa) is a compound of Formula (IIa2):

or a form thereof.

An embodiment of the compound of Formula (IIa) is a compound of Formula (IIa3):

or a form thereof.

An embodiment of the compound of Formula (IIa) is a compound of Formula (IIa4):

or a form thereof.

An embodiment of the compound of Formula (IIIa) is a compound of Formula (IIIa1):

or a form thereof.

An embodiment of the compound of Formula (IIIa) is a compound of Formula (IIIa2):

or a form thereof.

An embodiment of the compound of Formula (IIIa) is a compound of Formula (IIIa3):

or a form thereof.

An embodiment of the compound of Formula (IIIa) is a compound of Formula (IIIa4):

or a form thereof.

An embodiment of the compound of Formula (IVa) is a compound of Formula (IVa1):

or a form thereof.

An embodiment of the compound of Formula (IVa) is a compound of Formula (IVa2):

or a form thereof.

An embodiment of the compound of Formula (Va) is a compound of Formula (Va1):

or a form thereof.

An embodiment of the compound of Formula (Va) is a compound of Formula (Va2):

or a form thereof.

An embodiment of the compound of Formula (VIa) is a compound of Formula (VIa1):

or a form thereof.

An embodiment of the compound of Formula (VIa) is a compound of Formula (VIa2):

or a form thereof.

An embodiment of the compound of Formula (VIa) is a compound of Formula Formula (VIa3):

or a form thereof.

An embodiment of the compound of Formula (VIa) is a compound of Formula (VIa4):

or a form thereof.

An embodiment of the compound of Formula (VIIa) is a compound of Formula (VIIa1):

or a form thereof.

An embodiment of the compound of Formula (VIIa) is a compound of Formula (VIIa2):

or a form thereof.

An embodiment of the compound of Formula (VIIIa) is a compound of Formula (VIIIa1):

or a form thereof.

An embodiment of the compound of Formula (VIIIa) is a compound of Formula (VIIIa2):

or a form thereof.

An embodiment of the compound of Formula (IXa) is a compound of Formula (IXa1):

or a form thereof.

An embodiment of the compound of Formula (IXa) is a compound of Formula (IXa2):

or a form thereof.

An embodiment of the compound of Formula (IXa) is a compound of Formula (IXa3):

or a form thereof.

An embodiment of the compound of Formula (IXa) is a compound of Formula (IXa4):

or a form thereof.

An embodiment of the compound of Formula (Xa) is a compound of Formula (Xa1):

›EMBODIMENTS · 13 of 13

or a form thereof.

An embodiment of the compound of Formula (Xa) is a compound of Formula (Xa2):

or a form thereof.

An embodiment of the compound of Formula (XIa) is a compound of Formula (XIa1):

or a form thereof.

An embodiment of the compound of Formula (XIa) is a compound of Formula (XIa2):

or a form thereof.

An embodiment of the compound of Formula (XIIa) is a compound of Formula (XIIa1):

or a form thereof.

An embodiment of the compound of Formula (XIIa) is a compound of Formula (XIIa2):

or a form thereof.

An embodiment of the compound of Formula (XIIa) is a compound of Formula (XIIa3):

or a form thereof.

An embodiment of the compound of Formula (XIIa) is a compound of Formula (XIIa4):

or a form thereof.

An embodiment of the compound of Formula (XIIIa) is a compound of Formula (XIIIa1):

or a form thereof.

An embodiment of the compound of Formula (XIIIa) is a compound of Formula (XIIIa2):

or a form thereof.

An embodiment of the compound of Formula (XIVa) is a compound of Formula (XIVa1):

or a form thereof.

An embodiment of the compound of Formula (XIVa) is a compound of Formula (XIVa2):

or a form thereof.

An embodiment of the compound of Formula (I) is a compound selected from the group consisting of:

or a form thereof.

›TERMINOLOGY · 1 of 40

The chemical terms used above and throughout the description herein, unless specifically defined otherwise, shall be understood by one of ordinary skill in the art to have the following indicated meanings.

As used herein, the term “C 1-8 alkyl” generally refers to saturated hydrocarbon radicals having from one to eight carbon atoms in a straight or branched chain configuration, including, but not limited to, methyl, ethyl, n-propyl (also referred to as propyl or propanyl), isopropyl, n-butyl (also referred to as butyl or butanyl), isobutyl, sec-butyl, tert-butyl, n-pentyl (also referred to as pentyl or pentanyl), n-hexyl (also referred to as hexyl or hexanyl), n-heptyl (also referred to as heptyl or heptanyl), n-octyl and the like. In some embodiments, C 1-8 alkyl includes, but is not limited to, C 1-6 alkyl, C 1-4 alkyl and the like. A C 1-8 alkyl radical is optionally substituted with substituent species as described herein where allowed by available valences.

As used herein, the term “C 2-8 alkenyl” generally refers to partially unsaturated hydrocarbon radicals having from two to eight carbon atoms in a straight or branched chain configuration and one or more carbon-carbon double bonds therein, including, but not limited to, ethenyl (also referred to as vinyl), allyl, propenyl and the like. In some embodiments, C 2-8 alkenyl includes, but is not limited to, C 2-6 alkenyl, C 2-4 alkenyl and the like. A C 2-8 alkenyl radical is optionally substituted with substituent species as described herein where allowed by available valences.

As used herein, the term “C 2-8 alkynyl” generally refers to partially unsaturated hydrocarbon radicals having from two to eight carbon atoms in a straight or branched chain configuration and one or more carbon-carbon triple bonds therein, including, but not limited to, ethynyl, propynyl, butynyl and the like. In some embodiments, C 2-8 alkynyl includes, but is not limited to, C 2-6 alkynyl, C 2-4 alkynyl and the like. A C 2-8 alkynyl radical is optionally substituted with substituent species as described herein where allowed by available valences.

As used herein, the term “C 1-8 alkoxy” generally refers to saturated hydrocarbon radicals having from one to eight carbon atoms in a straight or branched chain configuration of the formula: —O—C 1-8 alkyl, including, but not limited to, methoxy, ethoxy, n-propoxy, isopropoxy, n-butoxy, isobutoxy, sec-butoxy, tert-butoxy, n-pentoxy, n-hexoxy and the like. In some embodiments, C 1-8 alkoxy includes, but is not limited to, C 1-6 alkoxy, C 1-4 alkoxy and the like. A C 1-8 alkoxy radical is optionally substituted with substituent species as described herein where allowed by available valences.

As used herein, the term “C 3-14 cycloalkyl” generally refers to a saturated or partially unsaturated monocyclic, bicyclic or polycyclic hydrocarbon radical, including, but not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cyclohexenyl, cycloheptyl, cyclooctyl, 1H-indanyl, indenyl, tetrahydro-naphthalenyl and the like. In some embodiments, C 3-14 cycloalkyl includes, but is not limited to, C 3-8 cycloalkyl, C 5-8 cycloalkyl, C 3-10 cycloalkyl and the like. A C 3-14 cycloalkyl radical is optionally substituted with substituent species as described herein where allowed by available valences.

As used herein, the term “aryl” generally refers to a monocyclic, bicyclic or polycyclic aromatic carbon atom ring structure radical, including, but not limited to, phenyl, naphthyl, anthracenyl, fluorenyl, azulenyl, phenanthrenyl and the like. An aryl radical is optionally substituted with substituent species as described herein where allowed by available valences.

As used herein, the term “heteroaryl” generally refers to a monocyclic, bicyclic or polycyclic aromatic carbon atom ring structure radical in which one or more carbon atom ring members have been replaced, where allowed by structural stability, with one or more heteroatoms, such as an O, S or N atom, including, but not limited to, furanyl (also referred to as furyl), thienyl (also referred to as thiophenyl), pyrrolyl, 2H-pyrrolyl, 3H-pyrrolyl, pyrazolyl, 1H-pyrazolyl, imidazolyl, 1H-imidazolyl, isoxazolyl, isothiazolyl, oxazolyl, 1,3-thiazolyl, triazolyl (such as 1H-1,2,3-triazolyl and the like), oxadiazolyl (such as 1,2,4-oxadiazolyl, 1,3,4-oxadiazolyl and the like), thiadiazolyl, tetrazolyl (such as 1H-tetrazolyl, 2H-tetrazolyl and the like), pyridinyl (also referred to as pyridyl), pyrimidinyl, pyrazinyl, pyridazinyl, triazinyl, indolyl, 1H-indolyl, indazolyl, 1H-indazolyl, 2H-indazolyl, indolizinyl, isoindolyl, benzofuranyl, benzothienyl (also referred to as benzothiophenyl), benzoimidazolyl, 1H-benzoimidazolyl, 1,3-benzothiazolyl, 1,3-benzoxazolyl (also referred to as 1,3-benzooxazolyl), purinyl, 9H-purinyl, quinolinyl, isoquinolinyl, quinazolinyl, quinoxalinyl, 1,3-diazinyl, 1,2-diazinyl, 1,2-diazolyl, 1,4-diazanaphthalenyl, acridinyl, furo[3,2-b]pyridinyl, furo[3,2-c]pyridinyl, furo[2,3-c]pyridinyl, 6H-thieno[2,3-b]pyrrolyl, thieno[3,2-c]pyridinyl, thieno[2,3-d]pyrimidinyl, 1H-pyrrolo[2,3-b]pyridinyl, 1H-pyrrolo[2,3-c]pyridinyl, 1H-pyrrolo[3,2-b]pyridinyl, pyrrolo[1,2-a]pyrazinyl, pyrrolo[1,2-b]pyridazinyl, pyrazolo[1,5-a]pyridinyl, pyrazolo[1,5-a]pyrazinyl, imidazo[1,2-a]pyridinyl, 3H-imidazo[4,5-b]pyridinyl, imidazo[1,2-a]pyrimidinyl, imidazo[1,2-c]pyrimidinyl, imidazo[1,2-b]pyridazinyl, imidazo[1,2-a]pyrazinyl, imidazo[2,1-b][1,3]thiazolyl, imidazo[2,1-b][1,3,4]thiadiazolyl, [1,2,4]triazolo[1,5-a]pyridinyl, [1,2,4]triazolo[4,3-a]pyridinyl and the like. A heteroaryl radical is optionally substituted on a carbon or nitrogen atom ring member with substituent species as described herein where allowed by available valences.

As used herein, the term “heterocyclyl” generally refers to a saturated or partially unsaturated monocyclic, bicyclic or polycyclic carbon atom ring structure radical in which one or more carbon atom ring members have been replaced, where allowed by structural stability, with a heteroatom, such as an O, S or N atom, including, but not limited to, oxiranyl, oxetanyl, azetidinyl, tetrahydrofuranyl, pyrrolinyl, pyrrolidinyl, pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, isoxazolinyl, isoxazolidinyl, isothiazolinyl, isothiazolidinyl, oxazolinyl, oxazolidinyl, thiazolinyl, thiazolidinyl, triazolinyl, triazolidinyl, oxadiazolinyl, oxadiazolidinyl, thiadiazolinyl, thiadiazolidinyl, tetrazolinyl, tetrazolidinyl, pyranyl, dihydro-2H-pyranyl, thiopyranyl, 1,3-dioxanyl, 1,2,5,6-tetrahydropyridinyl, 1,2,3,6-tetrahydropyridinyl, piperidinyl, piperazinyl, morpholinyl, thiomorpholinyl, 1,4-diazepanyl, 1,3-benzodioxolyl (also referred to as benzo[d][1,3]dioxolyl), 1,4-benzodioxanyl, 2,3-dihydro-1,4-benzodioxinyl (also referred to as 2,3-dihydrobenzo[b][1,4]dioxinyl), hexahydropyrrolo[3,4-b]pyrrol-(1H)-yl, (3aS,6aS)-hexahydropyrrolo[3,4-b]pyrrol-(1H)-yl, (3aR,6aR)-hexahydropyrrolo[3,4-b]pyrrol-(1H)-yl, hexahydropyrrolo[3,4-b]pyrrol-(2H)-yl, (3aS,6aS)-hexahydropyrrolo[3,4-b]pyrrol-(2H)-yl, (3aR,6aR)-hexahydropyrrolo[3,4-b]pyrrol-(2H)-yl, hexahydropyrrolo[3,4-c]pyrrol-(1H)-yl, (3aR,6aS)-hexahydropyrrolo[3,4-c]pyrrol-(1H)-yl, (3aR,6aR)-hexahydropyrrolo[3,4-c]pyrrol-(1H)-yl, octahydro-5H-pyrrolo[3,2-c]pyridinyl, octahydro-6H-pyrrolo[3,4-b]pyridinyl, (4aR,7aR)-octahydro-6H-pyrrolo[3,4-b]pyridinyl, (4aS,7aS)-octahydro-6H-pyrrolo[3,4-b]pyridinyl, hexahydropyrrolo[1,2-a]pyrazin-(1H)-yl, (7R,8aS)-hexahydropyrrolo[1,2-a]pyrazin-(1H)-yl, (8aS)-hexahydropyrrolo[1,2-a]pyrazin-(1H)-yl, (8aR)-hexahydropyrrolo[1,2-a]pyrazin-(1H)-yl, (8aS)-octahydropyrrolo[1,2-a]pyrazin-(1H)-yl, (8aR)-octahydropyrrolo[1,2-a]pyrazin-(1H)-yl, hexahydropyrrolo[1,2-a]pyrazin-(2H)-one, octahydro-2H-pyrido[1,2-a]pyrazinyl, 3-azabicyclo[3.1.0]hexyl, (1R,5S)-3-azabicyclo[3.1.0]hexyl, 8-azabicyclo[3.2.1]octyl, (1R,5S)-8-azabicyclo[3.2.1]octyl, 8-azabicyclo[3.2.1]oct-2-enyl, (1R,5S)-8-azabicyclo[3.2.1]oct-2-enyl, 9-azabicyclo[3.3.1]nonyl, (1R,5S)-9-azabicyclo[3.3.1]nonyl, 2,5-diazabicyclo[2.2.1]heptyl, (1S,4S)-2,5-diazabicyclo[2.2.1]heptyl, 2,5-diazabicyclo[2.2.2]octyl, 3,8-diazabicyclo[3.2.1]octyl, (1R,5S)-3,8-diazabicyclo[3.2.1]octyl, 1,4-diazabicyclo[3.2.2]nonyl, azaspiro[3.3]heptyl, 2,6-diazaspiro[3.3]heptyl, 2,7-diazaspiro[3.5]nonyl, 5,8-diazaspiro[3.5]nonyl, 2,7-diazaspiro[4.4]nonyl, 6,9-diazaspiro[4.5]decyl and the like. A heterocyclyl radical is optionally substituted on a carbon or nitrogen atom ring member with substituent species as described herein where allowed by available valences.

›TERMINOLOGY · 2 of 40

As used herein, the term “C 1-8 alkoxy-C 1-8 alkyl” refers to a radical of the formula: —C 1-8 alkyl-O—C 1-8 alkyl.

As used herein, the term “C 1-8 alkoxy-C 1-8 alkyl-amino” refers to a radical of the formula: —NH—C 1-8 alkyl-O—C 1-8 alkyl.

As used herein, the term “(C 1-8 alkoxy-C 1-8 alkyl) 2 -amino” refers to a radical of the formula: —N(C 1-8 alkyl-O—C 1-8 alkyl) 2 .

As used herein, the term “C 1-8 alkoxy-C 1-8 alkyl-amino-C 1-8 alkoxy” refers to a radical of the formula: —O—C 1-8 alkyl-NH—C 1-8 alkyl-O—C 1-8 alkyl.

As used herein, the term “(C 1-8 alkoxy-C 1-8 alkyl) 2 -amino-C 1-8 alkoxy” refers to a radical of the formula: —O—C 1-8 alkyl-N(C 1-8 alkyl-O—C 1-8 alkyl) 2 .

As used herein, the term “(C 1-8 alkoxy-C 1-8 alkyl)(C 1-8 alkyl)amino-C 1-8 alkoxy” refers to a radical of the formula: —O—C 1-8 alkyl-N(C 1-8 alkyl)(C 1-8 alkyl-O—C 1-8 alkyl).

As used herein, the term “C 1-8 alkoxy-C 1-8 alkyl-amino-C 1-8 alkyl” refers to a radical of the formula: —C 1-8 alkyl-NH—C 1-8 alkyl-O—C 1-8 alkyl.

As used herein, the term “(C 1-8 alkoxy-C 1-8 alkyl) 2 -amino-C 1-8 alkyl” refers to a radical of the formula: —C 1-8 alkyl-N(C 1-8 alkyl-O—C 1-8 alkyl) 2 .

As used herein, the term “(C 1-8 alkoxy-C 1-8 alkyl)(C 1-8 alkyl)amino-C 1-8 alkyl” refers to a radical of the formula: —C 1-8 alkyl-N(C 1-8 alkyl)(C 1-8 alkyl-O—C 1-8 alkyl).

As used herein, the term “C 1-8 alkoxy-carbonyl” refers to a radical of the formula: —C(O)—O—C 1-8 alkyl.

As used herein, the term “C 1-8 alkoxy-carbonyl-C 2-8 alkenyl” refers to a radical of the formula: —C 2-8 alkenyl-C(O)—O—C 1-8 alkyl.

As used herein, the term “C 1-8 alkoxy-carbonyl-amino” refers to a radical of the formula: —NH—C(O)—O—C 1-8 alkyl.

As used herein, the term “C 1-8 alkyl-amino” refers to a radical of the formula: —NH—C 1-8 alkyl.

As used herein, the term “(C 1-8 alkyl) 2 -amino” refers to a radical of the formula: —N(C 1-8 alkyl) 2 .

As used herein, the term “C 1-8 alkyl-amino-C 2-8 alkenyl” refers to a radical of the formula: —C 2-8 alkenyl-NH—C 1-8 alkyl.

As used herein, the term “(C 1-8 alkyl) 2 -amino-C 2-8 alkenyl” refers to a radical of the formula: —C 2-8 alkenyl-N(C 1-8 alkyl) 2 .

As used herein, the term “C 1-8 alkyl-amino-C 1-8 alkoxy” refers to a radical of the formula: —O—C 1-8 alkyl-NH—C 1-8 alkyl.

As used herein, the term “(C 1-8 alkyl) 2 -amino-C 1-8 alkoxy” refers to a radical of the formula: —O—C 1-8 alkyl-N(C 1-8 alkyl) 2 .

As used herein, the term “C 1-8 alkyl-amino-C 1-8 alkyl” refers to a radical of the formula: —C 1-8 alkyl-NH—C 1-8 alkyl.

As used herein, the term “(C 1-8 alkyl) 2 -amino-C 1-8 alkyl” refers to a radical of the formula: —C 1-8 alkyl-N(C 1-8 alkyl) 2 .

As used herein, the term “C 1-8 alkyl-amino-C 1-8 alkyl-amino” refers to a radical of the formula: —NH—C 1-8 alkyl-NH—C 1-8 alkyl.

As used herein, the term “(C 1-8 alkyl) 2 -amino-C 1-8 alkyl-amino” refers to a radical of the formula: —NH—C 1-8 alkyl-N(C 1-8 alkyl) 2 .

As used herein, the term “(C 1-8 alkyl-amino-C 1-8 alkyl) 2 -amino” refers to a radical of the formula: —N(C 1-8 alkyl-NH—C 1-8 alkyl) 2 .

As used herein, the term “[(C 1-8 alkyl) 2 -amino-C 1-8 alkyl] 2 -amino” refers to a radical of the formula: —N[C 1-8 alkyl-N(C 1-8 alkyl) 2 ] 2 .

As used herein, the term “(C 1-8 alkyl-amino-C 1-8 alkyl)(C 1-8 alkyl)amino” refers to a radical of the formula: —N(C 1-8 alkyl)(C 1-8 alkyl-NH—C 1-8 alkyl).

As used herein, the term “[(C 1-8 alkyl) 2 -amino-C 1-8 alkyl](C 1-8 alkyl)amino” refers to a radical of the formula: —N(C 1-8 alkyl)[C 1-8 alkyl-N(C 1-8 alkyl) 2 ].

As used herein, the term “C 1-8 alkyl-amino-C 2-8 alkynyl” refers to a radical of the formula: —C 2-8 alkynyl-NH—C 1-8 alkyl.

As used herein, the term “(C 1-8 alkyl) 2 -amino-C 2-8 alkynyl” refers to a radical of the formula: —C 2-8 alkynyl-N(C 1-8 alkyl) 2 .

As used herein, the term “C 1-8 alkyl-carbonyl” refers to a radical of the formula: —C(O)—C 1-8 alkyl.

As used herein, the term “C 1-8 alkyl-carbonyl-amino” refers to a radical of the formula: —NH—C(O)—C 1-8 alkyl.

As used herein, the term “C 1-8 alkyl-thio” refers to a radical of the formula: —S—C 1-8 alkyl.

As used herein, the term “amino-C 2-8 alkenyl” refers to a radical of the formula: —C 2-8 alkenyl-NH 2 .

As used herein, the term “amino-C 1-8 alkoxy” refers to a radical of the formula: —O—C 1-8 alkyl-NH 2 .

As used herein, the term “amino-C 1-8 alkyl” refers to a radical of the formula: —C 1-8 alkyl-NH 2 .

As used herein, the term “amino-C 1-8 alkyl-amino” refers to a radical of the formula: —NH—C 1-8 alkyl-NH 2 .

As used herein, the term “(amino-C 1-8 alkyl) 2 -amino” refers to a radical of the formula: —N(C 1-8 alkyl-NH 2 ) 2 .

As used herein, the term “(amino-C 1-8 alkyl)(C 1-8 alkyl)amino” refers to a radical of the formula: —N(C 1-8 alkyl)(C 1-8 alkyl-NH 2 ).

As used herein, the term “amino-C 2-8 alkynyl” refers to a radical of the formula: —C 2-8 alkynyl-NH 2 .

As used herein, the term “aryl-C 1-8 alkoxy-carbonyl” refers to a radical of the formula: —C(O)—O—C 1-8 alkyl-aryl.

As used herein, the term “aryl-C 1-8 alkyl” refers to a radical of the formula: —C 1-8 alkyl-aryl.

As used herein, the term “aryl-C 1-8 alkyl-amino” refers to a radical of the formula: —NH—C 1-8 alkyl-aryl.

As used herein, the term “(aryl-C 1-8 alkyl) 2 -amino” refers to a radical of the formula: —N(C 1-8 alkyl-aryl) 2 .

As used herein, the term “(aryl-C 1-8 alkyl)(C 1-8 alkyl)amino” refers to a radical of the formula: —N(C 1-8 alkyl)(C 1-8 alkyl-aryl).

As used herein, the term “aryl-C 1-8 alkyl-amino-C 1-8 alkyl” refers to a radical of the formula: —C 1-8 alkyl-NH—C 1-8 alkyl-aryl.

As used herein, the term “(aryl-C 1-8 alkyl) 2 -amino-C 1-8 alkyl” refers to a radical of the formula: —C 1-8 alkyl-N(C 1-8 alkyl-aryl) 2 .

As used herein, the term “(aryl-C 1-8 alkyl)(C 1-8 alkyl)amino-C 1-8 alkyl” refers to a radical of the formula: —C 1-8 alkyl-N(C 1-8 alkyl)(C 1-8 alkyl-aryl).

As used herein, the term “aryl-amino” refers to a radical of the formula: —NH-aryl.

As used herein, the term “aryl-amino-carbonyl” refers to a radical of the formula: —C(O)—NH-aryl.

›TERMINOLOGY · 3 of 40

As used herein, the term “aryl-sulfonyloxy-C 1-8 alkyl” refers to a radical of the formula: —C 1-8 alkyl-O—SO 2 -aryl.

As used herein, the term “benzoxy-carbonyl” refers to a radical of the formula: —C(O)—O—CH 2 -phenyl.

As used herein, the term “C 3-14 cycloalkyl-C 1-8 alkyl” refers to a radical of the formula: —C 1-8 alkyl-C 3-14 cycloalkyl.

As used herein, the term “C 3-14 cycloalkyl-amino” refers to a radical of the formula: —NH—C 3-14 cycloalkyl.

As used herein, the term “C 3-14 cycloalkyl-oxy” refers to a radical of the formula: —O—C 3-14 cycloalkyl.

As used herein, the term “halo” or “halogen” generally refers to a halogen atom radical, including fluoro, chloro, bromo and iodo.

As used herein, the term “halo-C 1-8 alkoxy” refers to a radical of the formula: —O—C 1-8 alkyl-halo, wherein C 1-8 alkyl is partially or completely substituted with one or more halogen atoms where allowed by available valences.

As used herein, the term “halo-C 1-8 alkyl” refers to a radical of the formula: —C 1-8 alkyl-halo, wherein C 1-8 alkyl is partially or completely substituted with one or more halogen atoms where allowed by available valences.

As used herein, the term “halo-C 1-8 alkyl-amino” refers to a radical of the formula: —NH—C 1-8 alkyl-halo.

As used herein, the term “(halo-C 1-8 alkyl)(C 1-8 alkyl)amino” refers to a radical of the formula: —N(C 1-8 alkyl)(C 1-8 alkyl-halo).

As used herein, the term “(halo-C 1-8 alkyl) 2 -amino” refers to a radical of the formula: —N(C 1-8 alkyl-halo) 2 .

As used herein, the term “heteroaryl-C 1-8 alkoxy” refers to a radical of the formula: —O—C 1-8 alkyl-heteroaryl.

As used herein, the term “heteroaryl-C 1-8 alkyl” refers to a radical of the formula: —C 1-8 alkyl-heteroaryl.

As used herein, the term “heteroaryl-C 1-8 alkyl-amino” refers to a radical of the formula: —NH—C 1-8 alkyl-heteroaryl.

As used herein, the term “(heteroaryl-C 1-8 alkyl) 2 -amino” refers to a radical of the formula: —N(C 1-8 alkyl-heteroaryl) 2 .

As used herein, the term “(heteroaryl-C 1-8 alkyl)(C 1-8 alkyl)amino” refers to a radical of the formula: —N(C 1-8 alkyl)(C 1-8 alkyl-heteroaryl).

As used herein, the term “heteroaryl-C 1-8 alkyl-amino-C 1-8 alkyl” refers to a radical of the formula: —C 1-8 alkyl-NH—C 1-8 alkyl-heteroaryl.

As used herein, the term “(heteroaryl-C 1-8 alkyl) 2 -amino-C 1-8 alkyl” refers to a radical of the formula: —C 1-8 alkyl-N(C 1-8 alkyl-heteroaryl) 2 .

As used herein, the term “(heteroaryl-C 1-8 alkyl)(C 1-8 alkyl)amino-C 1-8 alkyl” refers to a radical of the formula: —C 1-8 alkyl-N(C 1-8 alkyl)(C 1-8 alkyl-heteroaryl).

As used herein, the term “heteroaryl-amino” refers to a radical of the formula: —NH-heteroaryl.

As used herein, the term “heterocyclyl-C 1-8 alkoxy” refers to a radical of the formula: —O—C 1-8 alkyl-heterocyclyl.

As used herein, the term “heterocyclyl-C 1-8 alkyl” refers to a radical of the formula: —C 1-8 alkyl-heterocyclyl.

As used herein, the term “heterocyclyl-C 1-8 alkyl-amino” refers to a radical of the formula: —NH—C 1-8 alkyl-heterocyclyl.

As used herein, the term “(heterocyclyl-C 1-8 alkyl) 2 -amino” refers to a radical of the formula: —N(C 1-8 alkyl-heterocyclyl) 2 .

As used herein, the term “(heterocyclyl-C 1-8 alkyl)(C 1-8 alkyl)amino” refers to a radical of the formula: —N(C 1-8 alkyl)(C 1-8 alkyl-heterocyclyl).

As used herein, the term “heterocyclyl-C 1-8 alkyl-amino-C 1-8 alkyl” refers to a radical of the formula: —C 1-8 alkyl-NH—C 1-8 alkyl-heterocyclyl.

As used herein, the term “(heterocyclyl-C 1-8 alkyl) 2 -amino-C 1-8 alkyl” refers to a radical of the formula: —C 1-8 alkyl-N(C 1-8 alkyl-heterocyclyl) 2 .

As used herein, the term “(heterocyclyl-C 1-8 alkyl)(C 1-8 alkyl)amino-C 1-8 alkyl” refers to a radical of the formula: —C 1-8 alkyl-N(C 1-8 alkyl)(C 1-8 alkyl-heterocyclyl).

As used herein, the term “heterocyclyl-amino” refers to a radical of the formula: —NH-heterocyclyl.

As used herein, the term “(heterocyclyl)(C 1-8 alkyl)amino” refers to a radical of the formula: —N(C 1-8 alkyl)(heterocyclyl).

As used herein, the term “heterocyclyl-amino-C 1-8 alkyl” refers to a radical of the formula: —C 1-8 alkyl-NH-heterocyclyl.

As used herein, the term “heterocyclyl-carbonyl” refers to a radical of the formula: —C(O)-heterocyclyl.

As used herein, the term “heterocyclyl-carbonyl-oxy” refers to a radical of the formula: —O—C(O)-heterocyclyl.

As used herein, the term “heterocyclyl-oxy” refers to a radical of the formula: —O-heterocyclyl.

As used herein, the term “hydroxy” refers to a radical of the formula: —OH.

As used herein, the term “hydroxy-C 1-8 alkoxy-C 1-8 alkyl” refers to a radical of the formula: —C 1-8 alkyl-O—C 1-8 alkyl-OH.

As used herein, the term “hydroxy-C 1-8 alkyl” refers to a radical of the formula: —C 1-8 alkyl-OH, wherein C 1-8 alkyl is partially or completely substituted with one or more hydroxy radicals where allowed by available valences.

As used herein, the term “hydroxy-C 1-8 alkyl-amino” refers to a radical of the formula: —NH—C 1-8 alkyl-OH.

As used herein, the term “(hydroxy-C 1-8 alkyl) 2 -amino” refers to a radical of the formula: —N(C 1-8 alkyl-OH) 2 .

As used herein, the term “(hydroxy-C 1-8 alkyl)(C 1-8 alkyl)amino” refers to a radical of the formula: —N(C 1-8 alkyl)(C 1-8 alkyl-OH).

As used herein, the term “hydroxy-C 1-8 alkyl-amino-C 1-8 alkyl” refers to a radical of the formula: —C 1-8 alkyl-NH—C 1-8 alkyl-OH.

As used herein, the term “(hydroxy-C 1-8 alkyl) 2 -amino-C 1-8 alkyl” refers to a radical of the formula: —C 1-8 alkyl-N(C 1-8 alkyl-OH) 2 .

As used herein, the term “(hydroxy-C 1-8 alkyl)(C 1-8 alkyl)amino-C 1-8 alkyl” refers to a radical of the formula: —C 1-8 alkyl-N(C 1-8 alkyl)(C 1-8 alkyl-OH).

As used herein, the term “hydroxy-C 1-8 alkyl-amino-C 1-8 alkoxy” refers to a radical of the formula: —O—C 1-8 alkyl-NH—C 1-8 alkyl-OH.

As used herein, the term “(hydroxy-C 1-8 alkyl) 2 -amino-C 1-8 alkoxy” refers to a radical of the formula: —O—C 1-8 alkyl-N(C 1-8 alkyl-OH) 2 .

As used herein, the term “(hydroxy-C 1-8 alkyl)(C 1-8 alkyl)amino-C 1-8 alkoxy” refers to a radical of the formula: —O—C 1-8 alkyl-N(C 1-8 alkyl)(C 1-8 alkyl-OH).

›TERMINOLOGY · 4 of 40

As used herein, the term “hydroxy-C 1-8 alkyl-amino-C 1-8 alkyl-amino” refers to a radical of the formula: —NH—C 1-8 alkyl-NH—C 1-8 alkyl-OH.

As used herein, the term “(hydroxy-C 1-8 alkyl-amino-C 1-8 alkyl) 2 -amino” refers to a radical of the formula: —N(C 1-8 alkyl-NH—C 1-8 alkyl-OH) 2 .

As used herein, the term “(hydroxy-C 1-8 alkyl) 2 -amino-C 1-8 alkyl-amino” refers to a radical of the formula: —NH—C 1-8 alkyl-N(C 1-8 alkyl-OH) 2 .

As used herein, the term “(hydroxy-C 1-8 alkyl-amino-C 1-8 alkyl)(C 1-8 alkyl)amino” refers to a radical of the formula: —N(C 1-8 alkyl)(C 1-8 alkyl-NH—C 1-8 alkyl-OH).

As used herein, the term “[(hydroxy-C 1-8 alkyl) 2 -amino-C 1-8 alkyl](C 1-8 alkyl)amino” refers to a radical of the formula: —N(C 1-8 alkyl)[C 1-8 alkyl-N(C 1-8 alkyl-OH) 2 ].

As used herein, the term “(hydroxy-C 1-8 alkyl)(C 1-8 alkyl)amino-C 1-8 alkyl-amino” refers to a radical of the formula: —NH—C 1-8 alkyl-N(C 1-8 alkyl, C 1-8 alkyl-OH).

As used herein, the term “[(hydroxy-C 1-8 alkyl)(C 1-8 alkyl)amino-C 1-8 alkyl](C 1-8 alkyl)amino” refers to a radical of the formula: —N(C 1-8 alkyl)[C 1-8 alkyl-N(C 1-8 alkyl)(C 1-8 alkyl-OH)].

As used herein, the term “substituent” means positional variables on the atoms of a core molecule that are attached at a designated atom position, replacing one or more hydrogen atoms on the designated atom, provided that the atom of attachment does not exceed the available valence or shared valences, such that the substitution results in a stable compound. Accordingly, combinations of substituents and/or variables are permissible only if such combinations result in stable compounds. It should also be noted that any carbon as well as heteroatom with a valence level that appears to be unsatisfied as described or shown herein is assumed to have a sufficient number of hydrogen atom(s) to satisfy the valences described or shown.

For the purposes of this description, where one or more substituent variables for a compound of Formula (I) encompass functionalities incorporated into a compound of Formula (I), each functionality appearing at any location within the disclosed compound may be independently selected, and as appropriate, independently and/or optionally substituted.

As used herein, the terms “independently selected,” or “each selected” refer to functional variables in a substituent list that may be attached more than once on the structure of a core molecule, where the pattern of substitution at each occurrence is independent of the pattern at any other occurrence. Further, the use of a generic substituent on a core structure for a compound provided herein is understood to include the replacement of the generic substituent with specie substituents that are included within the particular genus, e.g., aryl may be independently replaced with phenyl or naphthalenyl (also referred to as naphthyl) and the like, such that the resulting compound is intended to be included within the scope of the compounds described herein.

As used herein, the term “each instance of” when used in a phrase such as “ . . . aryl, aryl-C 1-8 alkyl, heterocyclyl and heterocyclyl-C 1-8 alkyl, wherein each instance of aryl and heterocyclyl is optionally substituted with one or two substituents.” is intended to include optional, independent substitution on each of the aryl and heterocyclyl rings and on the aryl and heterocyclyl portions of aryl-C 1-8 alkyl and heterocyclyl-C 1-8 alkyl.

As used herein, the term “optionally substituted” means that the specified substituent variables, groups, radicals or moieties represent the scope of the genus and may be independently chosen as needed to replace one or more hydrogen atoms on the designated atom of attachment of a core molecule.

As used herein, the terms “stable compound” or “stable structure” mean a compound that is sufficiently robust to be isolated to a useful degree of purity from a reaction mixture and formulations thereof into an efficacious therapeutic agent.

Compound names provided herein were obtained using ACD Labs Index Name software provided by ACD Labs and/or ChemDraw Ultra software provided by CambridgeSoft®. When the compound name disclosed herein conflicts with the structure depicted, the structure shown will supercede the use of the name to define the compound intended. Nomenclature for substituent radicals defined herein may differ slightly from the chemical name from which they are derived; one skilled in the art will recognize that the definition of the substituent radical is intended to include the radical as found in the chemical name.

The term “SMN,” unless otherwise specified herein, refers to the human SMN1 gene, DNA or RNA, and/or human SMN2 gene, DNA or RNA. In a specific embodiment, the term “SMN1” refers to the human SMN1 gene, DNA or RNA. In another specific embodiment, the term “SMN2” refers to the human SMN2 gene, DNA or RNA.

Nucleic acid sequences for the human SMN1 and SMN2 genes are known in the art. For nucleic acid sequences of human SMN1, see, e.g., GenBank Accession Nos. DQ894095, NM_000344, NM_022874, and BC062723. For nucleic acid sequences of human SMN2, see, e.g., NM_022875, NM_022876, NM_022877, NM_017411, DQ894734 (Life Technologies, Inc. (formerly Invitrogen), Carlsbad, Calif.), BC000908, BC070242, CR595484, CR598529, CR609539, U21914, and BC015308.

The SMN1 gene can be found on the forward strand of human chromosome 5 from approximately nucleotide 70,220,768 to approximately nucleotide 70,249,769. The approximate locations of exons 6, 7 and 8 and introns 6 and 7 of SMN1 on human chromosome 5 are as follows:

70,241,893 to 70,242,003 exon 6;

70,242,004 to 70,247,767 intron 6;

70,247,768 to 70,247,821 exon 7;

70,247,822 to 70,248,265 intron 7; and,

70,248,266 to 70,248,839 exon 8.

The SMN2 gene can be found on the forward strand of human chromosome 5 from approximately nucleotide 69,345,350 to approximately nucleotide 69,374,349.

The approximate locations of exons 6, 7 and 8 and introns 6 and 7 of SMN2 on human chromosome 5 are as follows:

›TERMINOLOGY · 5 of 40

69,366,468 to 69,366,578 exon 6;

69,366,579 to 69,372,347 intron 6;

69,372,348 to 69,372,401 exon 7;

69,372,402 to 69,372,845 intron 7; and,

69,372,846 to 69,373,419 exon 8.

In specific embodiments, the nucleotide sequences delineated above for exons 6, 7 and 8 and introns 6 and 7 of SMN1 are used in the SMN1 minigene nucleic acid constructs described herein. In other specific embodiments, the nucleotide sequences of exons 6, 7 and 8 and introns 6 and 7 of SMN2 in the examples provided herein are used in the SMN2 minigene nucleic acid constructs described herein.

The term “Smn” or “Smn protein,” unless otherwise specified herein, refers to a human Smn protein that contains the amino acid residues encoded by exons 1 through 7 of the SMN1 gene and/or SMN2 gene. In a specific embodiment, the Smn protein is stable and functional in vitro and/or in vivo as assessed by methods known to one of skill in the art. In another specific embodiment, the Smn protein is the full-length protein encoded by the human SMN1 gene and/or SMN2 gene. In another specific embodiment, the Smn protein has the amino acid sequence found at GenBank Accession No. NP_000335, AAC50473.1, AAA66242.1, or NP_059107.

As used herein, the term “enhances the inclusion of exon 7 of SMN2 into mRNA that is transcribed from the SMN2 gene,” and analogous terms, unless otherwise specified herein, refers to the inclusion of the complete, intact, non-truncated sequence of exon 7 of SMN2 into the mature mRNA that is transcribed from the SMN2 gene (i.e., resulting in the production of full-length SMN2 mRNA) in vitro and/or in vivo, as assessed by methods known to one of skill in the art, such that increased levels of Smn protein are produced from the SMN2 gene in vitro and/or in vivo, as assessed by methods known to one of skill in the art; or, that increased expression of stable and functional Smn protein is produced from the SMN2 gene in vitro and/or in vivo, as assessed by methods known to one of skill in the art; or, that expression of the fusion protein encoded by the minigene is increased in vitro and/or in vivo, as assessed by methods known to one of skill in the art; or, that expression of Smn protein produced from the SMN2 gene in a subject (e.g., an animal model for SMA or a human subject or an SMA patient) in need thereof is increased.

As used herein, the term “enhances the inclusion of exon 7 of SMN1 into mRNA that is transcribed from the SMN1 gene,” and analogous terms, unless otherwise specified herein, refers to the inclusion of the complete, intact, non-truncated sequence of exon 7 of SMN1 into the mature mRNA that is transcribed from the SMN1 gene (i.e., resulting in the production of full-length SMN1 mRNA) in vitro and/or in vivo, as assessed by methods known to one of skill in the art, such that increased levels of Smn protein are produced from the SMN1 gene in vitro and/or in vivo, as assessed by methods known to one of skill in the art; or, that increased expression of stable and functional Smn protein is produced from the SMN1 gene in vitro and/or in vivo, as assessed by methods known to one of skill in the art; or, that expression of the fusion protein encoded by the minigene is increased in vitro and/or in vivo, as assessed by methods known to one of skill in the art; or, that expression of Smn protein produced from the SMN1 gene in a subject (e.g., an animal model for SMA or a human subject) in need thereof is increased.

As used herein, the term “substantial change” in the context of the amount of mRNA means that the amount of mRNA does not change by a statistically significant amount, e.g., a p value less than a value selected from 0.1, 0.05, 0.01, 0.005, 0.001, 0.0005, 0.0001, 0.00005 or 0.00001.

As used herein, the terms “subject” and “patient” are used interchangeably to refer to an animal or any living organism having sensation and the power of voluntary movement, and which requires for its existence oxygen and organic food. Nonlimiting examples include members of the human, equine, porcine, bovine, rattus, murine, canine and feline species. In some embodiments, the subject is a mammal or a warm-blooded vertebrate animal. In certain embodiments, the subject is a non-human animal. In specific embodiments, the subject is a human. In one specific embodiment, the subject is a human SMA patient.

As used herein, the term “elderly human” refers to a human 65 years old or older.

As used herein, the term “human adult” refers to a human that is 18 years or older.

As used herein, the term “human child” refers to a human that is 1 year to 18 years old.

As used herein, the term “human infant” refers to a newborn to 1 year old year human.

As used herein, the term “human toddler” refers to a human that is 1 year to 3 years old.

Compound Forms

As used herein, the terms “a compound of Formula (Ia),” “a compound of Formula (Ia1),” “a compound of Formula (Ia2),” “a compound of Formula (Ia3),” “a compound of Formula (Ia4),” “a compound of Formula (II),” “a compound of Formula (IIa),” “a compound of Formula (IIa1),” “a compound of Formula (IIa2),” “a compound of Formula (IIa3),” “a compound of Formula (IIa4),” “a compound of Formula (III),” “a compound of Formula (IIIa),” “a compound of Formula (IIIa1),” “a compound of Formula (IIIa2),” “a compound of Formula (IIIa3),” “a compound of Formula (IIIa4),” “a compound of Formula (IV),” “a compound of Formula (IVa),” “a compound of Formula (IVa1),” “a compound of Formula (IVa2),” “a compound of Formula (V),” “a compound of Formula (Va),” “a compound of Formula (Va1),” “a compound of Formula (Va2),” “a compound of Formula (VI),” “a compound of Formula (VIa),” “a compound of Formula (VIa1),” “a compound of Formula (VIa2),” “a compound of Formula (VIa3),” “a compound of Formula (VIa4),” “a compound of Formula (VII),” “a compound of Formula (VIIa),” “a compound of Formula (VIIa1),” “a compound of Formula (VIIa2),” “a compound of Formula (VIII),” “a compound of Formula (VIIIa),” “a compound of Formula (VIIIa1),” “a compound of Formula (VIIIa2),” “a compound of Formula (IX),” “a compound of Formula (IXa),” “a compound of Formula (IXa1),” “a compound of Formula (IXa2),” “a compound of Formula (IXa3),” “a compound of Formula (IXa4),” “a compound of Formula (X),” “a compound of Formula (Xa),” “a compound of Formula (Xa1),” “a compound of Formula (Xa2),” “a compound of Formula (XI),” “a compound of Formula (XIa),” “a compound of Formula (XIa1),” “a compound of Formula (XIa2),” “a compound of Formula (XII),” “a compound of Formula (XIIa),” “a compound of Formula (XIIa1),” “a compound of Formula (XIIa2),” “a compound of Formula (XIIa3),” “a compound of Formula (XIIa4),” “a compound of Formula (XIII),” “a compound of Formula (XIIIa),” “a compound of Formula (XIIIa1),” “a compound of Formula (XIIIa2),” “a compound of Formula (XIV),” “a compound of Formula (XIVa),” “a compound of Formula (XIVa1),” and “a compound of Formula (XIVa2),” each refer to subgenera of the compound of Formula (I) or a form thereof.

›TERMINOLOGY · 6 of 40

Rather than repeat embodiments for the various subgenera of the compound of Formula (I), in certain embodiments, the term “a compound of Formula (I) or a form thereof” is used to inclusively to refer to a compound of Formula (Ia) or a form thereof, a compound of Formula (Ia1) or a form thereof, a compound of Formula (Ia2) or a form thereof, a compound of Formula (Ia3) or a form thereof, a compound of Formula (Ia4) or a form thereof, a compound of Formula (II) or a form thereof, a compound of Formula (IIa) or a form thereof, a compound of Formula (IIa1) or a form thereof, a compound of Formula (IIa2) or a form thereof, a compound of Formula (IIa3) or a form thereof, a compound of Formula (IIa4) or a form thereof, a compound of Formula (III) or a form thereof, a compound of Formula (IIIa) or a form thereof, a compound of Formula (IIIa1) or a form thereof, a compound of Formula (IIIa2) or a form thereof, a compound of Formula (IIIa3) or a form thereof, a compound of Formula (IIIa4) or a form thereof, a compound of Formula (IV) or a form thereof, a compound of Formula (IVa) or a form thereof, a compound of Formula (IVa1) or a form thereof, a compound of Formula (IVa2) or a form thereof, a compound of Formula (V) or a form thereof, a compound of Formula (Va) or a form thereof, a compound of Formula (Va1) or a form thereof, a compound of Formula (Va2) or a form thereof, a compound of Formula (VI) or a form thereof, a compound of Formula (VIa) or a form thereof, a compound of Formula (VIa1) or a form thereof, a compound of Formula (VIa2) or a form thereof, a compound of Formula (VIa3) or a form thereof, a compound of Formula (VIa4) or a form thereof, a compound of Formula (VII) or a form thereof, a compound of Formula (VIIa) or a form thereof, a compound of Formula (VIIa1) or a form thereof, a compound of Formula (VIIa2) or a form thereof, a compound of Formula (VIII) or a form thereof, a compound of Formula (VIIIa) or a form thereof, a compound of Formula (VIIIa1) or a form thereof, a compound of Formula (VIIIa2) or a form thereof, a compound of Formula (IX) or a form thereof, a compound of Formula (IXa) or a form thereof, a compound of Formula (IXa1) or a form thereof, a compound of Formula (IXa2) or a form thereof, a compound of Formula (IXa3) or a form thereof, a compound of Formula (IXa4) or a form thereof, a compound of Formula (X) or a form thereof, a compound of Formula (Xa) or a form thereof, a compound of Formula (Xa1) or a form thereof, a compound of Formula (Xa2) or a form thereof, a compound of Formula (XI) or a form thereof, a compound of Formula (XIa) or a form thereof, a compound of Formula (XIa1) or a form thereof, a compound of Formula (XIa2) or a form thereof, a compound of Formula (XII) or a form thereof, a compound of Formula (XIIa) or a form thereof, a compound of Formula (XIIa1) or a form thereof, a compound of Formula (XIIa2) or a form thereof, a compound of Formula (XIIa3) or a form thereof, a compound of Formula (XIIa4) or a form thereof, a compound of Formula (XIII) or a form thereof, a compound of Formula (XIIIa) or a form thereof, a compound of Formula (XIIIa1) or a form thereof, a compound of Formula (XIIIa2) or a form thereof, a compound of Formula (XIV) or a form thereof, a compound of Formula (XIVa) or a form thereof, a compound of Formula (XIVa1) or a form thereof or a compound of Formula (XIVa2) or a form thereof, either separately or together.

Thus, embodiments and references to “a compound of Formula (I)” are intended to be inclusive of compounds of Formula (Ia), Formula (Ia1), Formula (Ia2), Formula (Ia3), Formula (Ia4), Formula (II), Formula (IIa), Formula (IIa1), Formula (IIa2), Formula (IIa3), Formula (IIa4), Formula (III), Formula (IIIa), Formula (IIIa1), Formula (IIIa2), Formula (IIIa3), Formula (IIIa4), Formula (IV), Formula (IVa), Formula (IVa1), Formula (IVa2), Formula (V), Formula (Va), Formula (Va1), Formula (Va2), Formula (VI), Formula (VIa), Formula (VIa1), Formula (VIa2), Formula (VIa3), Formula (VIa4), Formula (VII), Formula (VIIa), Formula (VIIa1), Formula (VIIa2), Formula (VIII), Formula (VIIIa), Formula (VIIIa1), Formula (VIIIa2), Formula (IX), Formula (IXa), Formula (IXa1), Formula (IXa2), Formula (IXa3), Formula (IXa4), Formula (X), Formula (Xa), Formula (Xa1), Formula (Xa2), Formula (XI), Formula (XIa), Formula (XIa1), Formula (XIa2), Formula (XII), Formula (XIIa), Formula (XIIa1), Formula (XIIa2), Formula (XIIa3), Formula (XIIa4), Formula (XIII), Formula (XIIIa), Formula (XIIIa1), Formula (XIIIa2), Formula (XIV), Formula (XIVa), Formula (XIVa1) and Formula (XIVa2).

As used herein, the term “form” means a compound of Formula (I) selected from a free acid, free base, salt, isotopologue, stereoisomer, racemate, enantiomer, diastereomer, or tautomer thereof.

In certain embodiments described herein, the form of the compound of Formula (I) is a selected from a salt, isotopologue, stereoisomer, racemate, enantiomer, diastereomer or tautomer thereof.

In certain embodiments described herein, the form of the compound of Formula (I) is a selected from a free acid, isotopologue, stereoisomer, racemate, enantiomer, diastereomer or tautomer thereof.

In certain embodiments described herein, the form of the compound of Formula (I) is a selected from a free base, isotopologue, stereoisomer, racemate, enantiomer, diastereomer or tautomer thereof.

In certain embodiments described herein, the form of the compound of Formula (I) is a free acid, free base or salt thereof.

In certain embodiments described herein, the form of the compound of Formula (I) is an isotopologue thereof.

In certain embodiments described herein, the form of the compound of Formula (I) is a stereoisomer, racemate, enantiomer or diastereomer thereof.

In certain embodiments described herein, the form of the compound of Formula (I) is a tautomer thereof.

In certain embodiments described herein, the form of the compound of Formula (I) is a pharmaceutically acceptable form.

In certain embodiments described herein, the compound of Formula (I) or a form thereof is isolated for use.

›TERMINOLOGY · 7 of 40

As used herein, the term “isolated” means the physical state of a compound of Formula (I) or a form thereof after being isolated and/or purified from a synthetic process (e.g., from a reaction mixture) or natural source or combination thereof according to an isolation or purification process or processes described herein or which are well known to the skilled artisan (e.g., chromatography, recrystallization and the like) in sufficient purity to be characterizable by standard analytical techniques described herein or well known to the skilled artisan.

As used herein, the term “protected” means that a functional group on a compound of Formula (I) is in a form modified to preclude undesired side reactions at the protected site when the compound is subjected to a reaction. Suitable protecting groups will be recognized by those with ordinary skill in the art as well as by reference to standard textbooks such as, for example, T. W. Greene et al, Protective Groups in Organic Synthesis (1991), Wiley, New York.

Prodrugs of a compound of Formula (I) or a form thereof are also contemplated herein.

As used herein, the term “prodrug” means that a functional group on a compound of Formula (I) is in a form (e.g., acting as an active or inactive drug precursor) that is transformed in vivo to yield an active or more active compound of Formula (I) or a form thereof. The transformation may occur by various mechanisms (e.g., by metabolic and/or non-metabolic chemical processes), such as, for example, by hydrolysis and/or metabolism in blood, liver and/or other organs and tissues. A discussion of the use of prodrugs is provided by V. J. Stella, et. al., “Biotechnology: Pharmaceutical Aspects, Prodrugs: Challenges and Rewards,” American Association of Pharmaceutical Scientists and Springer Press, 2007.

In one example, when a compound of Formula (I) or a form thereof contains a carboxylic acid functional group, a prodrug can comprise an ester formed by the replacement of the hydrogen atom of the acid group with a functional group such as alkyl and the like. In another example, when a compound of Formula (I) or a form thereof contains an alcohol functional group, a prodrug can be formed by the replacement of the hydrogen atom of the alcohol group with a functional group such as alkyl or substituted carbonyl and the like. In another example, when a compound of Formula (I) or a form thereof contains an amine functional group, a prodrug can be formed by the replacement of one or more amine hydrogen atoms with a functional group such as alkyl or substituted carbonyl. In another example, when a compound of Formula (I) or a form thereof contains a hydrogen substituent, a prodrug can be formed by the replacement of one or more hydrogen atoms with an alkyl substituent.

Pharmaceutically acceptable prodrugs of compounds of Formula (I) or a form thereof include those compounds substituted with one or more of the following groups: carboxylic acid esters, sulfonate esters, amino acid esters phosphonate esters, mono-, di- or triphosphate esters or alkyl substituents where appropriate. As described herein, it is understood by a person of ordinary skill in the art that one or more of such substituents may be used to provide a compound of Formula (I) or a form thereof for use as a prodrug.

The compounds of Formula (I) can form salts which are intended to be included within the scope of this description. Reference to a compound of Formula (I) herein is understood to include reference to salts thereof, unless otherwise indicated. The term “salt(s)”, as employed herein, denotes acidic salts formed with inorganic and/or organic acids, as well as basic salts formed with inorganic and/or organic bases. In addition, when a compound of Formula (I) contains both a basic moiety, such as, but not limited to a pyridine or imidazole, and an acidic moiety, such as, but not limited to a carboxylic acid, zwitterions (“inner salts”) may be formed and are included within the term “salt(s)” as used herein.

The term “pharmaceutically acceptable salt(s)”, as used herein, means those salts of compounds described herein that are safe and effective (i.e., non-toxic, physiologically acceptable) for use in mammals and that possess biological activity, although other salts are also useful. Salts of the compounds of Formula (I) may be formed, for example, by reacting a compound of Formula (I) with an amount of acid or base, such as an equivalent or stoichiometric amount, in a medium such as one in which the salt precipitates or in an aqueous medium followed by lyophilization.

Pharmaceutically acceptable salts include one or more salts of acidic or basic groups present in compounds described herein. Embodiments of acid addition salts include, but are not limited to, an acetate, diacetate, acid phosphate, ascorbate, benzoate, benzenesulfonate, bisulfate, bitartrate, borate, butyrate, chloride, citrate, camphorate, camphorsulfonate, ethanesulfonate, formate, fumarate, gentisinate, gluconate, glucaronate, glutamate, hydrobromide, hydrochloride, dihydrochloride, trihydrochloride, hydroiodide, isonicotinate, lactate, maleate, methanesulfonate, naphthalenesulfonate, nitrate, oxalate, pamoate, pantothenate, phosphate, propionate, saccharate, salicylate, succinate, sulfate, tartrate, thiocyanate, toluenesulfonate (also known as tosylate), trifluoroacetate, trifluoroacetic acid salt and the like. One or more embodiments of acid addition salts include chloride, hydrobromide, hydrochloride, dihydrochloride, trihydrochloride, acetate, diacetate, trifluoroacetate, trifluoroacetic acid salt and the like. More particular embodiments include a chloride, hydrobromide, hydrochloride, dihydrochloride, trifluoroacetate, trifluoroacetic acid salt and the like.

Additionally, acids which are generally considered suitable for the formation of pharmaceutically useful salts from basic pharmaceutical compounds are discussed, for example, by P. Stahl et al, Camille G. (eds.) Handbook of Pharmaceutical Salts. Properties, Selection and Use . (2002) Zurich: Wiley-VCH; S. Berge et al, Journal of Pharmaceutical Sciences (1977) 66(1) 1-19; P. Gould, International J. of Pharmaceutics (1986) 33, 201-217; Anderson et al, The Practice of Medicinal Chemistry (1996), Academic Press, New York; and in The Orange Book (see, website for Food & Drug Administration, Washington, D.C.). These disclosures are incorporated herein by reference thereto.

›TERMINOLOGY · 8 of 40

Suitable basic salts include, but are not limited to, aluminum, ammonium, calcium, lithium, magnesium, potassium, sodium, zinc, and diethanolamine salts. Certain compounds described herein can also form pharmaceutically acceptable salts with organic bases (for example, organic amines) such as, but not limited to, dicyclohexylamines, tert-butyl amines and the like, and with various amino acids such as, but not limited to, arginine, lysine and the like. Basic nitrogen—containing groups may be quarternized with agents such as lower alkyl halides (e.g., methyl, ethyl, and butyl chlorides, bromides and iodides), dialkyl sulfates (e.g., dimethyl, diethyl, and dibutyl sulfates), long chain halides (e.g., decyl, lauryl, and stearyl chlorides, bromides and iodides), aralkyl halides (e.g., benzyl and phenethyl bromides), and others.

All such acid salts and base salts are intended to be pharmaceutically acceptable salts within the scope of the description herein and all such acid and base salts are considered equivalent to the free forms of the corresponding compounds for the purposes described herein.

Compounds of Formula I and forms thereof may further exist in a tautomeric form. All such tautomeric forms are contemplated herein as part of the present description.

The compounds of Formula (I) may contain asymmetric or chiral centers, and, therefore, may exist in different stereoisomeric forms. The present description is intended to include all stereoisomeric forms of the compounds of Formula (I) as well as mixtures thereof, including racemic mixtures.

The compounds of Formula (I) described herein may include one or more chiral centers, and as such may exist as racemic mixtures (R/S) or as substantially pure enantiomers and diastereomers. The compounds may also exist as substantially pure (R) or (S) enantiomers (when one chiral center is present). In one embodiment, the compounds of Formula (I) described herein are (S) isomers and may exist as enantiomerically pure compositions substantially comprising only the (S) isomer. In another embodiment, the compounds of Formula (I) described herein are (R) isomers and may exist as enantiomerically pure compositions substantially comprising only the (R) isomer. As one of skill in the art will recognize, when more than one chiral center is present, the compounds of Formula (I) described herein may also include portions described as an (R,R), (R,S), (S,R) or (S,S) isomer, as defined by IUPAC Nomenclature Recommendations.

As used herein, the term “substantially pure” refers to compounds consisting substantially of a single isomer in an amount greater than or equal to 90%, in an amount greater than or equal to 92%, in an amount greater than or equal to 95%, in an amount greater than or equal to 98%, in an amount greater than or equal to 99%, or in an amount equal to 100% of the single isomer.

In one aspect, a compound of Formula (I) is a substantially pure (S) enantiomer present in an amount greater than or equal to 90%, in an amount greater than or equal to 92%, in an amount greater than or equal to 95%, in an amount greater than or equal to 98%, in an amount greater than or equal to 99%, or in an amount equal to 100%.

In one aspect, a compound of Formula (I) is a substantially pure (R) enantiomer present in an amount greater than or equal to 90%, in an amount greater than or equal to 92%, in an amount greater than or equal to 95%, in an amount greater than or equal to 98%, in an amount greater than or equal to 99%, or in an amount equal to 100%.

As used herein, a “racemate” is any mixture of isometric forms that are not “enantiomerically pure”, including mixtures such as, without limitation, in a ratio of about 50/50, about 60/40, about 70/30, about 80/20, about 85/15 or about 90/10.

In addition, the present description embraces all geometric and positional isomers. For example, if a compound of Formula (I) incorporates a double bond or a fused ring, both the cis- and trans-forms, as well as mixtures, are embraced within the scope of the description herein.

Diastereomeric mixtures can be separated into their individual diastereomers on the basis of their physical chemical differences by methods well known to those skilled in the art, such as, for example, by chromatography and/or fractional crystallization. Enantiomers can be separated by use of chiral HPLC column or other chromatographic methods known to those skilled in the art.

Enantiomers can also be separated by converting the enantiomeric mixture into a diastereomeric mixture by reaction with an appropriate optically active compound (e.g., chiral auxiliary such as a chiral alcohol or Mosher's acid chloride), separating the diastereomers and converting (e.g., hydrolyzing) the individual diastereomers to the corresponding pure enantiomers. Also, some of the compounds of Formula (I) may be atropisomers (e.g., substituted biaryls) and are considered part of this description.

All stereoisomer forms (for example, geometric isomers, optical isomers, positional isomers and the like) of the present compounds (including salts, solvates, esters and prodrugs and transformed prodrugs thereof) which may exist due to asymmetric carbons on various substituents, including enantiomeric forms (which may exist even in the absence of asymmetric carbons), rotameric forms, atropisomers, diastereomeric forms and regioisomeric forms are contemplated within the scope of the description herein. For example, if a compound of Formula (I) incorporates a double bond or a fused ring, both the cis- and trans-forms, as well as mixtures thereof, are embraced within the scope of the description herein. Also, for example, all keto-enol and imine-enamine tautomeric forms of the compounds are included in the description herein. Individual stereoisomers of the compounds of Formula (I) described herein may, for example, be substantially free of other isomers, or may be present in a racemic mixture, as described supra.

The use of the terms “salt,” “prodrug” and “transformed prodrug” are intended to equally apply to the salts, prodrugs and transformed prodrugs of all contemplated isotopologues, stereoisomers, racemates or tautomers of the instant compounds.

›TERMINOLOGY · 9 of 40

The term “isotopologue” refers to isotopically-enriched compounds which are identical to those recited herein, but for the fact that one or more atoms are replaced by an atom having an atomic mass or mass number different from the atomic mass or mass number usually found in nature. Examples of isotopes that can be incorporated into compounds described herein include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorus, fluorine and chlorine, such as H 2 , H 3 , C 13 , C 14 , N 15 , O 18 , O 17 , P 31 , P 32 , S 35 , F 18 , Cl 35 , and Cl 36 , respectively, each of which is also within the scope of this description.

Certain isotopically-enriched compounds described herein (e.g., those labeled with H 3 and C 14 ) are useful in compound and/or substrate tissue distribution assays. Tritiated (i.e., H 3 ) and carbon-14 (i.e., C 14 ) isotopes are particularly preferred for their ease of preparation and detectability. Further, substitution with heavier isotopes such as deuterium (i.e., “deuterium enriched”) may afford certain therapeutic advantages resulting from greater metabolic stability (e.g., increased in vivo half-life or reduced dosage requirements) and hence may be preferred in some circumstances. Isotopically-enriched compounds of Formula (I) can generally be prepared using procedures known to persons of ordinary skill in the art by substituting an appropriate isotopically-enriched reagent for a non-isotopically-enriched reagent.

When the compounds are enriched with deuterium, the deuterium-to-hydrogen ratio on the deuterated atoms of the molecule substantially exceeds the naturally occurring deuterium-to-hydrogen ratio.

An embodiment described herein may include an isotopologue form of the compound of Formula (I), wherein the isotopologue is substituted on one or more atom members of the compound of Formula (I) with one or more deuterium atoms in place of one or more hydrogen atoms.

An embodiment described herein may include a compound of Formula (I) and forms thereof, wherein a carbon atom may have from 1 to 3 hydrogen atoms optionally replaced with deuterium.

One or more compounds described herein may exist in unsolvated as well as solvated forms with pharmaceutically acceptable solvents such as water, ethanol, and the like, and the description herein is intended to embrace both solvated and unsolvated forms.

As used herein, the term “solvate” means a physical association of a compound described herein with one or more solvent molecules. This physical association involves varying degrees of ionic and covalent bonding, including hydrogen bonding. In certain instances the solvate will be capable of isolation, for example when one or more solvent molecules are incorporated in the crystal lattice of the crystalline solid. As used herein, “solvate” encompasses both solution-phase and isolatable solvates. Non-limiting examples of suitable solvates include ethanolates, methanolates, and the like.

One or more compounds described herein may optionally be converted to a solvate. Preparation of solvates is generally known. A typical, non-limiting process involves dissolving a compound in a desired amount of the desired solvent (organic or water or mixtures thereof) at a higher than ambient temperature, and cooling the solution at a rate sufficient to form crystals which are then isolated by standard methods. Analytical techniques such as, for example infrared spectroscopy, show the presence of the solvent (or water) in the crystals as a solvate (or hydrate).

As used herein, the term “hydrate” means a solvate wherein the solvent molecule is water.

Polymorphic crystalline and amorphous forms of the compounds of Formula (I), and of the salts, solvates, esters and prodrugs of the compounds of Formula (I), are further intended to be included in the scope of the compounds described herein.

Compound Uses

Compounds of Formula (I) or a form thereof that enhance inclusion of exon 7 of SMN2 into mRNA that is transcribed from the SMN2 gene are described herein. Such compounds of Formula (I) or a form thereof have been shown to enhance the inclusion of exon 7 of SMN2 into mRNA that is transcribed from the SMN2 gene using the assays described herein (see Biological example section, infra). Accordingly, compounds of Formula (I) or a form thereof have utility as enhancers for the inclusion of exon 7 of SMN2 into mRNA that is transcribed from the SMN2 gene.

Compounds of Formula (I) or a form thereof for enhancing inclusion of exon 7 of SMN1 into mRNA that is transcribed from the SMN1 gene are described herein. Such compounds of Formula (I) or a form thereof may enhance inclusion of exon 7 of SMN1 into mRNA that is transcribed from the SMN1 gene using, e.g., an SMN1 minigene assay. Accordingly, compounds of Formula (I) or a form thereof may have utility as enhancers for the inclusion of exon 7 of SMN1 into mRNA that is transcribed from the SMN1 gene.

In one aspect, provided herein are methods for modulating the inclusion of exon 7 of SMN2 into RNA transcribed from the SMN2 gene, comprising contacting a human cell with a compound of Formula (I) or a form thereof. In a specific embodiment, provided herein are methods for modulating the inclusion of exon 7 of SMN2 into RNA transcribed from the SMN2 gene, comprising contacting a human cell with a compound of Formula (I) or a form thereof that modulates the expression of an SMN2 minigene described herein or in International Publication No. WO2009/151546 or U.S. Patent Application Publication No. 2011/0086833, each of which is incorporated herein by reference in its entirety. In one embodiment, the minigene is a minigene described in the Examples of International Publication No. WO2009/151546 or U.S. Patent Application Publication No. 2011/0086833. In another embodiment, the minigene is the minigene described in Biological Example 1, infra. The human cell can be contacted with a compound of Formula (I) or a form thereof in vitro and/or in vivo, e.g., in a non-human animal or in a human. In a specific embodiment, the human cell is from or in a human. In another specific embodiment, the human cell is from or in a human SMA patient. In another specific embodiment, the human cell is from or in a human SMA patient, wherein SMA is caused by an inactivating mutation or deletion in the SMN1 gene on both chromosomes, resulting in a loss of SMN1 gene function. In another embodiment, the human cell is a human cell from a human SMA patient. In certain embodiments, the human cell is from a cell line, such as GM03813, GM00232, GM09677, and/or GM23240 (available from Coriell Institute). In one embodiment, the compound is a compound of Formula (I) or a form thereof.

›TERMINOLOGY · 10 of 40

In a specific embodiment, provided herein is a method for enhancing the inclusion of exon 7 of SMN2 into mRNA that is transcribed from the SMN2 gene, comprising contacting a human cell with a compound of Formula (I) or a form thereof. In another embodiment, provided herein is a method for enhancing the inclusion of exon 7 of SMN2 into mRNA that is transcribed from the SMN2 gene, comprising contacting a human cell with a compound of Formula (I) or a form thereof that enhances the expression of an SMN2 minigene described herein or in International Publication No. WO2009/151546 or U.S. Patent Application Publication No. 2011/0086833, each of which is incorporated herein by reference in its entirety. In one embodiment, the minigene is a minigene described in the Examples of International Publication No. WO2009/151546 or U.S. Patent Application Publication No. 2011/0086833. In another embodiment, the minigene is the minigene described in Biological Example 1, infra. The human cell can be contacted with a compound of Formula (I) or a form thereof in vitro and/or in vivo, e.g., in a non-human animal or in a human. In a specific embodiment, the human cell is from or in a human. In another specific embodiment, the human cell is from or in a human SMA patient. In another specific embodiment, the human cell is from or in a human SMA patient, wherein SMA is caused by an inactivating mutation or deletion in the SMN1 gene on both chromosomes, resulting in a loss of SMN1 gene function. In another embodiment, the human cell is a human cell from a human SMA patient. In certain embodiments, the human cell is from a cell line, such as GM03813, GM00232, GM09677, and/or GM23240 (available from Coriell Institute). In one embodiment, the compound is a compound of Formula (I) or a form thereof.

In another aspect, provided herein are methods for enhancing the inclusion of exon 7 of SMN1 into RNA transcribed from the SMN1 gene, comprising contacting a human cell with a compound of Formula (I) or a form thereof. In a specific embodiment, provided herein are methods for enhancing the inclusion of exon 7 of SMN1 into RNA transcribed from the SMN1 gene, comprising contacting a human cell with a compound of Formula (I) or a form thereof. In another specific embodiment, provided herein are methods for enhancing the inclusion of exon 7 of SMN1 into RNA transcribed from the SMN1 gene, comprising contacting a human cell with a compound of Formula (I) or a form thereof that modulates the expression of an SMN1 minigene described in International Publication No. WO2009/151546 or U.S. Patent Application Publication No. 2011/0086833, each of which is incorporated herein by reference in its entirety. In one embodiment, the minigene is a minigene described in the Examples of International Publication No. WO2009/151546 or U.S. Patent Application Publication No. 2011/0086833. The human cell can be contacted with a compound of Formula (I) or a form thereof in vitro and/or in vivo, e.g., in a non-human animal or in a human. In a specific embodiment, the human cell is from or in a human. In another specific embodiment, the human cell is from or in a human SMA patient. In one embodiment, the compound is a compound of Formula (I) or a form thereof.

In specific embodiments, provided herein are methods for enhancing the inclusion of exon 7 of SMN1 and SMN2 into RNA transcribed from the SMN1 and SMN2 genes, comprising contacting a human cell with a compound of Formula (I) or a form thereof. The human cell can be contacted with a compound of Formula (I) or a form thereof in vitro and/or in vivo, e.g., in a non-human animal or in a human. In a specific embodiment, the human cell is from or in a human. In another specific embodiment, the human cell is from or in a human SMA patient. In one embodiment, the compound is a compound of Formula (I) or a form thereof.

In another aspect, provided herein is a method for modulating the inclusion of exon 7 of SMN2 into RNA transcribed from the SMN2 gene, comprising administering to a non-human animal model for SMA a compound of Formula (I) or a form thereof. In a specific embodiment, provided herein is a method for modulating the inclusion of exon 7 of SMN2 into RNA transcribed from the SMN2 gene, comprising administering to a non-human animal model for SMA a compound of Formula (I) or a form thereof that modulates the expression of an SMN2 minigene described herein or in International Publication No. WO2009/151546 or U.S. Patent Application Publication No. 2011/0086833, each of which is incorporated herein by reference in its entirety. In one embodiment, the minigene is a minigene described in the Examples of International Publication No. WO2009/151546 or U.S. Patent Application Publication No. 2011/0086833. In another embodiment, the minigene is the minigene described in Biological Example 1, infra. In a specific embodiment, the compound is a compound of Formula (I) or a form thereof.

In a specific embodiment, provided herein is a method for enhancing the inclusion of exon 7 of SMN2 into mRNA that is transcribed from the SMN2 gene, comprising administering to a non-human animal model for SMA a compound of Formula (I) or a form thereof. In another specific embodiment, provided herein is a method for enhancing the inclusion of exon 7 of SMN2 into mRNA that is transcribed from the SMN2 gene, comprising administering to a non-human animal model for SMA a compound of Formula (I) or a form thereof that enhances the expression of an SMN2 minigene described herein or in International Publication No. WO2009/151546 or U.S. Patent Application Publication No. 2011/0086833, each of which is incorporated herein by reference in its entirety. In one embodiment, the minigene is a minigene described in the Examples of International Publication No. WO2009/151546 or U.S. Patent Application Publication No. 2011/0086833. In another embodiment, the minigene is the minigene described in Biological Example 1, infra. In a specific embodiment, the compound is a compound of Formula (I) or a form thereof.

›TERMINOLOGY · 11 of 40

In another aspect, provided herein is a method for enhancing the inclusion of exon 7 of SMN1 into RNA transcribed from the SMN1 gene, comprising administering to a non-human animal model for SMA a compound of Formula (I) or a form thereof. In a specific embodiment, provided herein is a method for enhancing the inclusion of exon 7 of SMN1 into RNA transcribed from the SMN1 gene, comprising administering to a non-human animal model for SMA a compound of Formula (I) or a form thereof that modulates the expression of an SMN1 minigene described herein or in International Publication No. WO2009/151546 or U.S. Patent Application Publication No. 2011/0086833, each of which is incorporated herein by reference in its entirety. In one embodiment, the minigene is a minigene described in the Examples of International Publication No. WO2009/151546 or U.S. Patent Application Publication No. 2011/0086833. In a specific embodiment, the compound is a compound of Formula (I) or a form thereof.

In specific embodiments, provided herein is a method for enhancing the inclusion of exon 7 of SMN1 and SMN2 into RNA transcribed from the SMN1 and SMN2 genes, comprising administering to a non-human animal model for SMA a compound of Formula (I) or a form thereof. In a specific embodiment, the compound is a compound of Formula (I) or a form thereof.

In another aspect, provided herein is a method for increasing the amount of Smn protein, comprising contacting a human cell with a compound of Formula (I) or a form thereof. In a specific embodiment, provided herein is a method for increasing the amount of Smn protein, comprising contacting a human cell with a compound of Formula (I) that enhances the inclusion of exon 7 of SMN2 into mRNA that is transcribed from the SMN2 gene. In another specific embodiment, provided herein is a method for increasing the amount of Smn protein, comprising contacting a human cell with a compound of Formula (I) that enhances the inclusion of exon 7 of SMN1 and/or SMN2 into mRNA that is transcribed from the SMN1 and/or SMN2 gene. The human cell can be contacted with a compound of Formula (I) or a form thereof in vitro and/or in vivo, e.g., in a non-human animal or in a human. In a specific embodiment, the human cell is from or in a human. In another specific embodiment, the human cell is from or in a human SMA patient. In another specific embodiment, the human cell is from or in a human SMA patient, wherein SMA is caused by an inactivating mutation or deletion in the SMN1 gene on both chromosomes, resulting in a loss of SMN1 gene function. In another embodiment, the human cell is a human cell from a human SMA patient. In certain embodiments, the human cell is from a cell line, such as GM03813, GM00232, GM09677, and/or GM23240 (available from Coriell Institute). In one embodiment, the compound is a compound of Formula (I) or a form thereof.

In another aspect, provided herein is a method for increasing the amount of Smn protein, comprising administering to a non-human animal model for SMA a compound of Formula (I) or a form thereof. In a specific embodiment, provided herein is a method for increasing the amount of Smn protein, comprising administering to a non-human animal model for SMA a compound of Formula (I) that enhances the inclusion of exon 7 of SMN2 into mRNA that is transcribed from the SMN2 gene in, e.g., a cell-based or cell-free assay, such as described in the Biological Examples, infra. In another specific embodiment, provided herein is a method for increasing the amount of Smn protein, comprising administering to a non-human animal model for SMA a compound of Formula (I) that enhances the inclusion of exon 7 of SMN1 and/or SMN2 into mRNA that is transcribed from the SMN1 and/or SMN2 gene in, e.g., a cell-based or cell-free assay.

In one embodiment, the compound of Formula (I) enhances the expression of a minigene described herein or in International Publication No. WO2009/151546 or U.S. Patent Application Publication No. 2011/0086833, each of which is incorporated herein by reference in its entirety. In a specific embodiment, the compound of Formula (I) enhances the expression of a minigene described in the Examples of International Publication No. WO2009/151546 or U.S. Patent Application Publication No. 2011/0086833. In another specific embodiment, the compound of Formula (I) enhances the expression of a minigene described in Biological Example 1, infra. In one embodiment, the compound is a compound of Formula (I) or a form thereof.

In one embodiment, provided herein is the use of a compound of Formula (I) or a form thereof for the preparation of a medicament that enhances the inclusion of exon 7 of SMN2 into mRNA that is transcribed from the SMN2 gene. In another embodiment, provided herein is the use of a compound of Formula (I) or a form thereof for the preparation of a medicament that enhances the inclusion of exon 7 of SMN2 into mRNA that is transcribed from the SMN2 gene, thereby increasing expression of Smn protein in a human subject in need thereof. In a particular embodiment, the compound of Formula (I) or a form thereof enhances the inclusion of exon 7 of SMN2 into mRNA that is transcribed from the SMN2 gene in an assay described herein (see, e.g., the Biological Examples, infra). In a specific embodiment, the compound is a compound of Formula (I) or a form thereof.

In one embodiment, provided herein is the use of a compound of Formula (I) or a form thereof for the preparation of a medicament that enhances the inclusion of exon 7 of SMN1 and/or SMN2 into mRNA that is transcribed from the SMN1 and/or SMN2 gene. In another embodiment, provided herein is the use of a compound of Formula (I) or a form thereof for the preparation of a medicament that enhances the inclusion of exon 7 of SMN1 and/or SMN2 into mRNA that is transcribed from the SMN1 and/or SMN2 gene, thereby increasing expression of Smn protein in a human subject in need thereof. In a specific embodiment, the compound is a compound of Formula (I) or a form thereof.

›TERMINOLOGY · 12 of 40

In another aspect, provided herein are methods for enhancing the inclusion of exon 7 of SMN2 into mRNA that is transcribed from the SMN2 gene in a human subject in need thereof, comprising administering to the human subject an effective amount of a compound of Formula (I) or a form thereof. In a specific embodiment, provided herein is a method for enhancing the inclusion of exon 7 of SMN2 into mRNA that is transcribed from the SMN2 gene in a human subject in need thereof, comprising administering to the human subject an effective amount a compound of Formula (I) or a form thereof that enhances the inclusion of exon 7 of SMN2 into mRNA that is transcribed from the SMN2 gene as determined in an assay described herein (see, e.g., the Biological Examples, infra). In specific embodiments, the effective amount of the compound of Formula (I) or a form thereof is administered to the human subject in a pharmaceutical composition comprising a pharmaceutically acceptable carrier, excipient or diluent. In a particular embodiment, the compound of Formula (I) or a form thereof enhances the inclusion of exon 7 of SMN2 into mRNA that is transcribed from the SMN2 gene in an assay described herein (see, e.g., the Biological Examples, infra). In a specific embodiment, the human subject is a human SMA patient. In another specific embodiment, the human subject is a human SMA patient, wherein SMA is caused by an inactivating mutation or deletion in the SMN1 gene on both chromosomes, resulting in a loss of SMN1 gene function. In one embodiment, the compound is a compound of Formula (I) or a form thereof.

In another aspect, provided herein are methods for enhancing the inclusion of exon 7 of SMN1 into mRNA that is transcribed from the SMN1 gene in a human subject in need thereof, comprising administering to the human subject an effective amount of a compound of Formula (I) or a form thereof. In a particular embodiment, the compound of Formula (I) or a form thereof enhances the inclusion of exon 7 of SMN1 into mRNA that is transcribed from the SMN1 gene in an assay described in International Publication No. WO2009/151546 or U.S. Patent Application Publication No. 2011/0086833. In specific embodiments, the effective amount of the compound of Formula (I) or a form thereof is administered to the human subject in a pharmaceutical composition comprising a pharmaceutically acceptable carrier, excipient or diluent. In a specific embodiment, the human subject is a human SMA patient. In one embodiment, the compound is a compound of Formula (I) or a form thereof.

In another aspect, provided herein is a method for enhancing the inclusion of exon 7 of SMN1 and SMN2 into mRNA that is transcribed from the SMN1 and SMN2 genes in a human subject in need thereof, comprising administering to the human subject an effective amount a compound of Formula (I) or a form thereof. In a particular embodiment, the compound of Formula (I) or a form thereof enhances the inclusion of exon 7 of SMN1 into mRNA that is transcribed from the SMN1 gene in an assay(s) described in International Publication No. WO2009/151546 or U.S. Patent Application Publication No. 2011/0086833 (see, e.g., the Examples in those publications), each of which is incorporated herein by reference in its entirety. In specific embodiments, the effective amount of the compound of Formula (I) or a form thereof is administered to the human subject in a pharmaceutical composition comprising a pharmaceutically acceptable carrier, excipient or diluent. In a specific embodiment, the human subject is a human SMA patient. In another specific embodiment, the human subject is a human SMA patient, wherein SMA is caused by an inactivating mutation or deletion in the SMN1 gene on both chromosomes, resulting in a loss of SMN1 gene function. In one embodiment, the compound is a compound of Formula (I) or a form thereof.

In another aspect, provided herein are methods for enhancing the expression of Smn protein in a human subject in need thereof, comprising administering to the human subject an effective amount of a compound of Formula (I) or a form thereof. In a specific embodiment, provided herein is a method for enhancing the expression of Smn protein in a human subject in need thereof, comprising administering to the human subject an effective amount a compound of Formula (I) or a form thereof that enhances the inclusion of exon 7 of SMN2 into mRNA that is transcribed from the SMN2 gene. In another specific embodiment, provided herein is a method for enhancing the expression of Smn protein in a human subject in need thereof, comprising administering to the human subject an effective amount a compound of Formula (I) or a form thereof that enhances the inclusion of exon 7 of SMN1 and/or SMN2 into mRNA that is transcribed from the SMN1 and/or SMN2 gene. In specific embodiments, the effective amount of the compound of Formula (I) or a form thereof is administered to the human subject in a pharmaceutical composition comprising a pharmaceutically acceptable carrier, excipient or diluent. In a particular embodiment, the compound of Formula (I) or a form thereof enhances the inclusion of exon 7 of SMN1 and/or SMN2 into mRNA that is transcribed from the SMN1 and/or SMN2 gene in an assay described herein (see, e.g., the Biological Examples, infra) or in International Publication No. WO2009/151546 or U.S. Patent Application Publication No. 2011/0086833 (see, e.g., the Examples in those publications), each of which is incorporated herein by reference in its entirety.

In a specific embodiment, the human subject is a human SMA patient. In another specific embodiment, the human subject is a human SMA patient, wherein SMA is caused by an inactivating mutation or deletion in the teleomeric copy of the SMN1 gene in both chromosomes, resulting in a loss of SMN1 gene function. In one embodiment, the compound is a compound of Formula (I) or a form thereof.

In another embodiment, provided herein is the use of a compound of Formula (I) or a form thereof for the preparation of a medicament that enhances expression of Smn protein in a human subject in need thereof. In a particular embodiment, the compound of Formula (I) or a form thereof enhances the inclusion of exon 7 of SMN2 into mRNA that is transcribed from the SMN2 gene as determined in an assay described herein (see, e.g., the Biological Examples, infra). In another embodiment, the compound of Formula (I) or a form thereof enhances the inclusion of exon 7 of SMN1 and/or SMN2 into mRNA that is transcribed from the SMN1 and/or SMN2 gene as determined in an assay described herein (see, e.g., the Biological Examples, infra) or in International Publication No. WO2009/151546 or U.S. Patent Application Publication No. 2011/0086833 (see, e.g., the Examples in those publications), each of which is incorporated herein by reference in its entirety. In a specific embodiment, the compound is a compound of Formula (I) or a form thereof.

›TERMINOLOGY · 13 of 40

In another aspect, provided herein are methods for treating spinal muscular atrophy (SMA), comprising administering to a subject an effective amount of a compound of Formula (I) or a form thereof. In a specific embodiment, provided herein is a method for treating SMA in a human subject in need thereof, comprising administering to the subject an effective amount of a compound of Formula (I) or a form thereof. In another specific embodiment, provided herein is a method for treating SMA in a human subject in need thereof, comprising administering to the subject a pharmaceutical composition comprising an effective amount of a compound of Formula (I) or a form thereof, and a pharmaceutically acceptable carrier, excipient or diluent. In one embodiment, the compound is a compound of Formula (I) or a form thereof.

In another embodiment, provided herein is a method for treating SMA in a human subject in need thereof, comprising administering to the subject an effective amount of a compound of Formula (I) or a form thereof that enhances the inclusion of exon 7 of SMN2 into mRNA that is transcribed from the SMN2 gene. In a specific embodiment, provided herein is a method for treating SMA in a human subject in need thereof, comprising administering to the subject a pharmaceutical composition comprising an effective amount of a compound of Formula (I) or a form thereof that enhances the inclusion of exon 7 of SMN2 into mRNA that is transcribed from the SMN2 gene, and a pharmaceutically acceptable carrier, excipient or diluent.

In another specific embodiment, provided herein is a method for treating SMA in a human subject in need thereof, comprising administering to the subject a pharmaceutical composition comprising an effective amount of a compound of Formula (I) or a form thereof that enhances the inclusion of exon 7 of SMN1 and/or SMN2 into mRNA that is transcribed from the SMN1 and/or SMN2 gene, and a pharmaceutically acceptable carrier, excipient or diluent. In a particular embodiment, the compound of Formula (I) or a form thereof enhances the inclusion of exon 7 of SMN2 into mRNA that is transcribed from the SMN2 gene in an assay described herein (see, e.g., the Biological Examples, infra). In another embodiment, the compound of Formula (I) or a form thereof enhances the inclusion of exon 7 of SMN1 and/or SMN2 into mRNA that is transcribed from the SMN1 and/or SMN2 gene as determined in an assay described herein (see, e.g., the Biological Examples, infra) or in International Publication No. WO2009/151546 or U.S. Patent Application Publication No. 2011/0086833 (see, e.g., the Examples in those publications), each of which is incorporated herein by reference in its entirety. In a specific embodiment, the compound is a compound of Formula (I) or a form thereof.

In another embodiment, provided herein is the use of a compound of Formula (I) or a form thereof in the manufacture of a medicament for treating SMA in a human subject in need thereof. In a particular embodiment, the compound of Formula (I) or a form thereof enhances the inclusion of exon 7 of SMN2 into mRNA that is transcribed from the SMN2 gene as determined in an assay described herein (see, e.g., the Biological Examples, infra). In another embodiment, the compound of Formula (I) or a form thereof enhances the inclusion of exon 7 of SMN1 and/or SMN2 into mRNA that is transcribed from the SMN1 and/or SMN2 gene as determined in an assay described herein (see, e.g., the Biological Examples, infra) or in International Publication No. WO2009/151546 or U.S. Patent Application Publication No. 2011/0086833 (see, e.g., the Examples in those publications), each of which is incorporated herein by reference in its entirety. In a specific embodiment, the compound is a compound of Formula (I) or a form thereof.

In an embodiment of a use or method provided herein, compounds of Formula (I) or a form thereof are used in combination with one or more additional agents. A compound(s) of Formula (I) or a form thereof can be administered to a subject or contacted with a cell prior to, concurrently with, or subsequent to administering to the subject or contacting the cell with an additional agent(s). A compound(s) of Formula (I) or a form thereof and an additional agent(s) can be administered to a subject or contacted with a cell in single composition or different compositions. In a specific embodiments, a compound(s) of Formula (I) or a form thereof is used in combination with gene replacement of SMN1 (using, e.g., viral delivery vectors). In another specific embodiments, a compound(s) of Formula (I) or a form thereof are used in combination with cell replacement using differentiated SMN1 +/+ and/or SMN2 +/+ stem cells. In another specific embodiments, a compound(s) of Formula (I) or a form thereof are used in combination with cell replacement using differentiated SMN1 +/+ stem cells. In another specific embodiments, a compound(s) of Formula (I) or a form thereof are used in combination with cell replacement using differentiated SMN2 +/+ stem cells. In another specific embodiment, a compound(s) of Formula (I) or a form thereof are used in combination with aclarubicin. In another specific embodiment, a compound(s) of Formula (I) or a form thereof are used in combination with a transcription activator such as a histone deacetylase (“HDAC”) inhibitor (e.g., butyrates, valproic acid, and hydroxyurea), and mRNA stabilizers (e.g., mRNA decapping inhibitor RG3039 from Repligen).

In one embodiment, provided herein is the use of compounds of Formula (I) or a form thereof in combination with supportive therapy, including respiratory, nutritional or rehabilitation care.

In certain embodiments, treating SMA with a compound of Formula (I) or a form thereof (alone or in combination with an additional agent) has a therapeutic effect and/or beneficial effect. In a specific embodiment, treating SMA with a compound of Formula (I) or a form thereof (alone or in combination with an additional agent) results in one, two or more of the following effects: (i) reduces or ameliorates the severity of SMA; (ii) delays onset of SMA; (iii) inhibits the progression of SMA; (iv) reduces hospitalization of a subject; (v) reduces hospitalization length for a subject; (vi) increases the survival of a subject; (vii) improves the quality of life of a subject; (viii) reduces the number of symptoms associated with SMA; (ix) reduces or ameliorates the severity of a symptom(s) associated with SMA; (x) reduces the duration of a symptom associated with SMA; (xi) prevents the recurrence of a symptom associated with SMA; (xii) inhibits the development or onset of a symptom of SMA; and/or (xiii) inhibits of the progression of a symptom associated with SMA.

›TERMINOLOGY · 14 of 40

Symptoms of SMA include muscle weakness, poor muscle tone, weak cry, weak cough, limpness or a tendency to flop, difficulty sucking or swallowing, difficulty breathing, accumulation of secretions in the lungs or throat, clenched fists with sweaty hand, flickering/vibrating of the tongue, head often tilted to one side, even when lying down, legs that tend to be weaker than the arms, legs frequently assuming a “frog legs” position, feeding difficulties, increased susceptibility to respiratory tract infections, bowel/bladder weakness, lower-than-normal weight, inability to sit without support, failure to walk, failure to crawl, and hypotonia, areflexia, and multiple congenital contractures (arthrogryposis) associated with loss of anterior horn cells.

In a specific embodiment, treating SMA with a compound of Formula (I) or a form thereof (alone or in combination with an additional agent) results in one, two or more of the following effects: (i) a reduction in the loss of muscle strength; (ii) an increase in muscle strength; (iii) a reduction in muscle atrophy; (iv) a reduction in the loss of motor function; (v) an increase in motor neurons; (vii) a reduction in the loss of motor neurons; (viii) protection of SMN deficient motor neurons from degeneration; (ix) an increase in motor function; (x) an increase in pulmonary function; and/or (xi) a reduction in the loss of pulmonary function.

In another embodiment, treating SMA with a compound of Formula (I) or a form thereof (alone or in combination with an additional agent) results in the functional ability or helps retain the functional ability for a human infant or a human toddler to sit up. In another embodiment, treating SMA with a compound of Formula (I) or a form thereof (alone or in combination with an additional agent) results in the functional ability or helps retain the functional ability for a human infant, a human toddler, a human child or a human adult to stand up unaided. In another embodiment, treating SMA with a compound of Formula (I) or a form thereof (alone or in combination with an additional agent) results in the functional ability or helps retain the functional ability for a human infant, a human toddler, a human child or a human adult to walk unaided. In another embodiment, treating SMA with a compound of Formula (I) or a form thereof (alone or in combination with an additional agent) results in the functional ability or helps retain the functional ability for a human infant, a human toddler, a human child or a human adult to run unaided. In another embodiment, treating SMA with a compound of Formula (I) or a form thereof (alone or in combination with an additional agent) results in the functional ability or helps retain the functional ability for a human infant, a human toddler, a human child or a human adult to breathe unaided. In another embodiment, treating SMA with a compound of Formula (I) or a form thereof (alone or in combination with an additional agent) results in the functional ability or helps retain the functional ability for a human infant, a human toddler, a human child or a human adult to turn during sleep unaided. In another embodiment, treating SMA with a compound of Formula (I) or a form thereof (alone or in combination with an additional agent) results in the functional ability or helps retain the functional ability for a human infant, a human toddler, a human child or a human adult to swallow unaided.

In certain embodiments, a primer and/or probe described below in the Biological Examples (e.g., SMN primers such as SEQ ID NO. 1, 7, 8, 11 or 13 and/or SEQ ID NO. 2, 9 or 12, and SMN probes such as a SEQ ID NO. 3 or 10) is used in an assay, such as RT-PCR, RT-qPCR, endpoint RT-PCR, PCR, qPCR, rolling circle amplification, Northern blot or Southern blot, to determine whether a compound of Formula (I) or a form thereof enhances the inclusion of exon 7 of SMN1 and/or SMN2 into mRNA that is transcribed from an SMN1 and/or SMN2 gene. In some embodiments, a primer and/or probe described below in the Biological Examples (e.g., SMN primers such as SEQ ID NO. 1, 7, 8, 11 or 13 and/or SEQ ID NO. 2, 9 or 12, and SMN probes such as a SEQ ID NO. 3 or 10) is used in an assay, such as RT-PCR, RT-qPCR, endpoint RT-PCR, PCR, qPCR, rolling circle amplification, Northern blot or Southern blot, or a pharmaceutical or assay kit as described infra, to monitor patient responses to a compound of Formula (I) or a form thereof.

In one embodiment, a compound of Formula (I):

or a form thereof is used as described herein, wherein:

w 1 and w 5 are independently C—R a or N;

w 2 is C—R b or N;

w 3 , w 4 and w 7 are independently C—R 1 , C—R 2 , C—R a or N;

w 6 is C—R 1 , C—R 2 , C—R c or N;

wherein one of w 3 , w 4 , w 6 and w 7 is C—R 1 and one other of w 3 , w 4 , w 6 and w 7 is C—R 2 , provided that,

when w 3 is C—R 1 , then w 6 is C—R 2 and w 4 and w 7 are independently C—R a or N; or,

when w 3 is C—R 2 , then w 6 is C—R 1 and w 4 and w 7 are independently C—R a or N; or,

when w 4 is C—R 1 , then w 7 is C—R 2 and w 3 is C—R a or N and w 6 is C—R c or N; or,

when w 4 is C—R 2 , then w 7 is C—R 1 and w 3 is C—R a or N and w 6 is C—R c or N; and,

wherein any one, two or three of w 1 , w 2 , w 3 , w 4 , w 5 , w 6 and w 7 may optionally be N;

›TERMINOLOGY · 15 of 40

wherein, each instance of heterocyclyl, C 3-14 cycloalkyl, aryl and heteroaryl is optionally substituted with one, two, three or four R 3 substituents;

R 2 is aryl, aryl-amino, aryl-amino-carbonyl, heterocyclyl, heteroaryl or heteroaryl-amino;

wherein, each instance of aryl, heterocyclyl and heteroaryl is optionally substituted with one, two or three R 6 substituents and optionally, with one additional R 7 substituent;

R a is, in each instance, independently selected from hydrogen, halogen or C 1-8 alkyl;

R b is hydrogen, halogen, C 1-8 alkyl or C 1-8 alkoxy;

R 7 is C 3-14 cycloalkyl, C 3-14 cycloalkyl-oxy, aryl, heterocyclyl or heteroaryl.

An embodiment of the use of the compound of Formula (I) is the use of a compound selected from Formula (II), Formula (III), Formula (IV), Formula (V), Formula (VI), Formula (VII), Formula (VIII), Formula (IX), Formula (X), Formula (XI), Formula (XII), Formula (XIII) or Formula (XIV):

or a form thereof.

In an embodiment of the use of the compound of Formula (I), w 3 is C—R 1 , w 6 is C—R 2 , w 1 , w 4 , w 5 and w 7 are independently C—R a or N and w 2 is C—R b or N.

In another embodiment of the use of the compound of Formula (I), w 3 is C—R 2 , w 6 is C—R 1 , w 1 , w 4 , w 5 and w 7 are independently C—R a or N and w 2 is C—R b or N.

In another embodiment of the use of the compound of Formula (I), w 4 is C—R 1 , w 7 is C—R 2 , w 1 , w 3 and w 5 are independently C—R a or N, w 2 is C—R b or N and w 6 is C—R c or N.

In another embodiment of the use of the compound of Formula (I), w 4 is C—R 2 , w 7 is C—R 1 , w 1 , w 3 and w 5 are independently C—R a or N, w 2 is C—R b or N and w 6 is C—R c or N.

In an embodiment of the use of the compound of Formula (II), w 3 is C—R 1 , w 6 is C—R 2 , w 4 , w 5 and w 7 are independently C—R a or N and w 2 is C—R b or N.

In another embodiment of the use of the compound of Formula (II), w 3 is C—R 2 , w 6 is C—R 1 , w 4 , w 5 and w 7 are independently C—R a or N and w 2 is C—R b or N.

In another embodiment of the use of the compound of Formula (II), w 4 is C—R 1 , w 7 is C—R 2 , w 3 and w 5 are independently C—R a or N, w 2 is C—R b or N and w 6 is C—R c or N.

In another embodiment of the use of the compound of Formula (II), w 4 is C—R 2 , w 7 is C—R 1 , w 3 and w 5 are independently C—R a or N, w 2 is C—R b or N and w 6 is C—R c or N.

In an embodiment of the use of the compound of Formula (III), w 3 is C—R 1 , w 6 is C—R 2 and w 1 , w 4 , w 5 and w 7 are independently C—R a or N.

In another embodiment of the use of the compound of Formula (III), w 3 is C—R 2 , w 6 is C—R 1 and w 1 , w 4 , w 5 and w 7 are independently C—R a or N.

In another embodiment of the use of the compound of Formula (III), w 4 is C—R 1 , w 7 is C—R 2 , w 1 , w 3 and w 5 are independently C—R a or N and w 6 is C—R c or N.

In another embodiment of the use of the compound of Formula (III), w 4 is C—R 2 , w 7 is C—R 1 , w 1 , w 3 and w 5 are independently C—R a or N and w 6 is C—R c or N.

In an embodiment of the use of the compound of Formula (IV), w 4 is C—R 1 , w 7 is C—R 2 , w 1 and w 5 are independently C—R a or N, w 2 is C—R b or N and w 6 is C—R c or N.

In another embodiment of the use of the compound of Formula (IV), w 4 is C—R 2 , w 7 is C—R 1 , w 1 and w 5 are independently C—R a or N, w 2 is C—R b or N and w 6 is C—R c or N.

In an embodiment of the use of the compound of Formula (V), w 3 is C—R 1 , w 6 is C—R 2 , w 1 , w 5 and w 7 are independently C—R a or N and w 2 is C—R b or N.

In another embodiment of the use of the compound of Formula (V), w 3 is C—R 2 , w 6 is C—R 1 , w 1 , w 5 and w 7 are independently C—R a or N and w 2 is C—R b or N.

In an embodiment of the use of the compound of Formula (VI), w 3 is C—R 1 , w 6 is C—R 2 , w 1 , w 4 and w 7 are independently C—R a or N and w 2 is C—R b or N.

In another embodiment of the use of the compound of Formula (VI), w 3 is C—R 2 , w 6 is C—R 1 , w 1 , w 4 and w 7 are independently C—R a or N and w 2 is C—R b or N.

In another embodiment of the use of the compound of Formula (VI), w 4 is C—R 1 , w 7 is C—R 2 , w 1 and w 3 are independently C—R a or N, w 2 is C—R b or N and w 6 is C—R c or N.

›TERMINOLOGY · 16 of 40

In another embodiment of the use of the compound of Formula (VI), w 4 is C—R 2 , w 7 is C—R 1 , w 1 and w 3 are independently C—R a or N, w 2 is C—R b or N and w 6 is C—R c or N.

In another embodiment of the use of the compound of Formula (VII), w 4 is C—R 1 , w 7 is C—R 2 , w 1 , w 3 and w 5 are C—R a or N and w 2 is C—R b or N.

In another embodiment of the use of the compound of Formula (VII), w 4 is C—R 2 , w 7 is C—R 1 , w 1 , w 3 and w 5 are C—R a or N and w 2 is C—R b or N.

In another embodiment of the use of the compound of Formula (VIII), w 3 is C—R 1 , w 6 is C—R 2 , w 1 , w 4 and w 5 are C—R a or N and w 2 is C—R b or N.

In another embodiment of the use of the compound of Formula (VIII), w 3 is C—R 2 , w 6 is C—R 1 , w 1 , w 4 and w 5 are C—R a or N and w 2 is C—R b or N.

In an embodiment of the use of the compound of Formula (IX), w 3 is C—R 1 , w 6 is C—R 2 , w 4 and w 7 are independently C—R a or N and w 2 is C—R b or N.

In another embodiment of the use of the compound of Formula (IX), w 3 is C—R 2 , w 6 is C—R 1 , w 4 and w 7 are independently C—R a or N and w 2 is C—R b or N.

In another embodiment of the use of the compound of Formula (IX), w 4 is C—R 1 , w 7 is C—R 2 , w 2 is C—R b or N, w 3 is C—R a or N and w 6 is C—R c or N.

In another embodiment of the use of the compound of Formula (IX), w 4 is C—R 2 , w 7 is C—R 1 , w 2 is C—R b or N, w 3 is C—R a or N and w 6 is C—R c or N.

In an embodiment of the use of the compound of Formula (X), w 3 is C—R 1 , w 6 is C—R 2 , w 2 is C—R b or N and w 5 and w 7 are independently C—R a or N.

In another embodiment of the use of the compound of Formula (X), w 3 is C—R 2 , w 6 is C—R 1 , w 2 is C—R b or N and w 5 and w 7 are independently C—R a or N.

In an embodiment of the use of the compound of Formula (XI), w 4 is C—R 1 , w 7 is C—R 2 , w 2 is C—R b or N, w 5 is C—R a or N and w 6 is C—R c or N.

In another embodiment of the use of the compound of Formula (XI), w 4 is C—R 2 , w 7 is C—R 1 , w 2 is C—R b or N, w 5 is C—R a or N and w 6 is C—R c or N.

In an embodiment of the use of the compound of Formula (XII), w 3 is C—R 1 , w 6 is C—R 2 and w 4 , w 5 and w 7 are independently C—R a or N.

In another embodiment of the use of the compound of Formula (XII), w 3 is C—R 2 , w 6 is C—R 1 and w 4 , w 5 and w 7 are independently C—R a or N.

In another embodiment of the use of the compound of Formula (XII), w 4 is C—R 1 , w 7 is C—R 2 , w 3 and w 5 are independently C—R a or N and w 6 is C—R c or N.

In another embodiment of the use of the compound of Formula (XII), w 4 is C—R 2 , w 7 is C—R 1 , w 3 and w 5 are independently C—R a or N and w 6 is C—R c or N.

In an embodiment of the use of the compound of Formula (XIII), w 3 is C—R 1 , w 6 is C—R 2 , w 2 is C—R b or N and w 4 and w 5 are independently C—R a or N.

In another embodiment of the use of the compound of Formula (XIII), w 3 is C—R 2 , w 6 is C—R 1 , w 2 is C—R b or N and w 4 and w 5 are independently C—R a or N.

In an embodiment of the use of the compound of Formula (XIV), w 4 is C—R 1 , w 7 is C—R 2 , w 2 is C—R b or N and w 3 and w 5 are independently C—R a or N.

In another embodiment of the use of the compound of Formula (XIV), w 4 is C—R 2 , w 7 is C—R 1 , w 2 is C—R b or N and w 3 and w 5 are independently C—R a or N.

Another embodiment of the use of the compound of Formula (I) is the use of the compound selected from Formula (II), Formula (III), Formula (IX), Formula (XI) or Formula (XII):

or a form thereof.

Another embodiment of the use of the compound of Formula (I) is the use of the compound of Formula (II):

or a form thereof.

Another embodiment of the use of the compound of Formula (I) is the use of the compound of Formula (III):

or a form thereof.

Another embodiment of the use of the compound of Formula (I) is the use of the compound of Formula (IV):

or a form thereof.

Another embodiment of the use of the compound of Formula (I) is the use of the compound of Formula (V):

or a form thereof.

Another embodiment of the use of the compound of Formula (I) is the use of the compound of Formula (VI):

or a form thereof.

Another embodiment of the use of the compound of Formula (I) is the use of the compound of Formula (VII):

or a form thereof.

Another embodiment of the use of the compound of Formula (I) is the use of the compound of Formula (VIII):

or a form thereof.

Another embodiment of the use of the compound of Formula (I) is the use of the compound of Formula (IX):

or a form thereof.

Another embodiment of the use of the compound of Formula (I) is the use of the compound of Formula (X):

or a form thereof.

Another embodiment of the use of the compound of Formula (I) is the use of the compound of Formula (XI):

or a form thereof.

Another embodiment of the compound of Formula (I) is the use of the compound of Formula (XII):

or a form thereof.

Another embodiment of the use of the compound of Formula (I) is the use of the compound of Formula (XIII):

or a form thereof.

Another embodiment of the use of the compound of Formula (I) is the use of the compound of Formula (XIV):

or a form thereof.

An embodiment of the use of the compound of Formula (I), Formula (II), Formula (III), Formula (IV), Formula (V), Formula (VI), Formula (VII), Formula (VIII), Formula (IX), Formula (X), Formula (XI), Formula (XII), Formula (XIII) or Formula (XIV) is the use of a compound selected from Formula (Ia), Formula (IIa), Formula (IIIa), Formula (IVa), Formula (Va), Formula (VIa), Formula (VIIa), Formula (VIIIa), Formula (IXa), Formula (Xa), Formula (XIa), Formula (XIIa), Formula (XIIIa) or Formula (XIVa), respectively:

or a form thereof.

In an embodiment of the use of the compound of Formula (Ia), one of w 3 , w 4 , w 6 and w 7 is C—R 1 and one other of w 3 , w 4 , w 6 and w 7 is C—R 2 , provided that,

when w 3 is C—R 1 , then w 6 is C—R 2 and w 4 and w 7 are independently C—R a or N; or,

when w 3 is C—R 2 , then w 6 is C—R 1 and w 4 and w 7 are independently C—R a or N; or,

when w 4 is C—R 1 , then w 7 is C—R 2 and w 3 is C—R a or N and w 6 is C—R c or N; or,

›TERMINOLOGY · 17 of 40

when w 4 is C—R 2 , then w 7 is C—R 1 and w 3 is C—R a or N and w 6 is C—R c or N.

In an embodiment of the use of the compound of Formula (IIa), one of w 3 , w 4 , w 6 and

w 7 is C—R 1 and one other of w 3 , w 4 , w 6 and w 7 is C—R 2 , provided that,

when w 3 is C—R 1 , then w 6 is C—R 2 and w 4 and w 7 are independently C—R a or N; or,

when w 3 is C—R 2 , then w 6 is C—R 1 and w 4 and w 7 are independently C—R a or N; or,

when w 4 is C—R 1 , then w 7 is C—R 2 and w 3 is C—R a or N and w 6 is C—R c or N; or,

when w 4 is C—R 2 , then w 7 is C—R 1 and w 3 is C—R a or N and w 6 is C—R c or N.

In an embodiment of the use of the compound of Formula (IIIa), one of w 3 , w 4 , w 6 and w 7 is C—R 1 and one other of w 3 , w 4 , w 6 and w 7 is C—R 2 , provided that,

when w 3 is C—R 1 , then w 6 is C—R 2 and w 4 and w 7 are independently C—R a or N; or,

when w 3 is C—R 2 , then w 6 is C—R 1 and w 4 and w 7 are independently C—R a or N; or,

when w 4 is C—R 1 , then w 7 is C—R 2 and w 3 is C—R a or N and w 6 is C—R c or N; or,

when w 4 is C—R 2 , then w 7 is C—R 1 and w 3 is C—R a or N and w 6 is C—R c or N.

In an embodiment of the use of the compound of Formula (IVa), one of w 4 and w 7 is C—R 1 and the other is C—R 2 , provided that, when w 4 is C—R 1 , then w 7 is C—R 2 ; or, when w 4 is C—R 2 , then w 7 is C—R 1 .

In an embodiment of the use of the compound of Formula (Va), one of w 3 and w 6 is C—R 1 and the other is C—R 2 , provided that, when w 3 is C—R 1 , then w 6 is C—R 2 ; or, when w 3 is C—R 2 , then w 6 is C—R 1 .

In an embodiment of the use of the compound of Formula (VIa), one of w 3 , w 4 , w 6 and w 7 is C—R 1 and one other of w 3 , w 4 , w 6 and w 7 is C—R 2 , provided that,

when w 3 is C—R 1 , then w 6 is C—R 2 and w 4 and w 7 are independently C—R a or N; or,

when w 3 is C—R 2 , then w 6 is C—R 1 and w 4 and w 7 are independently C—R a or N; or,

when w 4 is C—R 1 , then w 7 is C—R 2 and w 3 is C—R a or N and w 6 is C—R c or N; or,

when w 4 is C—R 2 , then w 7 is C—R 1 and w 3 is C—R a or N and w 6 is C—R c or N.

In an embodiment of the use of the compound of Formula (VIIa), one of w 4 and w 7 is C—R 1 and the other is C—R 2 , provided that, when w 4 is C—R 1 , then w 7 is C—R 2 ; or, when w 4 is C—R 2 , then w 7 is C—R 1 .

In an embodiment of the use of the compound of Formula (VIIIa), one of w 3 and w 6 is C—R 1 and the other is C—R 2 , provided that, when w 3 is C—R 1 , then w 6 is C—R 2 ; or, when w 3 is C—R 2 , then w 6 is C—R 1 .

In an embodiment of the use of the compound of Formula (IXa), one of w 3 , w 4 , w 6 and w 7 is C—R 1 and one other of w 3 , w 4 , w 6 and w 7 is C—R 2 , provided that,

when w 3 is C—R 1 , then w 6 is C—R 2 and w 4 and w 7 are independently C—R a or N; or,

when w 3 is C—R 2 , then w 6 is C—R 1 and w 4 and w 7 are independently C—R a or N; or,

when w 4 is C—R 1 , then w 7 is C—R 2 and w 3 is C—R a or N and w 6 is C—R c or N; or,

when w 4 is C—R 2 , then w 7 is C—R 1 and w 3 is C—R a or N and w 6 is C—R c or N.

In an embodiment of the use of the compound of Formula (Xa), one of w 3 and w 6 is C—R 1 and the other is C—R 2 , provided that, when w 3 is C—R 1 , then w 6 is C—R 2 ; or, when w 3 is C—R 2 , then w 6 is C—R 1 .

In an embodiment of the use of the compound of Formula (XIa), one of w 4 and w 7 is C—R 1 and the other is C—R 2 , provided that, when w 4 is C—R 1 , then w 7 is C—R 2 ; or, when w 4 is C—R 2 , then w 7 is C—R 1 .

In an embodiment of the use of the compound of Formula (XIIa), one of w 3 , w 4 , w 6 and w 7 is C—R 1 and one other of w 3 , w 4 , w 6 and w 7 is C—R 2 , provided that,

when w 3 is C—R 1 , then w 6 is C—R 2 and w 4 and w 7 are independently C—R a or N; or,

when w 3 is C—R 2 , then w 6 is C—R 1 and w 4 and w 7 are independently C—R a or N; or,

when w 4 is C—R 1 , then w 7 is C—R 2 and w 3 is C—R a or N and w 6 is C—R c or N; or,

when w 4 is C—R 2 , then w 7 is C—R 1 and w 3 is C—R a or N and w 6 is C—R c or N.

In an embodiment of the use of the compound of Formula (XIIIa), one of w 3 and w 6 is C—R 1 and the other is C—R 2 , provided that, when w 3 is C—R 1 , then w 6 is C—R 2 ; or, when w 3 is C—R 2 , then w 6 is C—R 1 .

In an embodiment of the use of the compound of Formula (XIVa), one of w 4 and w 7 is C—R 1 and the other is C—R 2 , provided that, when w 4 is C—R 1 , then w 7 is C—R 2 ; or, when w 4 is C—R 2 , then w 7 is C—R 1 .

An embodiment of the use of the compound of Formula (I), Formula (II), Formula (III), Formula (IX), Formula (XI) or Formula (XII) is the use of the compound selected from Formula (Ia), Formula (IIa), Formula (IIIa), Formula (IXa), Formula (XIa) or Formula (XIIa), respectively:

or a form thereof.

Another embodiment of the use of the compound of Formula (I) is the use of the compound of Formula (Ia):

or a form thereof.

Another embodiment of the use of the compound of Formula (II) is the use of the compound of Formula (IIa):

or a form thereof.

Another embodiment of the use of the compound of Formula (III) is the use of the compound of Formula (IIIa):

or a form thereof.

Another embodiment of the use of the compound of Formula (IV) is the use of the compound of Formula (IVa):

or a form thereof.

Another embodiment of the use of the compound of Formula (V) is the use of the compound of Formula (Va):

or a form thereof.

Another embodiment of the use of the compound of Formula (VI) is the use of the compound of Formula (VIa):

or a form thereof.

Another embodiment of the use of the compound of Formula (VII) is the use of the compound of Formula (VIIa):

or a form thereof.

Another embodiment of the use of the compound of Formula (VIII) is the use of the compound of Formula (VIIIa):

or a form thereof.

Another embodiment of the use of the compound of Formula (IX) is the use of the compound of Formula (IXa):

or a form thereof.

Another embodiment of the use of the compound of Formula (X) is the use of the compound of Formula (Xa):

or a form thereof.

Another embodiment of the use of the compound of Formula (XI) is the use of the compound of Formula (XIa):

or a form thereof.

›TERMINOLOGY · 18 of 40

Another embodiment of the use of the compound of Formula (XII) is the use of the compound of Formula (XIIa):

or a form thereof.

Another embodiment of the use of the compound of Formula (XIII) is the use of the compound of Formula (XIIIa):

or a form thereof.

Another embodiment of the use of the compound of Formula (XIV) is the use of the compound of Formula (XIVa):

or a form thereof.

An embodiment of the use of the compound of Formula (Ia) is the use of a compound of Formula (Ia1), Formula (Ia2), Formula (Ia3) or Formula (Ia4):

or a form thereof.

An embodiment of the use of the compound of Formula (IIa) is the use of a compound of Formula (IIa1), Formula (IIa2), Formula (IIa3) or Formula (IIa4):

or a form thereof.

An embodiment of the use of the compound of Formula (IIIa) is the use of a compound of Formula (IIIa1), Formula (IIIa2), Formula (IIIa3) or Formula (IIIa4):

or a form thereof.

An embodiment of the use of the compound of Formula (IVa) is the use of a compound of Formula (IVa1) or Formula (IVa2):

or a form thereof.

An embodiment of the use of the compound of Formula (Va) is the use of a compound of Formula (Va1) or Formula (Va2):

or a form thereof.

An embodiment of the use of the compound of Formula (VIa) is the use of a compound of Formula (VIa1), Formula (VIa2), Formula (VIa3) or Formula (VIa2):

or a form thereof.

An embodiment of the use of the compound of Formula (VIIa) is the use of a compound of Formula (VIIa1) or Formula (VIIa2):

or a form thereof.

An embodiment of the use of the compound of Formula (VIIIa) is the use of a compound of Formula (VIIIa1) or Formula (VIIIa2):

or a form thereof.

An embodiment of the use of the compound of Formula (IXa) is the use of a compound of Formula (IXa1), Formula (IXa2), Formula (IXa3) or Formula (IXa4):

or a form thereof.

An embodiment of the use of the compound of Formula (Xa) is the use of a compound of Formula (Xa1) or Formula (Xa2):

or a form thereof.

An embodiment of the use of the compound of Formula (XIa) is the use of a compound of Formula (XIa1) or Formula (XIa2):

or a form thereof.

An embodiment of the use of the compound of Formula (XIIa) is the use of a compound of Formula (XIIa1), Formula (XIIa2), Formula (XIIa3) or Formula (XIIa4):

or a form thereof.

An embodiment of the use of the compound of Formula (XIIIa) is the use of a compound of Formula (XIIIa1) or Formula (XIIIa2):

or a form thereof.

An embodiment of the use of the compound of Formula (XIVa) is the use of a compound of Formula (XIVa1) or Formula (XIVa2):

or a form thereof.

An embodiment of the use of the compound of Formula (Ia) is the use of the compound of Formula (Ia1):

or a form thereof.

An embodiment of the use of the compound of Formula (Ia) is the use of the compound of Formula (Ia2):

or a form thereof.

An embodiment of the use of the compound of Formula (Ia) is the use of the compound of Formula (Ia3):

or a form thereof.

An embodiment of the use of the compound of Formula (Ia) is the use of the compound of Formula (Ia4):

or a form thereof.

An embodiment of the use of the compound of Formula (IIa) is the use of the compound of Formula (IIa1):

or a form thereof.

An embodiment of the use of the compound of Formula (IIa) is the use of the compound of Formula (IIa2):

or a form thereof.

An embodiment of the use of the compound of Formula (IIa) is the use of the compound of Formula (IIa3):

or a form thereof.

An embodiment of the use of the compound of Formula (IIa) is the use of the compound of Formula (IIa4):

or a form thereof.

An embodiment of the use of the compound of Formula (IIIa) is the use of the compound of Formula (IIIa1):

or a form thereof.

An embodiment of the use of the compound of Formula (IIIa) is the use of the compound of Formula (IIIa2):

or a form thereof.

An embodiment of the use of the compound of Formula (IIIa) is the use of the compound of Formula (IIIa3):

or a form thereof.

An embodiment of the use of the compound of Formula (IIIa) is the use of the compound of Formula (IIIa4):

or a form thereof.

An embodiment of the use of the compound of Formula (IVa) is the use of the compound of Formula (IVa1):

or a form thereof.

An embodiment of the use of the compound of Formula (IVa) is the use of the compound of Formula (IVa2):

or a form thereof.

An embodiment of the use of the compound of Formula (Va) is the use of the compound of Formula (Va1):

or a form thereof.

An embodiment of the use of the compound of Formula (Va) is the use of the compound of Formula (Va2):

or a form thereof.

An embodiment of the use of the compound of Formula (VIa) is the use of the compound of Formula (VIa1):

or a form thereof.

An embodiment of the use of the compound of Formula (VIa) is the use of the compound of Formula (VIa2):

or a form thereof.

An embodiment of the use of the compound of Formula (VIa) is the use of the compound of Formula (VIa3):

or a form thereof.

An embodiment of the use of the compound of Formula (VIa) is the use of the compound of Formula (VIa4):

or a form thereof.

An embodiment of the use of the compound of Formula (VIIa) is the use of the compound of Formula (VIIa1):

or a form thereof.

An embodiment of the use of the compound of Formula (VIIa) is the use of the compound of Formula (VIIa2):

or a form thereof.

An embodiment of the use of the compound of Formula (VIIIa) is the use of the compound of Formula (VIIIa1):

or a form thereof.

An embodiment of the use of the compound of Formula (VIIIa) is the use of the compound of Formula (VIIIa2):

or a form thereof.

An embodiment of the use of the compound of Formula (IXa) is the use of the compound of Formula (IXa1):

or a form thereof.

An embodiment of the use of the compound of Formula (IXa) is the use of the compound of Formula (IXa2):

or a form thereof.

An embodiment of the use of the compound of Formula (IXa) is the use of the compound of Formula (IXa3):

or a form thereof.

An embodiment of the use of the compound of Formula (IXa) is the use of the compound of Formula (IXa4):

or a form thereof.

An embodiment of the use of the compound of Formula (Xa) is the use of the compound of Formula (Xa1):

›TERMINOLOGY · 19 of 40

or a form thereof.

An embodiment of the use of the compound of Formula (Xa) is the use of the compound of Formula (Xa2):

or a form thereof.

An embodiment of the use of the compound of Formula (XIa) is the use of the compound of Formula (XIa1):

or a form thereof.

An embodiment of the use of the compound of Formula (XIa) is the use of the compound of Formula (XIa2):

or a form thereof.

An embodiment of the use of the compound of Formula (XIIa) is the use of the compound of Formula (XIIa1):

or a form thereof.

An embodiment of the use of the compound of Formula (XIIa) is the use of the compound of Formula (XIIa2):

or a form thereof.

An embodiment of the use of the compound of Formula (XIIa) is the use of the compound of Formula (XIIa3):

or a form thereof.

An embodiment of the use of the compound of Formula (XIIa) is the use of the compound of Formula (XIIa4):

or a form thereof.

An embodiment of the use of the compound of Formula (XIIIa) is the use of the compound of Formula (XIIIa1):

or a form thereof.

An embodiment of the use of the compound of Formula (XIIIa) is the use of the compound of Formula (XIIIa2):

or a form thereof.

An embodiment of the use of the compound of Formula (XIVa) is the use of the compound of Formula (XIVa1):

or a form thereof.

An embodiment of the use of the compound of Formula (XIVa) is the use of the compound of Formula (XIVa2):

or a form thereof.

Patient Population

In some embodiments, a compound of Formula (I) or a form thereof, or a pharmaceutical composition thereof is administered to a subject suffering from SMA. In other embodiments, a compound of Formula (I) or a form thereof, is administered to a subject predisposed or susceptible to SMA. In a specific embodiment, a compound of Formula (I) or a form thereof, or a pharmaceutical composition thereof is administered to a human subject having SMA, wherein SMA is caused by an inactivating mutation or deletion in the SMN1 gene on both chromosomes, resulting in a loss of SMN1 gene function. In certain embodiments, the human subject is genotyped prior to administration of a compound of Formula (I) or a form thereof, or a pharmaceutical composition thereof to determine whether the subject has an inactivating mutation or deletion in the teleomeric copy of the SMN1 gene in both chromosomes, which results in a loss of SMN1 gene function. In some embodiments, a compound of Formula (I) or a form thereof, or pharmaceutical composition thereof is administered to a subject with Type 0 SMA. In some embodiments, a compound of Formula (I) or a form thereof, or a pharmaceutical composition thereof is administered to a subject with Type 1 SMA. In other embodiments, a compound of Formula (I) or a form thereof, or a pharmaceutical composition thereof is administered to a subject with Type 2 SMA. In other embodiments, a compound of Formula (I) or a form thereof, or a pharmaceutical composition thereof is administered to a subject with Type 3 SMA. In some embodiments, a compound of Formula (I) or a form thereof, or a pharmaceutical composition thereof is administered to a subject with Type 4 SMA. In certain embodiments, the human subject is an SMA patient.

In certain embodiments, a compound of Formula (I) or a form thereof, or a pharmaceutical composition thereof is administered to a subject that will or might benefit from enhanced inclusion of exon 7 of SMN1 and/or SMN2 into mRNA that is transcribed from the SMN1 and/or SMN2 gene. In specific embodiments, a compound of Formula (I) or a form thereof, or a pharmaceutical composition thereof is administered to a subject that will or may benefit from enhanced Smn protein expression.

In certain embodiments, a compound of Formula (I) or a form thereof, or a pharmaceutical composition thereof is administered to a human that has an age in a range of from about 0 months to about 6 months old, from about 6 to about 12 months old, from about 6 to about 18 months old, from about 18 to about 36 months old, from about 1 to about 5 years old, from about 5 to about 10 years old, from about 10 to about 15 years old, from about 15 to about 20 years old, from about 20 to about 25 years old, from about 25 to about 30 years old, from about 30 to about 35 years old, from about 35 to about 40 years old, from about 40 to about 45 years old, from about 45 to about 50 years old, from about 50 to about 55 years old, from about 55 to about 60 years old, from about 60 to about 65 years old, from about 65 to about 70 years old, from about 70 to about 75 years old, from about 75 to about 80 years old, from about 80 to about 85 years old, from about 85 to about 90 years old, from about 90 to about 95 years old or from about 95 to about 100 years old.

In some embodiments, a compound of Formula (I) or a form thereof, or a pharmaceutical composition thereof is administered to a human infant. In other embodiments, a compound of Formula (I) or a form thereof, or a pharmaceutical composition thereof is administered to a human toddler. In other embodiments, a compound of Formula (I) or a form thereof, or a pharmaceutical composition thereof is administered to a human child. In other embodiments, a compound of Formula (I) or a form thereof, or a pharmaceutical composition thereof is administered to a human adult. In yet other embodiments, a compound of Formula (I) or a form thereof, or a pharmaceutical composition thereof is administered to an elderly human.

In some embodiments, a compound of Formula (I) or a form thereof, or a pharmaceutical composition thereof, is administered to a patient to prevent the onset of SMA in a patient at risk of developing SMA. In other embodiments, an effective amount of a compound of Formula (I) or a form thereof, or a pharmaceutical composition thereof, is administered to a patient to prevent the onset of SMA in a patient at risk of developing SMA. In other embodiments, a prophylactically effective amount of a compound of Formula (I) or a form thereof, or a pharmaceutical composition thereof, is administered to a patient to prevent the onset of SMA in a patient at risk of developing SMA. In other embodiments, a therapeutically effective amount of a compound of Formula (I) or a form thereof, or a pharmaceutical composition thereof, is administered to a patient to prevent the onset of SMA in a patient at risk of developing SMA.

›TERMINOLOGY · 20 of 40

In some embodiments, a compound of Formula (I) or a form thereof, or a pharmaceutical composition thereof, is administered to an SMA patient to treat or ameliorate SMA. In other embodiments, an effective amount of a compound of Formula (I) or a form thereof, or a pharmaceutical composition thereof, is administered to an SMA patient to treat or ameliorate SMA. In other embodiments, a prophylactically effective amount of a compound of Formula (I) or a form thereof, or a pharmaceutical composition thereof, is administered to an SMA patient to prevent advancement of SMA. In other embodiments, a therapeutically effective amount of a compound of Formula (I) or a form thereof, or a pharmaceutical composition thereof, is administered to an SMA patient to treat or ameliorate SMA.

In some embodiments, a compound of Formula (I) or a form thereof, or a medicament thereof is administered to a subject suffering from SMA. In other embodiments, a compound of Formula (I) or a form thereof, is administered to a subject predisposed or susceptible to SMA. In a specific embodiment, a compound of Formula (I) or a form thereof, or a medicament thereof is administered to a human subject having SMA, wherein SMA is caused by an inactivating mutation or deletion in the SMN1 gene on both chromosomes, resulting in a loss of SMN1 gene function. In certain embodiments, the human subject is genotyped prior to administration of a compound of Formula (I) or a form thereof, or a medicament thereof to determine whether the subject has an inactivating mutation or deletion in the teleomeric copy of the SMN1 gene in both chromosomes, which results in a loss of SMN1 gene function. In some embodiments, a compound of Formula (I) or a form thereof, or medicament thereof is administered to a subject with Type 0 SMA. In some embodiments, a compound of Formula (I) or a form thereof, or a medicament thereof is administered to a subject with Type 1 SMA. In other embodiments, a compound of Formula (I) or a form thereof, or a medicament thereof is administered to a subject with Type 2 SMA. In other embodiments, a compound of Formula (I) or a form thereof, or a medicament thereof is administered to a subject with Type 3 SMA. In some embodiments, a compound of Formula (I) or a form thereof, or a medicament thereof is administered to a subject with Type 4 SMA. In certain embodiments, the human subject is an SMA patient.

In certain embodiments, a compound of Formula (I) or a form thereof, or a medicament thereof is administered to a subject that will or might benefit from enhanced inclusion of exon 7 of SMN1 and/or SMN2 into mRNA that is transcribed from the SMN1 and/or SMN2 gene. In specific embodiments, a compound of Formula (I) or a form thereof, or a medicament thereof is administered to a subject that will or may benefit from enhanced Smn protein expression.

In certain embodiments, a compound of Formula (I) or a form thereof, or a medicament thereof is administered to a human that has an age in a range of from about 0 months to about 6 months old, from about 6 to about 12 months old, from about 6 to about 18 months old, from about 18 to about 36 months old, from about 1 to about 5 years old, from about 5 to about 10 years old, from about 10 to about 15 years old, from about 15 to about 20 years old, from about 20 to about 25 years old, from about 25 to about 30 years old, from about 30 to about 35 years old, from about 35 to about 40 years old, from about 40 to about 45 years old, from about 45 to about 50 years old, from about 50 to about 55 years old, from about 55 to about 60 years old, from about 60 to about 65 years old, from about 65 to about 70 years old, from about 70 to about 75 years old, from about 75 to about 80 years old, from about 80 to about 85 years old, from about 85 to about 90 years old, from about 90 to about 95 years old or from about 95 to about 100 years old.

In some embodiments, a compound of Formula (I) or a form thereof, or a medicament thereof is administered to a human infant. In other embodiments, a compound of Formula (I) or a form thereof, or a medicament thereof is administered to a human toddler. In other embodiments, a compound of Formula (I) or a form thereof, or a medicament thereof is administered to a human child. In other embodiments, a compound of Formula (I) or a form thereof, or a medicament thereof is administered to a human adult. In yet other embodiments, a compound of Formula (I) or a form thereof, or a medicament thereof is administered to an elderly human.

In some embodiments, a compound of Formula (I) or a form thereof, or a medicament thereof is administered to a patient to prevent the onset of SMA in a patient at risk of developing SMA. In other embodiments, an effective amount of a compound of Formula (I) or a form thereof, or a medicament thereof, is administered to a patient to prevent the onset of SMA in a patient at risk of developing SMA. In other embodiments, a prophylactically effective amount of a compound of Formula (I) or a form thereof, or a medicament thereof, is administered to a patient to prevent the onset of SMA in a patient at risk of developing SMA. In other embodiments, a therapeutically effective amount of a compound of Formula (I) or a form thereof, or a medicament thereof, is administered to a patient to prevent the onset of SMA in a patient at risk of developing SMA.

In some embodiments, a compound of Formula (I) or a form thereof, or a medicament thereof, is administered to an SMA patient to treat or ameliorate SMA. In other embodiments, an effective amount of a compound of Formula (I) or a form thereof, or a medicament thereof, is administered to an SMA patient to treat or ameliorate SMA. In other embodiments, a prophylactically effective amount of a compound of Formula (I) or a form thereof, or a medicament thereof, is administered to an SMA patient to prevent advancement of SMA. In other embodiments, a therapeutically effective amount of a compound of Formula (I) or a form thereof, or a medicament thereof, is administered to an SMA patient to treat or ameliorate SMA.

›TERMINOLOGY · 21 of 40

Mode of Administration

When administered to a patient, a compound of Formula (I) or a form thereof is preferably administered as a component of a composition that optionally comprises a pharmaceutically acceptable carrier, excipient or diluent. The composition can be administered orally, or by any other convenient route, for example, by infusion or bolus injection, by absorption through epithelial or mucocutaneous linings (e.g., oral mucosa, rectal, and intestinal mucosa) and may be administered together with another biologically active agent. Administration can be systemic or local. Various delivery systems are known, e.g., encapsulation in liposomes, microparticles, microcapsules, capsules, and can be used to administer the compound.

Methods of administration include but are not limited to parenteral, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, oral, sublingual, intranasal, intracerebral, intravaginal, transdermal, rectally, by inhalation, or topically, particularly to the ears, nose, eyes, or skin. The mode of administration is left to the discretion of the practitioner. In most instances, administration will result in the release of a compound into the bloodstream. In a specific embodiment, a compound is administered orally.

Dosage and Dosage Forms

The amount of a compound of Formula (I) or a form thereof that will be effective in the treatment of SMA depend, e.g., on the route of administration, the type of SMA, the general health of the subject, ethnicity, age, weight, and gender of the subject, diet, time, and the severity of SMA, and should be decided according to the judgment of the practitioner and each patient's or subject's circumstances.

In specific embodiments, an “effective amount,” “prophylactically effective amount” or “therapeutically effective amount” in the context of the administration of a compound of Formula (I) or a form thereof, or composition or medicament thereof refers to an amount of a compound of Formula (I) which has a therapeutic effect and/or beneficial effect. In certain specific embodiments, an “effective amount,” “prophylactically effective amount” or “therapeutically effective amount” in the context of the administration of a compound of Formula (I) or a form thereof, or composition or medicament thereof results in one, two or more of the following effects: (i) reduces or ameliorates the severity of SMA; (ii) delays onset of SMA; (iii) inhibits the progression of SMA; (iv) reduces hospitalization of a subject; (v) reduces hospitalization length for a subject; (vi) increases the survival of a subject; (vii) improves the quality of life of a subject; (viii) reduces the number of symptoms associated with SMA; (ix) reduces or ameliorates the severity of a symptom(s) associated with SMA; (x) reduces the duration of a symptom associated with SMA; (xi) prevents the recurrence of a symptom associated with SMA; (xii) inhibits the development or onset of a symptom of SMA; and/or (xiii) inhibits of the progression of a symptom associated with SMA. In certain embodiments, an effective amount of a compound of Formula (I) or a form thereof is an amount effective to enhance inclusion of exon 7 of SMN2 into SMN2 mRNA that is transcribed from the SMN2 gene and increases the levels of Smn protein produced from the SMN2 gene and thus producing a desired beneficial effect in a subject in need thereof. In some instances, the desired effect can be determined by analyzing or quantifying: (1) the inclusion of exon 7 of SMN2 into mRNA that is transcribed from the SMN2 gene; or (2) the levels of Smn protein produced from the SMN2 gene. Non-limiting examples of effective amounts of a compound of Formula (I) or a form thereof are described herein.

For example, the effective amount may be the amount required to treat SMA in a human subject in need thereof, or the amount required to enhance inclusion of exon 7 of SMN2 into mRNA that is transcribed from the SMN2 gene in a human subject in need thereof, or the amount required to increase levels of Smn protein produced from the SMN2 gene in a human subject in need thereof. In a specific embodiment, the human subject is an SMA patient.

In general, the effective amount will be in a range of from about 0.001 mg/kg/day to about 500 mg/kg/day for a patient or subject having a weight in a range of between about 1 kg to about 200 kg. The typical adult subject is expected to have a median weight in a range of between about 70 and about 100 kg.

Within the scope of the present description, the “effective amount” of a compound of Formula (I) or a form thereof for use in the manufacture of a medicament, the preparation of a pharmaceutical kit or in a method for treating SMA in a human subject in need thereof, is intended to include an amount in a range of from about 0.001 mg to about 35,000 mg. In a specific embodiment, the human subject is an SMA patient.

The compositions described herein are formulated for administration to the subject via any drug delivery route known in the art. Nonlimiting examples include oral, ocular, rectal, buccal, topical, nasal, ophthalmic, subcutaneous, intramuscular, intraveneous (bolus and infusion), intracerebral, transdermal, and pulmonary routes of administration.

Pharmaceutical Compositions

Embodiments described herein include the use of a compound of Formula (I) or a form thereof in a pharmaceutical composition. In a specific embodiment, described herein is the use of a compound of Formula (I) or a form thereof in a pharmaceutical composition for treating SMA in a human subject in need thereof comprising administering an effective amount of a compound of Formula (I) or a form thereof in admixture with a pharmaceutically acceptable excipient. In a specific embodiment, the human subject is an SMA patient.

A compound of Formula (I) or a form thereof may optionally be in the form of a composition comprising the compound or a form thereof and an optional carrier, excipient or diluent. Other embodiments provided herein include pharmaceutical compositions comprising an effective amount of a compound of Formula (I) or a form thereof and a pharmaceutically acceptable carrier, excipient, or diluent. In a specific embodiment, the pharmaceutical compositions are suitable for veterinary and/or human administration. The pharmaceutical compositions provided herein can be in any form that allows for the composition to be administered to a subject.

›TERMINOLOGY · 22 of 40

In a specific embodiment and in this context, the term “pharmaceutically acceptable carrier, excipient or diluent” means a carrier, excipient or diluent approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans. The term “carrier” refers to a diluent, adjuvant (e.g., Freund's adjuvant (complete and incomplete)), excipient, or vehicle with which a therapeutic agent is administered. Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water is a specific carrier for intravenously administered pharmaceutical compositions. Saline solutions and aqueous dextrose and glycerol solutions can also be employed as liquid carriers, particularly for injectable solutions.

Typical compositions and dosage forms comprise one or more excipients. Suitable excipients are well-known to those skilled in the art of pharmacy, and non limiting examples of suitable excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol and the like. Whether a particular excipient is suitable for incorporation into a pharmaceutical composition or dosage form depends on a variety of factors well known in the art including, but not limited to, the way in which the dosage form will be administered to a patient and the specific active ingredients in the dosage form. Further provided herein are anhydrous pharmaceutical compositions and dosage forms comprising one or more compounds of Formula (I) or a form thereof as described herein. The compositions and single unit dosage forms can take the form of solutions or syrups (optionally with a flavoring agent), suspensions (optionally with a flavoring agent), emulsions, tablets (e.g., chewable tablets), pills, capsules, granules, powder (optionally for reconstitution), taste-masked or sustained-release formulations and the like.

Pharmaceutical compositions provided herein that are suitable for oral administration can be presented as discrete dosage forms, such as, but are not limited to, tablets, caplets, capsules, granules, powder, and liquids. Such dosage forms contain predetermined amounts of active ingredients, and may be prepared by methods of pharmacy well known to those skilled in the art.

Examples of excipients that can be used in oral dosage forms provided herein include, but are not limited to, binders, fillers, disintegrants, and lubricants.

Biomarkers

In certain embodiments, the amount of mRNA that is transcribed from the SMN1 gene and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 is used as a biomarker for SMA. In certain embodiments, the amount of mRNA that is transcribed from the SMN1 gene and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2 is used as a biomarker for SMA. In other embodiments, the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 is used as a biomarker for an SMA patient being treated with a compound, such as disclosed herein. In other embodiments, the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2 is used as a biomarker for an SMA patient being treated with a compound, such as disclosed herein. In some embodiments, a change in the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 and a corresponding change in the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2 is a biomarker for a patient being treated with a compound, such as disclosed herein. In a specific embodiment, the patient is an SMA patient.

In a specific embodiment, an increase in the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 and a corresponding decrease in the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2 after the administration of a compound (e.g., a compound of Formula (I) disclosed herein) indicates that the compound may be effective to treat SMA. In another specific embodiment, a decrease in the amount of mRNA that is transcribed from the SMN2 gene and includes exon 7 of SMN2 and a corresponding increase in the amount of mRNA that is transcribed from the SMN2 gene and does not include exon 7 of SMN2 after the administration of a compound (e.g., a compound of Formula (I) disclosed herein) indicates that the compound will not be effective to treat SMA. In accordance with these embodiments, an SMN primer(s) and/or an SMN probe described below can be used in assays, such as PCR (e.g., qPCR) and RT-PCR (e.g., RT-qPCR or endpoint RT-PCR) to assess and/or quantify the amount of mRNA that is transcribed from the SMN1 gene and/or SMN2 gene and does or does not include exon 7 of SMN1 and/or SMN2.

In one embodiment, provided herein are SMN primers and/or SMN probes (e.g., a forward primer having the nucleotide sequence of SEQ ID NO. 1, 7, 8, 11 or 13; and/or a reverse primer having the nucleotide sequence of SEQ ID NO. 9 or 12; and/or an SMN probe such as a SEQ ID NO. 3 or 10) for amplifying nucleic acids encoding or encoded by human SMN1 and/or SMN2. These primers can be used as primers in, e.g., RT-PCR (such as RT-PCR, endpoint RT-PCR and/or RT-qPCR as described herein or as known to one skilled in the art), PCR (such as qPCR) or rolling circle amplification, and as probes in hybridization assays, such as a Northern blot and/or a Southern blot assay. As utilized in the Biological Examples herein, endpoint RT-PCR is a reverse transcription-polymerase chain reaction that is carried out for a certain number of amplification cycles (or until starting materials are exhausted) following by a quantification of each of the DNA products using, e.g., gel electrophoretic separation, staining with a fluorescent dye, quantification of fluorescence and the like.

›TERMINOLOGY · 23 of 40

SEQ ID NO. 1 hybridizes to DNA or RNA comprising nucleotides corresponding to nucleotides 22 to 40 of exon 7 of SMN1 and/or SMN2, SEQ ID NO. 2 hybridizes to DNA or RNA comprising nucleotides corresponding to nucleotides 4 to 26 of the firefly luciferase coding sequence; SEQ ID NO. 7 hydridizes to nucleic acid sequences (e.g., the sense strand of DNA) comprising nucleotides corresponding to nucleotides 32 to 54 of exon 7 of SMN1 and/or SMN2 and nucleotides 1 to 4 of exon 8 of SMN1 and/or SMN2, SEQ ID NO. 8 hybridizes to nucleic acid sequences (e.g., the sense strand of DNA) comprising nucleotides corresponding, in order, to nucleotides 87 to 111 of exon 7 of SMN1 and/or SMN2 and nucleotides 1 to 3 of exon 8 of SMN1 and/or SMN2, SEQ ID NO. 9 hybridizes to nucleic acid sequences (e.g., the antisense strand of DNA or RNA) comprising nucleotides corresponding to nucleotides 39 to 62 of exon 8 of SMN1 and/or SMN2, SEQ ID NO. 11 hybridizes to nucleic acid sequences (e.g., the sense strand of DNA) comprising nucleotides corresponding to nucleotides 43 to 63 of exon 6 of SMN1 and/or SMN2, SEQ ID NO. 12 hybridizes to nucleic acid sequences (e.g., the antisense strand of DNA or RNA) comprising nucleotides corresponding to nucleotides 51 to 73 of exon 8 of SMN1 and/or SMN2, and SEQ ID NO. 13 hybridizes to nucleic acid sequence (e.g., the sense strand of DNA) comprising nucleotides corresponding to nucleotides 22 to 46 of exon 6 of SMN1 and/or SMN2.

Accordingly, an oligonucleotide corresponding to SEQ ID NO. 9, 11, 12 and/or 13 can be used in an amplification reaction to amplify nucleic acids encoding or encoded by human SMN1 and/or SMN2 lacking exon 7 of human SMN1 and/or SMN2 and nucleic acid encoding or encoded by human SMN1 and/or SMN2 and includes exon 7 of human SMN1 and/or SMN2. In contrast, an oligonucleotide corresponding to SEQ ID NO. 8 in conjunction with a downstream reverse primer (e.g., SEQ ID NO. 9 or 12) can be used to amplify nucleic acids encoding or encoded by human SMN1 and/or SMN2 lacking exon 7 of human SMN1 and/or SMN2 and an oligonucleotide corresponding to SEQ ID NO. 1 and 7 in conjunction with a downstream reverse primer (e.g., SEQ ID NO. 9 or 12) can be used to amplify nucleic acids encoding or encoded by human SMN1 and/or human SMN2 and includes exon 7 of SMN1 and/or SMN2.

SEQ ID NO. 3 hybridizes to nucleic acid sequences (e.g., the sense strand of DNA) comprising nucleotides corresponding, in order, to nucleotides 50 to 54 of exon 7 of human SMN1 and/or SMN2 and nucleotides 1 to 21 of exon 8 of human SMN1 and/or SMN2, and SEQ ID NO. 10 hybridizes to nucleic acid sequences (e.g., the sense strand of DNA) comprising nucleotides corresponding to nucleotides 7 to 36 of exon 8 of human SMN1 and/or SMN2. SEQ ID NO. 3 is useful as a probe to detect mRNA that is transcribed from the minigene and includes exon 7 of SMN1 and/or SMN2, described herein or described in International Publication No. WO 2009/151546 or U.S. Patent Application Publication No. 2011/0086833 (each of which is incorporated herein by reference in its entirety) and to detect mRNA that is transcribed from human SMN1 and/or SMN2 and includes exon 7 of SMN1 and/or SMN2. In addition, SEQ ID NO. 10 is useful as a probe to detect mRNA that is transcribed from the minigene and does or does not include exon 7 of SMN1 and/or SMN2 and to detect mRNA that is transcribed from human SMN1 and/or SMN2, described herein or as described in International Publication No. WO 2009/151546 or U.S. Patent Application Publication No. 2011/0086833, each of which is incorporated herein by reference in its entirety.

In a specific embodiment, a primer and/or probe described below in the Biological Examples (e.g., SMN primers such as SEQ ID NO. 1, 7, 11 or 13 and/or SEQ ID NO. 2, 9 or 12, and/or SMN probes such as a SEQ ID NO. 3 or 10) is used in an assay, such as RT-PCR, RT-qPCR, endpoint RT-PCR, PCR, qPCR, rolling circle amplification and, as applicable, Northern blot or Southern blot (e.g., an assay such as described below in the Biological Examples), to determine whether a compound (e.g., a compound of Formula (I) or a form thereof) enhances the inclusion of exon 7 of SMN1 and/or SMN2 into mRNA that is transcribed from an SMN1 and/or SMN2 gene.

In another embodiment, a primer and/or probe described below in the Biological Examples (e.g., SMN primers such as SEQ ID NO. 1, 7, 11 or 13 and/or SEQ ID NO. 9 or 12, and/or SMN probes such as a SEQ ID NO. 3 or 10) is used in an assay, such as RT-PCR, RT-qPCR, endpoint RT-PCR, PCR, qPCR, rolling circle amplification and, as applicable, Northern blot or Southern blot (e.g., an assay such as described below in the Biological Examples), to monitor the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 in a patient sample. In a specific embodiment, the patient is an SMA patient.

In another embodiment, a primer and/or probe described below in the Biological Examples (e.g., SMN primers such as SEQ ID NO. 1, 7, 11 or 13 and/or SEQ ID NO. 9 or 12, and/or SMN probes such as a SEQ ID NO. 3 or 10) is used in an assay, such as RT-PCR, RT-qPCR, endpoint RT-PCR, PCR, qPCR, rolling circle amplification and, as applicable, Northern blot or Southern blot (e.g., an assay such as described below in the Biological Examples), to monitor a patient's response to a compound (e.g., a compound of Formula (I) or a form thereof). In a specific embodiment, the patient is an SMA patient.

A sample (e.g., a blood sample, PBMC sample, or tissue sample, such as a skin or muscle tissue sample) from a patient can be obtained using techniques known to one skilled in the art and the primers and/or probes described in the Biological Examples below can be used in assays (e.g., PCR, RT-PCR, RT-qPCR, qPCR, endpoint RT-PCR, rolling circle amplification, Northern blot and Southern blot) to determine the amount of mRNA that is transcribed from the SMN1 and/or SMN2 genes (e.g., the amount of mRNA that includes exon 7 of SMN2 transcribed from the SMN2 gene). A sample derived from a patient refers to a sample that is processed and/or manipulated after being obtained from the patient using techniques known to one skilled in the art. For example, a sample from a patient can be processed to, e.g., extract RNA, using techniques known to one of skill in the art. A sample from a patient can be processed to, e.g., extract RNA and the RNA is reversed transcribed to produce cDNA. In a specific embodiment, the patient is an SMA patient.

›TERMINOLOGY · 24 of 40

In a specific embodiment, provided herein is a method for detecting the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2, comprising: (a) contacting a patient sample (e.g., blood sample or tissue sample) or a sample derived from a patient (e.g., a blood sample or tissue sample that has been processed to extract RNA) with a forward SMN primer described below (e.g., SEQ ID NO. 1, 7, 11 or 13) and/or a reverse SMN primer described herein (e.g., SEQ ID NO. 9 or 12) along with applicable components for, e.g., an RT-PCR (e.g., endpoint RT-PCR and/or RT-qPCR), PCR (e.g., qPCR) or rolling circle amplification; and (b) detecting the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2. In certain embodiments, the sample is from or derived from a patient administered a compound, such as a compound of Formula (I) or a form thereof as described herein. In a specific embodiment, the patient is an SMA patient.

In another specific embodiment, provided herein is a method for detecting the amount of mRNA that is transcribed from the SMN1 and SMN2 genes, comprising: (a) contacting a patient sample (e.g., blood sample or tissue sample) or a sample derived from a patient (e.g., a blood sample or tissue sample that has been processed to extract RNA) with a forward SMN primer described below (e.g., SEQ ID NO. 1, 7, 11 or 13) and/or a reverse SMN primer described herein (e.g., SEQ ID NO. 9 or 12) along with applicable components for, e.g., an RT-PCR (e.g., endpoint RT-PCR and/or RT-qPCR), PCR (e.g., qPCR) or rolling circle amplification; and (b) detecting the amount of mRNA that is transcribed from the SMN1 and SMN2 genes. In certain embodiments, the sample is from or derived from a patient administered a compound, such as a compound of Formula (I) or a form thereof as described herein. In a specific embodiment, the patient is an SMA patient.

In another specific embodiment, provided herein is a method for detecting the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2, comprising: (a) contacting a patient sample (e.g., blood sample or tissue sample) or a sample derived from a patient (e.g., a blood sample or tissue sample that has been processed to extract RNA) with a forward SMN primer described below (e.g., SEQ ID NO. 8, 11 or 13) and/or a reverse SMN primer described herein (e.g., SEQ ID NO. 9 or 12) along with applicable components for, e.g., an RT-PCR (e.g., endpoint RT-PCR and/or RT-qPCR), PCR (e.g., qPCR) or rolling circle amplification; and (b) detecting the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2. In certain embodiments, the sample is from or derived from a patient administered a compound, such as a compound of Formula (I) or a form thereof as described herein. In a specific embodiment, the patient is an SMA patient.

In another specific embodiment, provided herein is a method for detecting the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2, comprising: (a) contacting a patient sample (e.g., blood sample or tissue sample) or a sample derived from a patient (e.g., a blood sample or tissue sample that has been processed to extract RNA) with an SMN probe described below (e.g., SEQ ID NO. 3 or 10) along with applicable components, e.g., of an RT-PCR (e.g., endpoint RT-PCR and/or RT-qPCR), PCR (e.g., qPCR), rolling circle amplification and, as applicable, Northern blot or Southern blot; and (b) detecting the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2. In certain embodiments, the sample is from or derived from a patient administered a compound, such as a compound of Formula (I) or a form thereof as described herein. In a specific embodiment, the patient is an SMA patient.

In another specific embodiment, provided herein is a method for detecting the amount of mRNA that is transcribed from the SMN1 and SMN2 genes, comprising: (a) contacting a patient sample (e.g., blood sample or tissue sample) or a sample derived from a patient (e.g., a blood sample or tissue sample that has been processed to extract RNA) with an SMN probe described below (e.g., SEQ ID NO. 3 or 10) along with applicable components for, e.g., an RT-PCR (e.g., endpoint RT-PCR and/or RT-qPCR), PCR (e.g., qPCR), rolling circle amplification and, as applicable, Northern blot or Southern blot; and (b) detecting the amount of mRNA that is transcribed from the SMN1 and SMN2 genes.

The amount of mRNA that is transcribed from the human SMN1 and SMN2 genes that includes exon 7 of SMN1 and SMN2 and the amount of mRNA that is transcribed from the human SMN1 and SMN2 genes and does not include exon 7 of SMN1 and SMN2 can be differentiated from each other by, e.g., size of the RNA or DNA fragment generated from SMN1 and SMN2 mRNA that includes exon 7 of SMN1 and SMN2 and from SMN1 and SMN2 mRNA that do not include exon 7 of SMN1 and SMN2. In certain embodiments, the sample is from or derived from a patient administered a compound, such as a compound of Formula (I) or a form thereof as described herein. In a specific embodiment, the patient is an SMA patient.

In another specific embodiment, provided herein is a method for detecting the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2, comprising: (a) contacting a patient sample (e.g., blood sample or tissue sample) or a sample derived from a patient (e.g., a blood sample or tissue sample that has been processed to extract RNA) with an SMN probe described below (e.g., SEQ ID NO. 10) along with applicable components for, e.g., an RT-PCR (e.g., endpoint RT-PCR and/or RT-qPCR), PCR (e.g., qPCR), rolling circle amplification, or Northern blot or Southern blot; and (b) detecting the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2. In certain embodiments, the sample is from or derived from a patient administered a compound, such as a compound of Formula (I) or a form thereof as described herein. In a specific embodiment, the patient is an SMA patient.

›TERMINOLOGY · 25 of 40

In a specific embodiment, provided herein is a method for detecting the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2, comprising: (a) contacting a patient sample (e.g., blood sample or tissue sample) or a sample derived from a patient (e.g., a blood sample or tissue sample that has been processed to extract RNA) with a forward SMN primer described below (e.g., SEQ ID NO. 1, 7, 11 or 13) and/or a reverse SMN primer described herein (e.g., SEQ ID NO. 9 or 12) and/or an SMN probe described herein (e.g., SEQ ID NO. 3 or 10) along with applicable components for e.g., an RT-PCR (e.g., endpoint RT-PCR and/or RT-qPCR), PCR (e.g., qPCR) or rolling circle amplification; and (b) detecting the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2. In certain embodiments, the sample is from or derived from a patient administered a compound, such as a compound of Formula (I) or a form thereof as described herein. In a specific embodiment, the patient is an SMA patient.

In a specific embodiment, provided herein is a method for detecting the amount of mRNA that is transcribed from the SMN1 and SMN2 genes, comprising: (a) contacting a patient sample (e.g., blood sample or tissue sample) or a sample derived from a patient (e.g., a blood sample or tissue sample that has been processed to extract RNA) with a forward SMN primer described below (e.g., SEQ ID NO. 1, 7, 8, 11 or 13) and/or a reverse SMN primer described herein (e.g., SEQ ID NO. 9 or 12) and/or an SMN probe described herein (e.g., SEQ ID NO. 3 or 10) along with applicable components for e.g., an RT-PCR (e.g., endpoint RT-PCR and/or RT-qPCR), PCR (e.g., qPCR) or rolling circle amplification, as applicable; and (b) detecting the amount of mRNA that is transcribed from the SMN1 and SMN2 genes. In a specific embodiment, the patient is an SMA patient.

The amount of mRNA that is transcribed from the human SMN1 and SMN2 genes that includes exon 7 of SMN1 and SMN2 and the amount of mRNA that is transcribed from the human SMN1 and SMN2 genes that do not include exon 7 of SMN1 and SMN2 can be differentiated from each other by, e.g., size of the RNA or DNA fragment generated from SMN1 and SMN2 mRNA that includes exon 7 of SMN1 and SMN2 and from SMN1 and SMN2 mRNA that does not include exon 7 of SMN1 and SMN2. In certain embodiments, the sample is from or derived from a patient administered a compound, such as a compound of Formula (I) or a form thereof as described herein. In a specific embodiment, the patient is an SMA patient.

In a specific embodiment, provided herein is a method for detecting the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2, comprising: (a) contacting a patient sample (e.g., blood sample or tissue sample) or a sample derived from a patient (e.g., a blood sample or tissue sample that has been processed to extract RNA) with a forward SMN primer described below (e.g., SEQ ID NO. 8) and/or a reverse SMN primer described herein (e.g., SEQ ID NO. 9 or 12) and/or an SMN probe described herein (e.g., SEQ ID NO. 10) along with applicable components for e.g., an RT-PCR (e.g., endpoint RT-PCR and/or RT-qPCR), PCR (e.g., qPCR) or rolling circle amplification; and (b) detecting the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2. In certain embodiments, the sample is from or derived from a patient administered a compound, such as a compound of Formula (I) or a form thereof as described herein. In a specific embodiment, the patient is an SMA patient.

›TERMINOLOGY · 26 of 40

In a specific embodiment, provided herein is a method for assessing an SMA patient's response to a compound, comprising: (a) contacting an SMA patient sample (e.g., blood sample or tissue sample) or a sample derived from an SMA patient (e.g., a blood sample or tissue sample that has been processed to extract RNA) with a forward SMN primer described below (e.g., SEQ ID NO. 1, 7, 11 or 13) and/or a reverse SMN primer described herein (e.g., SEQ ID NO. 9 or 12) and/or an SMN probe (e.g., SEQ ID NO. 3 or 10) along with applicable components for e.g., RT-PCR (e.g., endpoint RT-PCR and/or RT-qPCR), PCR (e.g., qPCR) or rolling circle amplification, wherein the sample is from or derived from an SMA patient administered a compound (e.g., a compound of Formula (I) or a form thereof as described herein); and (b) detecting the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2, wherein (1) an increase in the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 in the patient sample relative to the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 in an analogous sample (e.g., from the same type of tissue sample) from the patient prior to administration of the compound indicates that the patient is responsive to the compound and that the compound may be or is beneficial and/or of therapeutic value to the patient; and (2) no change or no substantial change in the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 in the patient sample relative to the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 in an analogous sample (e.g., from the same type of tissue sample) from the patient prior to administration of the compound indicates that the patient is not responsive to the compound and that the compound is not beneficial and/or of therapeutic value to the patient. In certain embodiments, the patient's response is assessed 1 hour, 2 hours, 4 hours, 8 hours, 12 hours, 16 hours, 20 hours, 1 day, 2 days, 3 days, 5 days, 7 days, 14 days, 28 days, 1 month, 2 months, 3 months, 6 months, 9 months, 12 months or more after administration of a compound, such as a compound of Formula (I) or a form thereof as described herein.

›TERMINOLOGY · 27 of 40

In a specific embodiment, provided herein is a method for assessing an SMA patient's response to a compound, comprising: (a) contacting an SMA patient sample (e.g., blood sample or tissue sample) or a sample derived from an SMA patient (e.g., a blood sample or tissue sample that has been processed to extract RNA) with a forward SMN primer described below (e.g., SEQ ID NO. 8, 11 or 13) and/or a reverse SMN primer described herein (e.g., SEQ ID NO. 9 or 12) along with applicable components for e.g., RT-PCR (e.g., endpoint RT-PCR and/or RT-qPCR), PCR (e.g., qPCR) or rolling circle amplification, wherein the sample is from or derived from an SMA patient administered a compound (e.g., a compound of Formula (I) or a form thereof as described herein); and (b) detecting the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2, wherein (1) a decrease in the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2 in the patient sample relative to the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2 in an analogous sample (e.g., from the same type of tissue sample) from the patient prior to administration of the compound indicates that the patient is responsive to the compound and that the compound may be or is beneficial and/or of therapeutic value to the patient; and (2) no change or no substantial change in the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2 in the patient sample relative to the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2 in an analogous sample (e.g., from the same type of tissue sample) from the patient prior to administration of the compound indicates that the patient is not responsive to the compound and that the compound is not beneficial and/or of therapeutic value to the patient. In certain embodiments, the patient's response is assessed 1 hour, 2 hours, 4 hours, 8 hours, 12 hours, 16 hours, 20 hours, 1 day, 2 days, 3 days, 5 days, 7 days, 14 days, 28 days, 1 month, 2 months, 3 months, 6 months, 9 months, 12 months or more after administration of a compound, such as a compound of Formula (I) or a form thereof as described herein.

In a specific embodiment, provided herein is a method for assessing an SMA patient's response to a compound, comprising: (a) contacting an SMA patient sample (e.g., blood sample or tissue sample) or a sample derived from an SMA patient (e.g., a blood sample or tissue sample that has been processed to extract RNA) with a forward SMN primer described below (e.g., SEQ ID NO. 8, 11 or 13) and/or a reverse SMN primer described herein (e.g., SEQ ID NO. 9 or 12) and/or an SMN probe (e.g., SEQ ID NO. 10) along with applicable components for e.g., RT-PCR (e.g., endpoint RT-PCR and/or RT-qPCR), PCR (e.g., qPCR) or rolling circle amplification, wherein the sample is from or derived from an SMA patient administered a compound (e.g., a compound of Formula (I) or a form thereof as described herein); and (b) detecting the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2, wherein (1) a decrease in the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2 in the patient sample relative to the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2 in an analogous sample (e.g., from the same type of tissue sample) from the patient prior to administration of the compound indicates that the patient is responsive to the compound and that the compound may be or is beneficial and/or of therapeutic value to the patient; and (2) no change or no substantial change in the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2 in the patient sample relative to the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2 in an analogous sample (e.g., from the same type of tissue sample) from the patient prior to administration of the compound indicates that the patient is not responsive to the compound and that the compound is not beneficial and/or of therapeutic value to the patient. In certain embodiments, the patient's response is assessed 1 hour, 2 hours, 4 hours, 8 hours, 12 hours, 16 hours, 20 hours, 1 day, 2 days, 3 days, 5 days, 7 days, 14 days, 28 days, 1 month, 2 months, 3 months, 6 months, 9 months, 12 months or more after administration of a compound, such as a compound of Formula (I) or a form thereof as described herein.

›TERMINOLOGY · 28 of 40

In another specific embodiment, provided herein is a method for assessing an SMA patient's response to a compound, comprising: (a) administering a compound to an SMA patient; (b) contacting a sample (e.g., blood sample or tissue sample) obtained or derived from the patient with a forward SMN primer described below (e.g., SEQ ID NO. 8, 11 or 13) and/or a reverse SMN primer described herein (e.g., SEQ ID NO. 9 or 12) and/or an SMN probe (e.g., SEQ ID NO. 10) along with applicable components for e.g., RT-PCR (e.g., endpoint RT-PCR and/or RT-qPCR), PCR (e.g., qPCR) or rolling circle amplification; and (c) detecting the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2, wherein (1) a decrease in the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2 in the patient sample relative to the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2 in an analogous sample (e.g., from the same type of tissue sample) from the patient prior to administration of the compound indicates that the patient is responsive to the compound and that the compound may be or is beneficial and/or of therapeutic value to the patient; and (2) no change or no substantial change in the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2 in the patient sample relative to the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2 in an analogous sample (e.g., from the same type of tissue sample) from the patient prior to administration of the compound indicates that the patient is not responsive to the compound and that the compound is not beneficial and/or of therapeutic value to the patient. In certain embodiments, the patient's response is assessed 1 hour, 2 hours, 4 hours, 8 hours, 12 hours, 16 hours, 20 hours, 1 day, 2 days, 3 days, 5 days, 7 days, 14 days, 28 days, 1 month, 2 months, 3 months, 6 months, 9 months, 12 months or more after administration of a compound, such as a compound of Formula (I) or a form thereof as described herein.

In a specific embodiment, provided herein is a method for assessing an SMA patient's response to a compound, comprising: (a) contacting an SMA patient sample (e.g., blood sample or tissue sample) or a sample derived from an SMA patient (e.g., a blood sample or tissue sample that has been processed to extract RNA) with a forward SMN primer described below (e.g., SEQ ID NO. 11 or 13) and/or a reverse SMN primer described herein (e.g., SEQ ID NO. 9 or 12) along with applicable components for e.g., RT-PCR (e.g., endpoint RT-PCR and/or RT-qPCR), PCR (e.g., qPCR) or rolling circle amplification, wherein the sample is from or derived from an SMA patient administered a compound (e.g., a compound of Formula (I) or a form thereof as described herein); and (b) detecting the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 and the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2, wherein (1)(i) an increase in the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 in the patient sample relative to the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 in an analogous sample (e.g., from the same type of tissue sample) from the patient prior to administration of the compound, and (ii) a decrease in the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2 in the patient sample relative to the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2 in an analogous sample (e.g., from the same type of tissue sample) from the patient prior to administration of the compound, indicate that the patient is responsive to the compound and that the compound may be or is beneficial and/or of therapeutic value to the patient; and (2)(i) no change or no substantial change in the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 in the patient sample relative to the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 in an analogous sample (e.g., the same type of tissue sample) from the patient prior to administration of the compound, and (ii) no change or no substantial change in the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2 in the patient sample relative to the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2 in an analogous sample (e.g., the same type of tissue sample) from the patient prior to administration of the compound, indicates that the patient is not responsive to the compound and that the compound is not beneficial and/or of therapeutic value to the patient. In certain embodiments, the patient's response is assessed 1 hour, 2 hours, 4 hours, 8 hours, 12 hours, 16 hours, 20 hours, 1 day, 2 days, 3 days, 5 days, 7 days, 14 days, 28 days, 1 month, 2 months, 3 months, 6 months, 9 months, 12 months or more after administration of a compound, such as a compound of Formula (I) or a form thereof as described herein.

In another specific embodiment, provided herein is a method for assessing an SMA patient's response to a compound, comprising: (a) administering a compound to an SMA patient; (b) contacting a sample (e.g., blood sample or tissue sample) obtained or derived from the patient with a forward SMN primer described below (e.g., SEQ ID NO. 11 or 13) and/or a reverse SMN primer described herein (e.g., SEQ ID NO. 9 or 12) along with applicable components for e.g., RT-PCR (e.g., endpoint RT-PCR and/or RT-qPCR), PCR (e.g., qPCR) or rolling circle amplification; and (c) detecting the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 and the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2, wherein (1)(i) an increase in the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 in the patient sample relative to the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 in an analogous sample (e.g., from the same type of tissue sample) from the patient prior to administration of the compound, and (ii) a decrease in the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2 in the patient sample relative to the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2 in an analogous sample (e.g., from the same type of tissue sample) from the patient prior to administration of the compound, indicate that the patient is responsive to the compound and that the compound may be or is beneficial and/or of therapeutic value to the patient; and (2)(i) no change or no substantial change in the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 in the patient sample relative to the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 in an analogous sample (e.g., the same type of tissue sample) from the patient prior to administration of the compound, and (ii) no change or no substantial change in the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2 in the patient sample relative to the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2 in an analogous sample (e.g., the same type of tissue sample) from the patient prior to administration of the compound, indicate that the patient is not responsive to the compound and that the compound is not beneficial and/or of therapeutic value to the patient. In certain embodiments, the patient's response is assessed 1 hour, 2 hours, 4 hours, 8 hours, 12 hours, 16 hours, 20 hours, 1 day, 2 days, 3 days, 5 days, 7 days, 14 days, 28 days, 1 month, 2 months, 3 months, 6 months, 9 months, 12 months or more after administration of a compound, such as a compound of Formula (I) or a form thereof as described herein.

›TERMINOLOGY · 29 of 40

In a specific embodiment, provided herein is a method for assessing an SMA patient's response to a compound, comprising: (a) contacting an SMA patient sample (e.g., blood sample or tissue sample) or a sample derived from an SMA patient (e.g., a blood sample or tissue sample that has been processed to extract RNA) with an SMN probe (e.g., SEQ ID NO. 10) along with applicable components for e.g., RT-PCR (e.g., endpoint RT-PCR and/or RT-qPCR), PCR (e.g., qPCR) or rolling circle amplification, wherein the sample is from or derived from an SMA patient administered a compound (e.g., a compound of Formula (I) or a form thereof as described herein); and (b) detecting the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 and the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2, wherein (1)(i) an increase in the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 in the patient sample relative to the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 in an analogous sample (e.g., from the same type of tissue sample) from the patient prior to administration of the compound, and (ii) a decrease in the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2 in the patient sample relative to the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2 in an analogous sample (e.g., from the same type of tissue sample) from the patient prior to administration of the compound, indicate that the patient is responsive to the compound and that the compound may be or is beneficial and/or of therapeutic value to the patient; and (2)(i) no change or no substantial change in the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 in the patient sample relative to the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 in an analogous sample (e.g., the same type of tissue sample) from the patient prior to administration of the compound, and (ii) no change or no substantial change in the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2 in the patient sample relative to the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2 in an analogous sample (e.g., the same type of tissue sample) from the patient prior to administration of the compound, indicate that the patient is not responsive to the compound and that the compound is not beneficial and/or of therapeutic value to the patient. In certain embodiments, the patient's response is assessed 1 hour, 2 hours, 4 hours, 8 hours, 12 hours, 16 hours, 20 hours, 1 day, 2 days, 3 days, 5 days, 7 days, 14 days, 28 days, 1 month, 2 months, 3 months, 6 months, 9 months, 12 months or more after administration of a compound, such as a compound of Formula (I) or a form thereof as described herein.

In another specific embodiment, provided herein is a method for assessing an SMA patient's response to a compound, comprising: (a) administering a compound to an SMA patient; (b) contacting a sample (e.g., blood sample or tissue sample) obtained or derived from the patient with an SMN probe (e.g., SEQ ID NO. 10) along with applicable components for e.g., RT-PCR (e.g., endpoint RT-PCR and/or RT-qPCR), PCR (e.g., qPCR) or rolling circle amplification; and (c) detecting the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 and the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2, wherein (1)(i) an increase in the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 in the patient sample relative to the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 in an analogous sample (e.g., from the same type of tissue sample) from the patient prior to administration of the compound, and (ii) a decrease in the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2 in the patient sample relative to the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2 in an analogous sample (e.g., from the same type of tissue sample) from the patient prior to administration of the compound, indicate that the patient is responsive to the compound and that the compound may be or is beneficial and/or of therapeutic value to the patient; and (2)(i) no change or no substantial change in the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 in the patient sample relative to the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 in an analogous sample (e.g., the same type of tissue sample) from the patient prior to administration of the compound, and (ii) no change or no substantial change in the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2 in the patient sample relative to the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2 in an analogous sample (e.g., the same type of tissue sample) from the patient prior to administration of the compound, indicate that the patient is not responsive to the compound and that the compound is not beneficial and/or of therapeutic value to the patient. In certain embodiments, the patient's response is assessed 1 hour, 2 hours, 4 hours, 8 hours, 12 hours, 16 hours, 20 hours, 1 day, 2 days, 3 days, 5 days, 7 days, 14 days, 28 days, 1 month, 2 months, 3 months, 6 months, 9 months, 12 months or more after administration of a compound, such as a compound of Formula (I) or a form thereof as described herein.

›TERMINOLOGY · 30 of 40

In a specific embodiment, provided herein is a method for assessing an SMA patient's response to a compound, comprising: (a) contacting an SMA patient sample (e.g., blood sample or tissue sample) or a sample derived from an SMA patient (e.g., a blood sample or tissue sample that has been processed to extract RNA) with a forward SMN primer described below (e.g., SEQ ID NO. 11 or 13) and/or a reverse SMN primer described herein (e.g., SEQ ID NO. 9 or 12) and/or an SMN probe (e.g., SEQ ID NO. 10) along with applicable components for e.g., RT-PCR (e.g., endpoint RT-PCR and/or RT-qPCR) or PCR (e.g., qPCR), wherein the sample is from or derived from an SMA patient administered a compound (e.g., a compound of Formula (I) or a form thereof as described herein); and (b) detecting the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 and the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2, wherein (1)(i) an increase in the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 in the patient sample relative to the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 in an analogous sample (e.g., from the same type of tissue sample) from the patient prior to administration of the compound, and (ii) a decrease in the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2 in the patient sample relative to the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2 in an analogous sample (e.g., from the same type of tissue sample) from the patient prior to administration of the compound, indicate that the patient is responsive to the compound and that the compound may be or is beneficial and/or of therapeutic value to the patient; and (2)(i) no change or no substantial change in the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 in the patient sample relative to the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 in an analogous sample (e.g., the same type of tissue sample) from the patient prior to administration of the compound, and (ii) no change or no substantial change in the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2 in the patient sample relative to the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2 in an analogous sample (e.g., the same type of tissue sample) from the patient prior to administration of the compound, indicate that the patient is not responsive to the compound and that the compound is not beneficial and/or of therapeutic value to the patient. In certain embodiments, the patient's response is assessed 1 hour, 2 hours, 4 hours, 8 hours, 12 hours, 16 hours, 20 hours, 1 day, 2 days, 3 days, 5 days, 7 days, 14 days, 28 days, 1 month, 2 months, 3 months, 6 months, 9 months, 12 months or more after administration of a compound, such as a compound of Formula (I) or a form thereof as described herein.

In another specific embodiment, provided herein is a method for assessing an SMA patient's response to a compound, comprising: (a) administering a compound to an SMA patient; (b) contacting a sample (e.g., blood sample or tissue sample) obtained or derived from the patient with a forward SMN primer described below (e.g., SEQ ID NO. 11 or 13) and/or a reverse SMN primer described herein (e.g., SEQ ID NO. 9 or 12) and/or an SMN probe (e.g., SEQ ID NO. 10) along with applicable components for, e.g., RT-PCR (e.g., endpoint RT-PCR and/or RT-qPCR), PCR (e.g., qPCR) or rolling circle amplification; and (c) detecting the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 and the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2, wherein (1)(i) an increase in the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 in the patient sample relative to the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 in an analogous sample (e.g., from the same type of tissue sample) from the patient prior to administration of the compound, and (ii) a decrease in the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2 in the patient sample relative to the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2 in an analogous sample (e.g., from the same type of tissue sample) from the patient prior to administration of the compound, indicate that the SMN1 and/or patient is responsive to the compound and that the compound may be or is beneficial and/or of therapeutic value to the patient; and (2)(i) no change or no substantial change in the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 in the patient sample relative to the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 in an analogous sample (e.g., the same type of tissue sample) from the patient prior to administration of the compound, and (ii) no change or no substantial change in the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2 in the patient sample relative to the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2 in an analogous sample (e.g., the same type of tissue sample) from the patient prior to administration of the compound, indicate that the patient is not responsive to the compound and that the compound is not beneficial and/or of therapeutic value to the patient. In certain embodiments, the patient's response is assessed 1 hour, 2 hours, 4 hours, 8 hours, 12 hours, 16 hours, 20 hours, 1 day, 2 days, 3 days, 5 days, 7 days, 14 days, 28 days, 1 month, 2 months, 3 months, 6 months, 9 months, 12 months or more after administration of a compound, such as a compound of Formula (I) or a form thereof as described herein.

›TERMINOLOGY · 31 of 40

In a specific embodiment, provided herein is a method for monitoring an SMA patient's responsiveness to a compound, comprising: (a) contacting an SMA patient sample (e.g., blood sample or tissue sample) or a sample derived from an SMA patient (e.g., a blood sample or tissue sample that has been processed to extract RNA) with a forward SMN primer described below (e.g., SEQ ID NO. 1, 7, 11 or 13) and/or a reverse SMN primer described herein (e.g., SEQ ID NO. 9 or 12) along with applicable components for e.g., RT-PCR (e.g., endpoint RT-PCR and/or RT-qPCR), PCR (e.g., qPCR) or rolling circle amplification, wherein the sample is from or derived from an SMA patient administered a compound (e.g., a compound of Formula (I) or a form thereof as described herein); and (b) detecting the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2, wherein (1) an increase in the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 in the patient sample relative to the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 in an analogous sample (e.g., from the same type of tissue sample) from the patient prior to the administration of the compound or a certain number of doses of the compound, or a certain earlier date indicates that the patient is responsive to the compound and that the compound may be or is beneficial and/or of therapeutic value to the patient; and (2) no change or no substantial change in the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 in the patient sample relative to the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 in an analogous sample (e.g., from the same type of tissue sample) from the patient prior to the administration of the compound or a certain number of doses of the compound, or a certain earlier date indicates that the patient is not responsive to the compound and that the compound is not beneficial and/or of therapeutic value to the patient. In certain embodiments, the patient's response is monitored 1 hour, 2 hours, 4 hours, 8 hours, 12 hours, 16 hours, 20 hours, 1 day, 2 days, 3 days, 4 days, 5 days, 7 days, 14 days, 28 days, 1 month, 2 months, 3 months, 6 months, 9 months, 12 months or more after administration of a compound, such as of Formula (I) or a form thereof as described herein. In some embodiments, the patient's response is monitored after the patient has received 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more doses of a compound, such as a compound of Formula (I) or a form thereof as described herein. In some embodiments, the patient's response is monitored after the administration of 1-5, 5-10, 10-15, 15-20, 20-30, 30-40, 40-50, or 50-100 doses of a compound, such as a compound of Formula (I) or a form thereof as described herein. In some embodiments, the patient's response is monitored over a period of days, weeks, months or years during or after the continuous administration of a compound, such as a compound of Formula (I) or a form thereof as described herein.

In another specific embodiment, provided herein is a method for monitoring an SMA patient's responsiveness to a compound, comprising: (a) administering a compound to an SMA patient; (b) contacting a sample (e.g., blood sample or tissue sample) obtained or derived from the patient with a forward SMN primer described below (e.g., SEQ ID NO. 1, 7, 11 or 13) and/or a reverse SMN primer described herein (e.g., SEQ ID NO. 9 or 12) along with applicable components for, e.g., RT-PCR (e.g., endpoint RT-PCR and/or RT-qPCR), PCR (e.g., qPCR) or rolling circle amplification; and (c) detecting the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2, wherein (1) an increase in the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 in the patient sample relative to the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 in an analogous sample (e.g., from the same type of tissue sample) from the patient prior to the administration of the compound or a certain number of doses of the compound, or a certain earlier date indicates that the patient is responsive to the compound and that the compound may be or is beneficial and/or of therapeutic value to the patient; and (2) no change or no substantial change in the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 in the patient sample relative to the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 in an analogous sample (e.g., from the same type of tissue sample) from the patient prior to the administration of the compound or a certain number of doses of the compound, or a certain earlier date indicates that the patient is not responsive to the compound and that the compound is not beneficial and/or of therapeutic value to the patient. In certain embodiments, the patient's response is monitored 1 hour, 2 hours, 4 hours, 8 hours, 12 hours, 16 hours, 20 hours, 1 day, 2 days, 3 days, 4 days, 5 days, 7 days, 14 days, 28 days, 1 month, 2 months, 3 months, 6 months, 9 months, 12 months or more after administration of a compound, such as a compound of Formula (I) or a form thereof as described herein. In some embodiments, the patient's response is monitored after the patient has received 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more doses of a compound, such as a compound of Formula (I) or a form thereof as described herein. In some embodiments, the patient's response is monitored after the administration of 1-5, 5-10, 10-15, 15-20, 20-30, 30-40, 40-50, or 50-100 doses of a compound, such as a compound of Formula (I) or a form thereof as described herein. In some embodiments, the patient's response is monitored over a period of days, weeks, months or years during or after the continuous administration of a compound, such as a compound of Formula (I) or a form thereof as described herein.

›TERMINOLOGY · 32 of 40

In a specific embodiment, provided herein is a method for monitoring an SMA patient's responsiveness to a compound, comprising: (a) contacting an SMA patient sample (e.g., blood sample or tissue sample) or a sample derived from an SMA patient (e.g., a blood sample or tissue sample that has been processed to extract RNA) with a forward SMN primer described below (e.g., SEQ ID NO. 1, 7, 11 or 13) and/or a reverse SMN primer described herein (e.g., SEQ ID NO. 9 or 12) and/or an SMN probe (e.g., SEQ ID NO. 3 or 10) along with applicable components for e.g., RT-PCR (e.g., endpoint RT-PCR and/or RT-qPCR), PCR (e.g., qPCR) or rolling circle amplification, wherein the sample is from or derived from an SMA patient administered a compound (e.g., a compound of Formula (I) or a form thereof as described herein); and (b) detecting the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2, wherein (1) an increase in the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 in the patient sample relative to the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 in an analogous sample (e.g., from the same type of tissue sample) from the patient prior to the administration of the compound or a certain number of doses of the compound, or a certain earlier date indicates that the patient is responsive to the compound and that the compound may be or is beneficial and/or of therapeutic value to the patient; and (2) no change or no substantial change in the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 in the patient sample relative to the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 in an analogous sample (e.g., from the same type of tissue sample) from the patient prior to the administration of the compound or a certain number of doses of the compound, or a certain earlier date indicates that the patient is not responsive to the compound and that the compound is not beneficial and/or of therapeutic value to the patient. In certain embodiments, the patient's response is monitored 1 hour, 2 hours, 4 hours, 8 hours, 12 hours, 16 hours, 20 hours, 1 day, 2 days, 3 days, 4 days, 5 days, 7 days, 14 days, 28 days, 1 month, 2 months, 3 months, 6 months, 9 months, 12 months or more after administration of a compound, such as of Formula (I) or a form thereof as described herein. In some embodiments, the patient's response is monitored after the patient has received 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more doses of a compound, such as a compound of Formula (I) or a form thereof as described herein. In some embodiments, the patient's response is monitored after the administration of 1-5, 5-10, 10-15, 15-20, 20-30, 30-40, 40-50, or 50-100 doses of a compound, such as a compound of Formula (I) or a form thereof as described herein. In some embodiments, the patient's response is monitored over a period of days, weeks, months or years during or after the continuous administration of a compound, such as a compound of Formula (I) or a form thereof as described herein.

In another specific embodiment, provided herein is a method for monitoring an SMA patient's responsiveness to a compound, comprising: (a) administering a compound to an SMA patient; (b) contacting a sample (e.g., blood sample or tissue sample) obtained or derived from the patient with a forward SMN primer described below (e.g., SEQ ID NO. 1, 7, 11 or 13) and/or a reverse SMN primer described herein (e.g., SEQ ID NO. 9 or 12) and/or an SMN probe (e.g., SEQ ID NO. 3 or 10) along with applicable components for, e.g., RT-PCR (e.g., endpoint RT-PCR and/or RT-qPCR), PCR (e.g., qPCR) or rolling circle amplification; and (c) detecting the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2, wherein (1) an increase in the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 in the patient sample relative to the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 in an analogous sample (e.g., from the same type of tissue sample) from the patient prior to the administration of the compound or a certain number of doses of the compound, or a certain earlier date indicates that the patient is responsive to the compound and that the compound may be or is beneficial and/or of therapeutic value to the patient; and (2) no change or no substantial change in the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 in the patient sample relative to the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 in an analogous sample (e.g., from the same type of tissue sample) from the patient prior to the administration of the compound or a certain number of doses of the compound, or a certain earlier date indicates that the patient is not responsive to the compound and that the compound is not beneficial and/or of therapeutic value to the patient. In certain embodiments, the patient's response is monitored 1 hour, 2 hours, 4 hours, 8 hours, 12 hours, 16 hours, 20 hours, 1 day, 2 days, 3 days, 4 days, 5 days, 7 days, 14 days, 28 days, 1 month, 2 months, 3 months, 6 months, 9 months, 12 months or more after administration of a compound, such as a compound of Formula (I) or a form thereof as described herein. In some embodiments, the patient's response is monitored after the patient has received 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more doses of a compound, such as a compound of Formula (I) or a form thereof as described herein. In some embodiments, the patient's response is monitored after the administration of 1-5, 5-10, 10-15, 15-20, 20-30, 30-40, 40-50, or 50-100 doses of a compound, such as a compound of Formula (I) or a form thereof as described herein. In some embodiments, the patient's response is monitored over a period of days, weeks, months or years during or after the continuous administration of a compound, such as a compound of Formula (I) or a form thereof as described herein.

›TERMINOLOGY · 33 of 40

In a specific embodiment, provided herein is a method for monitoring an SMA patient's responsiveness to a compound, comprising: (a) contacting an SMA patient sample (e.g., blood sample or tissue sample) or a sample derived from an SMA patient (e.g., a blood sample or tissue sample that has been processed to extract RNA) with a forward SMN primer described below (e.g., SEQ ID NO. 8, 11 or 13) and/or a reverse SMN primer described herein (e.g., SEQ ID NO. 9 or 12) along with applicable components for, e.g., RT-PCR (e.g., endpoint RT-PCR and/or RT-qPCR), PCR (e.g., qPCR) or rolling circle amplification, wherein the sample is from or derived from an SMA patient administered a compound (e.g., a compound of Formula (I) or a form thereof as described herein); and (b) detecting the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2, wherein (1) a decrease in the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2 in the patient sample relative to the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2 in an analogous sample (e.g., from the same type of tissue sample) from the patient prior to the administration of the compound or a certain number of doses of the compound, or a certain earlier date indicates that the patient is responsive to the compound and that the compound may be or is beneficial and/or of therapeutic value to the patient; and (2) no change or no substantial change in the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2 in the patient sample relative to the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2 in an analogous sample (e.g., from the same type of tissue sample) from the patient prior to the administration of the compound or a certain number of doses of the compound, or a certain earlier date indicates that the patient is not responsive to the compound and that the compound is not beneficial and/or of therapeutic value to the patient. In certain embodiments, the patient's response is monitored 1 hour, 2 hours, 4 hours, 8 hours, 12 hours, 16 hours, 20 hours, 1 day, 2 days, 3 days, 4 days, 5 days, 7 days, 14 days, 28 days, 1 month, 2 months, 3 months, 6 months, 9 months, 12 months or more after administration of a compound, such as a compound of Formula (I) or a form thereof as described herein. In some embodiments, the patient's response is monitored after the patient has received 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more doses of a compound, such as a compound of Formula (I) or a form thereof as described herein. In some embodiments, the patient's response is monitored after the administration of 1-5, 5-10, 10-15, 15-20, 20-30, 30-40, 40-50, or 50-100 doses of a compound, such as a compound of Formula (I) or a form thereof as described herein. In some embodiments, the patient's response is monitored over a period of days, weeks, months or years during or after the continuous administration of a compound, such as a compound of Formula (I) or a form thereof as described herein.

In another specific embodiment, provided herein is a method for monitoring an SMA patient's responsiveness to a compound, comprising: (a) administering a compound to an SMA patient; (b) contacting a sample (e.g., blood sample or tissue sample) obtained or derived from the patient with a forward SMN primer described below (e.g., SEQ ID NO. 8, 11 or 13) and/or a reverse SMN primer described herein (e.g., SEQ ID NO. 9 or 12) along with applicable components for, e.g., RT-PCR (e.g., endpoint RT-PCR and/or RT-qPCR), PCR (e.g., qPCR) or rolling circle amplification; and (c) detecting the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2, wherein (1) a decrease in the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2 in the patient sample relative to the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2 in an analogous sample (e.g., from the same type of tissue sample) from the patient prior to the administration of the compound or a certain number of doses of the compound, or a certain earlier date indicates that the patient is responsive to the compound and that the compound may be or is beneficial and/or of therapeutic value to the patient; and (2) no change or no substantial change in the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2 in the patient sample relative to the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2 in an analogous sample (e.g., from the same type of tissue sample) from the patient prior to the administration of the compound or a certain number of doses of the compound, or a certain earlier date indicates that the patient is not responsive to the compound and that the compound is not beneficial and/or of therapeutic value to the patient. In certain embodiments, the patient's response is monitored 1 hour, 2 hours, 4 hours, 8 hours, 12 hours, 16 hours, 20 hours, 1 day, 2 days, 3 days, 4 days, 5 days, 7 days, 14 days, 28 days, 1 month, 2 months, 3 months, 6 months, 9 months, 12 months or more after administration of a compound, such as a compound of Formula (I) or a form thereof as described herein. In some embodiments, the patient's response is monitored after the patient has received 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more doses of a compound, such as a compound of Formula (I) or a form thereof as described herein. In some embodiments, the patient's response is monitored after the administration of 1-5, 5-10, 10-15, 15-20, 20-30, 30-40, 40-50, or 50-100 doses of a compound, such as a compound of Formula (I) or a form thereof as described herein. In some embodiments, the patient's response is monitored continuous administration of a compound over a period of days, weeks, months or years, such as a compound of Formula (I) or a form thereof as described herein.

›TERMINOLOGY · 34 of 40

In a specific embodiment, provided herein is a method for monitoring an SMA patient's responsiveness to a compound, comprising: (a) contacting an SMA patient sample (e.g., blood sample or tissue sample) or a sample derived from an SMA patient (e.g., a blood sample or tissue sample that has been processed to extract RNA) with a forward SMN primer described below (e.g., SEQ ID NO. 8, 11 or 13) and/or a reverse SMN primer described herein (e.g., SEQ ID NO. 9 or 12) and/or an SMN probe (e.g., SEQ ID NO. 10) along with applicable components for, e.g., RT-PCR (e.g., endpoint RT-PCR and/or RT-qPCR), PCR (e.g., qPCR) or rolling circle amplification, wherein the sample is from or derived from a patient administered a compound (e.g., a compound of Formula (I) or a form thereof as described herein); and (b) detecting the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2, wherein (1) a decrease in the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2 in the patient sample relative to the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2 in an analogous sample (e.g., from the same type of tissue sample) from the patient prior to the administration of the compound or a certain number of doses of the compound, or a certain earlier date indicates that the patient is responsive to the compound and that the compound may be or is beneficial and/or of therapeutic value to the patient; and (2) no change or no substantial change in the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2 in the patient sample relative to the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2 in an analogous sample (e.g., from the same type of tissue sample) from the patient prior to the administration of the compound or a certain number of doses of the compound, or a certain earlier date indicates that the patient is not responsive to the compound and that the compound is not beneficial and/or of therapeutic value to the patient. In certain embodiments, the patient's response is monitored 1 hour, 2 hours, 4 hours, 8 hours, 12 hours, 16 hours, 20 hours, 1 day, 2 days, 3 days, 4 days, 5 days, 7 days, 14 days, 28 days, 1 month, 2 months, 3 months, 6 months, 9 months, 12 months or more after administration of a compound, such as a compound of Formula (I) or a form thereof as described herein. In some embodiments, the patient's response is monitored after the patient has received 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more doses of a compound, such as a compound of Formula (I) or a form thereof as described herein. In some embodiments, the patient's response is monitored after the administration of 1-5, 5-10, 10-15, 15-20, 20-30, 30-40, 40-50, or 50-100 doses of a compound, such as a compound of Formula (I) or a form thereof as described herein. In some embodiments, the patient's response is monitored over a period of days, weeks, months or years during or after the continuous administration of a compound, such as a compound of Formula (I) or a form thereof as described herein.

In another specific embodiment, provided herein is a method for monitoring an SMA patient's responsiveness to a compound, comprising: (a) administering a compound to an SMA patient; (b) contacting a sample (e.g., blood sample or tissue sample) obtained or derived from the patient with a forward SMN primer described below (e.g., SEQ ID NO. 8, 11 or 13) and/or a reverse SMN primer described herein (e.g., SEQ ID NO. 9 or 12) and/or an SMN probe (e.g., SEQ ID NO. 10) along with applicable components for, e.g., RT-PCR (e.g., endpoint RT-PCR and/or RT-qPCR), PCR (e.g., qPCR) or rolling circle amplification; and (c) detecting the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2, wherein (1) a decrease in the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2 in the patient sample relative to the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2 in an analogous sample (e.g., from the same type of tissue sample) from the patient prior to the administration of the compound or a certain number of doses of the compound, or a certain earlier date indicates that the patient is responsive to the compound and that the compound may be or is beneficial and/or of therapeutic value to the patient; and (2) no change or no substantial change in the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2 in the patient sample relative to the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2 in an analogous sample (e.g., from the same type of tissue sample) from the patient prior to the administration of the compound or a certain number of doses of the compound, or a certain earlier date indicates that the patient is not responsive to the compound and that the compound is not beneficial and/or of therapeutic value to the patient. In certain embodiments, the patient's response is monitored 1 hour, 2 hours, 4 hours, 8 hours, 12 hours, 16 hours, 20 hours, 1 day, 2 days, 3 days, 4 days, 5 days, 7 days, 14 days, 28 days, 1 month, 2 months, 3 months, 6 months, 9 months, 12 months or more after administration of a compound, such as a compound of Formula (I) or a form thereof as described herein. In some embodiments, the patient's response is monitored after the patient has received 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more doses of a compound, such as a compound of Formula (I) or a form thereof as described herein. In some embodiments, the patient's response is monitored after the administration of 1-5, 5-10, 10-15, 15-20, 20-30, 30-40, 40-50, or 50-100 doses of a compound, such as a compound of Formula (I) or a form thereof as described herein. In some embodiments, the patient's response is monitored over a period of days, weeks, months or years during or after the continuous administration of a compound, such as a compound of Formula (I) or a form thereof as described herein.

›TERMINOLOGY · 35 of 40

In a specific embodiment, provided herein is a method for monitoring an SMA patient's response to a compound, comprising: (a) contacting an SMA patient sample (e.g., blood sample or tissue sample) or a sample derived from an SMA patient (e.g., a blood sample or tissue sample that has been processed to extract RNA) with a forward SMN primer described below (e.g., SEQ ID NO. 11 or 13) and/or a reverse SMN primer described herein (e.g., SEQ ID NO. 9 or 12) along with applicable components for, e.g., RT-PCR (e.g., endpoint RT-PCR and/or RT-qPCR), PCR (e.g., qPCR) or rolling circle amplification, wherein the sample is from or derived from an SMA patient administered a compound (e.g., a compound of Formula (I) or a form thereof as described herein); and (b) detecting the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 and the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2, wherein (1)(i) an increase in the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 in the patient sample relative to the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 in an analogous sample (e.g., from the same type of tissue sample) from the patient prior to administration of the compound or a certain number of doses of the compound, or a certain earlier date, and (ii) a decrease in the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2 in the patient sample relative to the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2 in an analogous sample (e.g., from the same type of tissue sample) from the patient prior to administration of the compound or a certain number of doses of the compound, or a certain earlier date, indicate that the patient is responsive to the compound and that the compound may be or is beneficial and/or of therapeutic value to the patient; and (2)(i) no change or no substantial change in the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 in the patient sample relative to the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 in an analogous sample (e.g., the same type of tissue sample) from the patient prior to administration of the compound or a certain number of doses of the compound, or a certain earlier date, and (ii) no change or no substantial change in the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2 in the patient sample relative to the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2 in an analogous sample (e.g., the same type of tissue sample) from the patient prior to administration of the compound or a certain number of doses of the compound, or a certain earlier date, indicate that the patient is not responsive to the compound and that the compound is not beneficial and/or of therapeutic value to the patient. In certain embodiments, the patient's response is monitored 1 hour, 2 hours, 4 hours, 8 hours, 12 hours, 16 hours, 20 hours, 1 day, 2 days, 3 days, 4 days, 5 days, 7 days, 14 days, 28 days, 1 month, 2 months, 3 months, 6 months, 9 months, 12 months or more after administration of a compound, such as a compound of Formula (I) or a form thereof as described herein. In some embodiments, the patient's response is monitored after the patient has received 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more doses of a compound, such as a compound of Formula (I) or a form thereof as described herein. In some embodiments, the patient's response is monitored after the administration of 1-5, 5-10, 10-15, 15-20, 20-30, 30-40, 40-50, or 50-100 doses of a compound, such as a compound of Formula (I) or a form thereof as described herein. In some embodiments, the patient's response is monitored over a period of days, weeks, months or years during or after the continuous administration of a compound, such as a compound of Formula (I) or a form thereof as described herein.

In another specific embodiment, provided herein is a method for monitoring an SMA patient's response to a compound, comprising: (a) administering a compound to an SMA patient; (b) contacting a sample (e.g., blood sample or tissue sample) obtained or derived from the patient with a forward SMN primer described below (e.g., SEQ ID NO. 11 or 13) and/or a reverse SMN primer described herein (e.g., SEQ ID NO. 9 or 12) along with applicable components for, e.g., RT-PCR (e.g., endpoint RT-PCR and/or RT-qPCR), PCR (e.g., qPCR), or rolling circle amplification; and (c) detecting the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 and the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2, wherein (1)(i) an increase in the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 in the patient sample relative to the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 in an analogous sample (e.g., from the same type of tissue sample) from the patient prior to administration of the compound or a certain number of doses of the compound, or a certain earlier date, and (ii) a decrease in the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2 in the patient sample relative to the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2 in an analogous sample (e.g., from the same type of tissue sample) from the patient prior to administration of the compound or a certain number of doses of the compound, or a certain earlier date, indicate that the patient is responsive to the compound and that the compound may be or is beneficial and/or of therapeutic value to the patient; and (2)(i) no change or no substantial change in the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 in the patient sample relative to the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 in an analogous sample (e.g., the same type of tissue sample) from the patient prior to administration of the compound or a certain number of doses of the compound, or a certain earlier date, and (ii) no change or no substantial change in the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2 in the patient sample relative to the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2 in an analogous sample (e.g., the same type of tissue sample) from the patient prior to administration of the compound or a certain number of doses of the compound, or a certain earlier date, indicate that the patient is not responsive to the compound and that the compound is not beneficial and/or of therapeutic value to the patient. In certain embodiments, the patient's response is monitored 1 hour, 2 hours, 4 hours, 8 hours, 12 hours, 16 hours, 20 hours, 1 day, 2 days, 3 days, 4 days, 5 days, 7 days, 14 days, 28 days, 1 month, 2 months, 3 months, 6 months, 9 months, 12 months or more after administration of a compound, such as a compound of Formula (I) or a form thereof as described herein. In some embodiments, the patient's response is monitored after the patient has received 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more doses of a compound, such as a compound of Formula (I) or a form thereof as described herein. In some embodiments, the patient's response is monitored after the administration of 1-5, 5-10, 10-15, 15-20, 20-30, 30-40, 40-50, or 50-100 doses of a compound, such as a compound of Formula (I) or a form thereof as described herein. In some embodiments, the patient's response is monitored over a period of days, weeks, months or years during or after the continuous administration of a compound, such as a compound of Formula (I) or a form thereof as described herein.

›TERMINOLOGY · 36 of 40

In a specific embodiment, provided herein is a method for monitoring an SMA patient's response to a compound, comprising: (a) contacting an SMA patient sample (e.g., blood sample or tissue sample) or a sample derived from an SMA patient (e.g., a blood sample or tissue sample that has been processed to extract RNA) with an SMN probe (e.g., SEQ ID NO. 10) along with applicable components for, e.g., RT-PCR (e.g., endpoint RT-PCR and/or RT-qPCR), PCR (e.g., qPCR) or rolling circle amplification, wherein the sample is from or derived from an SMA patient administered a compound (e.g., a compound of Formula (I) or a form thereof as described herein); and (b) detecting the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 and the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2, wherein (1)(i) an increase in the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 in the patient sample relative to the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of S SMN1 and/or MN2 in an analogous sample (e.g., from the same type of tissue sample) from the patient prior to administration of the compound or a certain number of doses of the compound, or a certain earlier date, and (ii) a decrease in the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2 in the patient sample relative to the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2 in an analogous sample (e.g., from the same type of tissue sample) from the patient prior to administration of the compound or a certain number of doses of the compound, or a certain earlier date, indicate that the patient is responsive to the compound and that the compound may be or is beneficial and/or of therapeutic value to the patient; and (2)(i) no change or no substantial change in the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 in the patient sample relative to the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 in an analogous sample (e.g., the same type of tissue sample) from the patient prior to administration of the compound or a certain number of doses of the compound, or a certain earlier date, and (ii) no change or no substantial change in the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2 in the patient sample relative to the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2 in an analogous sample (e.g., the same type of tissue sample) from the patient prior to administration of the compound or a certain number of doses of the compound, or a certain earlier date, indicate that the patient is not responsive to the compound and that the compound is not beneficial and/or of therapeutic value to the patient. In certain embodiments, the patient's response is monitored 1 hour, 2 hours, 4 hours, 8 hours, 12 hours, 16 hours, 20 hours, 1 day, 2 days, 3 days, 4 days, 5 days, 7 days, 14 days, 28 days, 1 month, 2 months, 3 months, 6 months, 9 months, 12 months or more after administration of a compound, such as a compound of Formula (I) or a form thereof as described herein. In some embodiments, the patient's response is monitored after the patient has received 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more doses of a compound, such as a compound of Formula (I) or a form thereof as described herein. In some embodiments, the patient's response is monitored after the administration of 1-5, 5-10, 10-15, 15-20, 20-30, 30-40, 40-50, or 50-100 doses of a compound, such as a compound of Formula (I) or a form thereof as described herein. In some embodiments, the patient's response is monitored over a period of days, weeks, months or years during or after the continuous administration of a compound, such as a compound of Formula (I) or a form thereof as described herein.

In another specific embodiment, provided herein is a method for monitoring an SMA patient's response to a compound, comprising: (a) administering a compound to an SMA patient; (b) contacting a sample (e.g., blood sample or tissue sample) obtained or derived from the patient with an SMN probe (e.g., SEQ ID NO. 10) along with applicable components for, e.g., RT-PCR (e.g., endpoint RT-PCR and/or RT-qPCR), PCR (e.g., qPCR) or rolling circle amplification; and (c) detecting the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 and the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2, wherein (1)(i) an increase in the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 in the patient sample relative to the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 in an analogous sample (e.g., from the same type of tissue sample) from the patient prior to administration of the compound or a certain number of doses of the compound, or a certain earlier date, and (ii) a decrease in the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2 in the patient sample relative to the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2 in an analogous sample (e.g., from the same type of tissue sample) from the patient prior to administration of the compound or a certain number of doses of the compound, or a certain earlier date, indicate that the patient is responsive to the compound and that the compound may be or is beneficial and/or of therapeutic value to the patient; and (2)(i) no change or no substantial change in the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 in the patient sample relative to the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 in an analogous sample (e.g., the same type of tissue sample) from the patient prior to administration of the compound or a certain number of doses of the compound, or a certain earlier date, and (ii) no change or no substantial change in the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2 in the patient sample relative to the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2 in an analogous sample (e.g., the same type of tissue sample) from the patient prior to administration of the compound or a certain number of doses of the compound, or a certain earlier date, indicate that the patient is not responsive to the compound and that the compound is not beneficial and/or of therapeutic value to the patient. In certain embodiments, the patient's response is monitored 1 hour, 2 hours, 4 hours, 8 hours, 12 hours, 16 hours, 20 hours, 1 day, 2 days, 3 days, 4 days, 5 days, 7 days, 14 days, 28 days, 1 month, 2 months, 3 months, 6 months, 9 months, 12 months or more after administration of a compound, such as a compound of Formula (I) or a form thereof as described herein. In some embodiments, the patient's response is monitored after the patient has received 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more doses of a compound, such as a compound of Formula (I) or a form thereof as described herein. In some embodiments, the patient's response is monitored after the administration of 1-5, 5-10, 10-15, 15-20, 20-30, 30-40, 40-50, or 50-100 doses of a compound, such as a compound of Formula (I) or a form thereof as described herein. In some embodiments, the patient's response is monitored over a period of days, weeks, months or years during or after the continuous administration of a compound, such as a compound of Formula (I) or a form thereof as described herein.

›TERMINOLOGY · 37 of 40

In a specific embodiment, provided herein is a method for monitoring an SMA patient's response to a compound, comprising: (a) contacting an SMA patient sample (e.g., blood sample or tissue sample) or a sample derived from an SMA patient (e.g., a blood sample or tissue sample that has been processed to extract RNA) with a forward SMN primer described below (e.g., SEQ ID NO. 11 or 13) and/or a reverse SMN primer described herein (e.g., SEQ ID NO. 9 or 12) and/or an SMN probe (SEQ ID NO. 10) along with applicable components for, e.g., RT-PCR (e.g., endpoint RT-PCR and/or RT-qPCR), PCR (e.g., qPCR) or rolling circle amplification, wherein the sample is from or derived from an SMA patient administered a compound (e.g., a compound of Formula (I) or a form thereof as described herein); and (b) detecting the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 and the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2, wherein (1)(i) an increase in the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 in the patient sample relative to the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN2 in an analogous sample (e.g., from the same type of tissue sample) from the patient prior to administration of the compound or a certain number of doses of the compound, or a certain earlier date, and (ii) a decrease in the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2 in the patient sample relative to the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2 in an analogous sample (e.g., from the same type of tissue sample) from the patient prior to administration of the compound or a certain number of doses of the compound, or a certain earlier date, indicate that the patient is responsive to the compound and that the compound may be or is beneficial and/or of therapeutic value to the patient; and (2)(i) no change or no substantial change in the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 in the patient sample relative to the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 in an analogous sample (e.g., the same type of tissue sample) from the patient prior to administration of the compound or a certain number of doses of the compound, or a certain earlier date, and (ii) no change or no substantial change in the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2 in the patient sample relative to the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2 in an analogous sample (e.g., the same type of tissue sample) from the patient prior to administration of the compound or a certain number of doses of the compound, or a certain earlier date, indicate that the patient is not responsive to the compound and that the compound is not beneficial and/or of therapeutic value to the patient. In certain embodiments, the patient's response is monitored 1 hour, 2 hours, 4 hours, 8 hours, 12 hours, 16 hours, 20 hours, 1 day, 2 days, 3 days, 4 days, 5 days, 7 days, 14 days, 28 days, 1 month, 2 months, 3 months, 6 months, 9 months, 12 months or more after administration of a compound, such as a compound of Formula (I) or a form thereof as described herein. In some embodiments, the patient's response is monitored after the patient has received 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more doses of a compound, such as a compound of Formula (I) or a form thereof as described herein. In some embodiments, the patient's response is monitored after the administration of 1-5, 5-10, 10-15, 15-20, 20-30, 30-40, 40-50, or 50-100 doses of a compound, such as a compound of Formula (I) or a form thereof as described herein. In some embodiments, the patient's response is monitored over a period of days, weeks, months or years during or after the continuous administration of a compound, such as a compound of Formula (I) or a form thereof as described herein.

In another specific embodiment, provided herein is a method for monitoring an SMA patient's response to a compound, comprising: (a) administering a compound to an SMA patient; (b) contacting a sample (e.g., blood sample or tissue sample) obtained or derived from the patient with a forward SMN primer described below (e.g., SEQ ID NO. 11 or 13) and/or a reverse SMN primer described herein (e.g., SEQ ID NO. 9 or 12) and/or an SMN probe (SEQ ID NO. 10) along with applicable components for, e.g., RT-PCR (e.g., endpoint RT-PCR and/or RT-qPCR), PCR (e.g., qPCR) or rolling circle amplification; and (c) detecting the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 and the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2, wherein (1)(i) an increase in the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 in the patient sample relative to the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 in an analogous sample (e.g., from the same type of tissue sample) from the patient prior to administration of the compound or a certain number of doses of the compound, or a certain earlier date, and (ii) a decrease in the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2 in the patient sample relative to the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2 in an analogous sample (e.g., from the same type of tissue sample) from the patient prior to administration of the compound or a certain number of doses of the compound, or a certain earlier date, indicate that the patient is responsive to the compound and that the compound may be or is beneficial and/or of therapeutic value to the patient; and (2)(i) no change or no substantial change in the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 in the patient sample relative to the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 in an analogous sample (e.g., the same type of tissue sample) from the patient prior to administration of the compound or a certain number of doses of the compound, or a certain earlier date, and (ii) no change or no substantial change in the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2 in the patient sample relative to the amount of mRNA that is transcribed from the SMN2 gene and does not include exon 7 of SMN1 and/or SMN2 in an analogous sample (e.g., the same type of tissue sample) from the patient prior to administration of the compound or a certain number of doses of the compound, or a certain earlier date, indicate that the patient is not responsive to the compound and that the compound is not beneficial and/or of therapeutic value to the patient. In certain embodiments, the patient's response is monitored 1 hour, 2 hours, 4 hours, 8 hours, 12 hours, 16 hours, 20 hours, 1 day, 2 days, 3 days, 4 days, 5 days, 7 days, 14 days, 28 days, 1 month, 2 months, 3 months, 6 months, 9 months, 12 months or more after administration of a compound, such as a compound of Formula (I) or a form thereof as described herein. In some embodiments, the patient's response is monitored after the patient has received 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more doses of a compound, such as a compound of Formula (I) or a form thereof as described herein. In some embodiments, the patient's response is monitored after the administration of 1-5, 5-10, 10-15, 15-20, 20-30, 30-40, 40-50, or 50-100 doses of a compound, such as a compound of Formula (I) or a form thereof as described herein. In some embodiments, the patient's response is monitored over a period of days, weeks, months or years during or after the continuous administration of a compound, such as a compound of Formula (I) or a form thereof as described herein.

›TERMINOLOGY · 38 of 40

In specific embodiments, SMA in a patient is caused by an inactivating mutation or deletion in the SMN1 gene on both chromosomes, resulting in a loss of SMN1 gene function.

Kits

In one aspect, provided herein are pharmaceutical or assay kits comprising an SMN primer or probe described herein, in one or more containers, and instructions for use. In one embodiment, a pharmaceutical or assay kit comprises, in a container, one or more SMN reverse primers (e.g., SEQ ID NO. 2, 9 and/or 12) and/or one or more SMN forward primers (SEQ ID NO. 1, 7, 8, 11 and/or 13)) and instructions for use. In another embodiment, a pharmaceutical or assay kit comprises, in one container, an SMN reverse primer (e.g., SEQ ID NO. 2, 9 or 12), an SMN forward primer (SEQ ID NO. 1, 7, 8, 11 or 13)) and instructions for use.

In one embodiment, a pharmaceutical or assay kit comprises, in separate containers, one SMN reverse primer (e.g., SEQ ID NO. 2, 9 or 12) in one container, another SMN forward primer (e.g., SEQ ID NO. 1, 7, 8, 11 or 13)) in another container, and instructions for use.

In certain embodiments, applicable components needed for a PCR (e.g., qPCR), RT-PCR (e.g., endpoint RT-PCR and/or RT-qPCR) or rolling circle amplification, such as polymerase, deoxynucleoside triphosphates, etc., are included in such kits. In some embodiments, components needed for hybridization are included in such kits. A pharmaceutical or assay kit containing such primers can be used in PCR and RT-PCR to, e.g.: (i) assess whether a therapeutic agent (e.g., a compound of Formula (I) or a form thereof) enhances inclusion of exon 7 of SMN1 and/or SMN2 into mRNA that is transcribed from the SMN1 and/or SMN2 gene, (ii) monitor the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 of SMN1 and/or SMN2 and the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2, and/or (iii) monitor a subject's response to a therapeutic agent (e.g., a compound of Formula (I) or a form thereof). In other embodiments, the subject is a human subject. In other embodiments, the human subject is a human patient. In certain other embodiments, the human patient is a human SMA patient.

In a specific embodiment, a pharmaceutical or assay kit comprises the forward primer with the sequence found in SEQ ID NO. 1, in a container, and the reverse primer with the sequence found in SEQ ID NO. 2, in another container. In certain embodiments, these primers are used in RT-PCR (e.g., endpoint RT-PCR and/or RT-qPCR), PCR (e.g., qPCR) or rolling circle amplification for amplifying nucleotide sequences encoded by a human SMN1 minigene or human SMN2 minigene, such as described those described herein or in International Publication No. WO 2009/151546 or U.S. Patent Application Publication No. 2011/0086833, each of which is incorporated herein by reference in its entirety. In other embodiments, these primers are used as probes in, e.g., hybridization assays, such as Southern blot or Northern blot.

In a specific embodiment, a pharmaceutical or assay kit comprises the forward primer with the nucleotide sequence found in SEQ ID NO. 7, in a container, and the reverse primer with the nucleotide sequence found in SEQ ID NO. 9, in another container. In certain embodiments, these primers are used in RT-PCR (e.g., endpoint RT-PCR and/or RT-qPCR), PCR (e.g., qPCR) or rolling circle amplification for amplifying nucleotide sequences encoded by endogenous human SMN1 and SMN2 genes. In other embodiments, these primers are used as probes in, e.g., hybridization assays, such as Southern blot or Northern blot.

In another specific embodiment, a pharmaceutical or assay kit comprises the forward primer with the nucleotide sequence found in SEQ ID NO. 8, in a container, and the reverse primer with the nucleotide sequence found in SEQ ID NO. 9, in another container. In certain embodiments, these primers are used in RT-PCR (e.g., endpoint RT-PCR and/or RT-qPCR), PCR (e.g., qPCR) or rolling circle amplification for amplifying nucleotide sequences encoded by the endogenous human SMN2 gene. In other embodiments, these primers are used as probes in, e.g., hybridization assays, such as Southern blot or Northern blot.

In a specific embodiment, a pharmaceutical or assay kit comprises the forward primer with the nucleotide sequence found in SEQ ID NO. 7, in a container, the forward primer with the nucleotide sequence found in SEQ ID NO. 8, in another container, and the reverse primer with the nucleotide sequence found in SEQ ID NO. 9, in another container. In certain embodiments, these primers are used in RT-PCR (e.g., endpoint RT-PCR and/or RT-qPCR), PCR (e.g., qPCR) or rolling circle amplification for amplifying nucleotide sequences encoded by endogenous human SMN1 and SMN2 genes. In other embodiments, these primers are used as probes in, e.g., hybridization assays, such as Southern blot or Northern blot.

In a specific embodiment, a pharmaceutical or assay kit comprises the forward primer with the nucleotide sequence found in SEQ ID NO. 11, in a container, and the reverse primer with the nucleotide sequence found in SEQ ID NO. 12, in another container. In certain embodiments, these primers are used in RT-PCR (e.g., endpoint RT-PCR and/or RT-qPCR), PCR (e.g., qPCR) or rolling circle amplification for amplifying nucleotide sequences encoded by endogenous human SMN1 and SMN2 genes. In other embodiments, these primers are used as probes in, e.g., hybridization assays, such as Southern blot or Northern blot.

In a specific embodiment, a pharmaceutical or assay kit comprises the forward primer with the nucleotide sequence found in SEQ ID NO. 11, in a container, and the reverse primer with the nucleotide sequence found in SEQ ID NO. 9, in another container. In certain embodiments, these primers are used in RT-PCR (e.g., endpoint RT-PCR and/or RT-qPCR), PCR (e.g., qPCR) or rolling circle amplification for amplifying nucleotide sequences encoded by endogenous human SMN1 and SMN2 genes. In other embodiments, these primers are used as probes in, e.g., hybridization assays, such as Southern blot or Northern blot.

›TERMINOLOGY · 39 of 40

In a specific embodiment, a pharmaceutical or assay kit comprises the forward primer with the nucleotide sequence found in SEQ ID NO. 13, in a container, and the reverse primer with the nucleotide sequence found in SEQ ID NO. 12, in another container. In certain embodiments, these primers are used in RT-PCR (e.g., endpoint RT-PCR and/or RT-qPCR), PCR (e.g., qPCR) or rolling circle amplification for amplifying nucleotide sequences encoded by endogenous human SMN1 and SMN2 genes. In other embodiments, these primers are used as probes in, e.g., hybridization assays, such as Southern blot or Northern blot.

In a specific embodiment, a pharmaceutical or assay kit comprises the forward primer with the nucleotide sequence found in SEQ ID NO. 13, in a container, and the reverse primer with the nucleotide sequence found in SEQ ID NO. 9, in another container. In certain embodiments, these primers are used in RT-PCR (e.g., endpoint RT-PCR and/or RT-qPCR), PCR (e.g., qPCR) or rolling circle amplification for amplifying nucleotide sequences encoded by endogenous human SMN1 and SMN2 genes. In other embodiments, these primers are used as probes in, e.g., hybridization assays, such as Southern blot or Northern blot.

In a specific embodiment, a pharmaceutical or assay kit comprises the forward primer with the nucleotide sequence found in SEQ ID NO. 1, in a container, and the reverse primer with the nucleotide sequence found in SEQ ID NO. 9, in another container. In certain embodiments, these primers are used in RT-PCR (e.g., endpoint RT-PCR and/or RT-qPCR), PCR (e.g., qPCR) or rolling circle amplification for amplifying nucleotide sequences encoded by endogenous human SMN1 and SMN2 genes. In other embodiments, these primers are used as probes in, e.g., hybridization assays, such as Southern blot or Northern blot.

In a specific embodiment, a pharmaceutical or assay kit comprises the forward primer with the nucleotide sequence found in SEQ ID NO. 1, in a container, and the reverse primer with the nucleotide sequence found in SEQ ID NO. 12, in another container. In certain embodiments, these primers are used in RT-PCR (e.g., endpoint RT-PCR and/or RT-qPCR), PCR (e.g., qPCR) or rolling circle amplification for amplifying nucleotide sequences encoded by endogenous human SMN1 and SMN2 genes. In other embodiments, these primers are used as probes in, e.g., hybridization assays, such as Southern blot or Northern blot.

In another embodiment, a pharmaceutical or assay kit comprises an SMN probe described herein (e.g., SEQ ID NO. 3 or 10), in one container. In other embodiments, the probe is used in, e.g., a hybridization assay, such as a Southern blot or Northern blot. In a specific embodiment, the probe is used in RT-qPCR or qPCR. In certain embodiments, components needed for a PCR (e.g., qPCR), RT-PCR (e.g., endpoint RT-PCR and/or RT-qPCR) or rolling circle amplification, such as polymerase, deoxynucleoside triphosphates, primers, etc., are included in such kits. In some embodiments, components needed for hybridization are included in such kits.

In one embodiment, a pharmaceutical or assay kit comprises an SMN reverse primer (e.g., SEQ ID NO. 2, 9 or 12) in one container, an SMN forward primer (e.g., SEQ ID NO. 1, 7, 8, 11 or 13) in another container, and an SMN probe (e.g., SEQ ID NO. 3 or 10) in another container, and instructions for use. In another embodiment, a pharmaceutical or assay kit comprises one or more SMN reverse primers (e.g., SEQ ID NO. 2, 9 and/or 12) in one container, one or more SMN forward primers (e.g., SEQ ID NO. 1, 7, 8, 11 and/or 13) in another container, and one or more SMN probe (e.g., SEQ ID NO. 3 and/or 10) in another container, and instructions for use.

In certain embodiments, components needed to run a PCR, RT-PCR or rolling circle amplification, such as polymerase, deoxynucleoside triphosphates, etc., are included in such kits. A pharmaceutical or assay kit containing such probes and/or primers can be used in PCR and RT-PCR to, e.g.: (i) assess whether a therapeutic agent (e.g., a compound of Formula (I) or a form thereof) enhances inclusion of exon 7 of SMN1 and/or SMN2 into mRNA that is transcribed from the SMN1 and/or SMN2 gene, (ii) monitor the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and includes exon 7 and the amount of mRNA that is transcribed from the SMN1 and/or SMN2 gene and does not include exon 7 of SMN1 and/or SMN2, and/or (iii) monitor a subject's response to a therapeutic agent (e.g., a compound of Formula (I) or a form thereof). In other embodiments, the subject is a human subject. In other embodiments, the human subject is a human patient. In certain other embodiments, the human patient is a human SMA patient.

In another aspect, provided herein is a pharmaceutical kit comprising a compound of Formula (I) or a form thereof, in a container, and instructions for use of the compound or form thereof. In a specific embodiment, provided herein is a pharmaceutical kit comprising a pharmaceutical composition comprising a compound of Formula (I) or a form thereof and a pharmaceutically acceptable carrier, excipient or diluent, and instructions for use. In another specific embodiment, provided herein is a pharmaceutical kit comprising a pharmaceutical composition comprising an effective amount of a compound of Formula (I) or a form thereof and a pharmaceutically acceptable carrier, excipient or diluent, and instructions for use. In one embodiment, the instructions for use explain one, two or more of the following: the dose, route of administration, frequency of administration and side effects of administration of a compound of Formula (I) or a form thereof to a subject. In other embodiments, the subject is a human subject. In other embodiments, the human subject is a human patient. In certain other embodiments, the human patient is a human SMA patient.

As disclosed herein, general methods for preparing the compounds of Formula (I) or a form thereof as described herein are available via standard, well-known synthetic methodology. Many of the starting materials are commercially available or, when not available, can be prepared using the routes described below using techniques known to those skilled in the art. The synthetic schemes provided herein comprise multiple reaction steps, each of which is intended to stand on its own and can be carried out with or without any preceding or succeeding step(s). In other words, each of the individual reaction steps of the synthetic schemes provided herein in isolation is contemplated.

›TERMINOLOGY · 40 of 40

General Synthetic Methods

›Scheme A

Compounds of Formula (I), wherein R 2 is a monocyclic or bicyclic aryl, heterocyclyl or heteroaryl ring system, may be prepared as described in Scheme A below.

Methyl ketone Compound A1 is reacted with dialkyl carbonate Compound A1a (where R x is C 1-4 alkyl and the like) in the presence of a base (such as NaH and the like) in a suitable solvent (such as THF and the like) to provide Compound A3. Alternatively, ester Compound A2 is reacted with acetic acid ester Compound A2a (where R y is C 1-4 alkyl and the like) in the presence of a base (such as LDA and the like) in a suitable solvent (such as THF and the like) to provide Compound A3. Compound A3 is further reacted in the presence of an alcohol (such as MeOH and the like) and an acid catalyst (such as p-TsOH and the like) to provide acetal Compound A4 (where R z is C 1-4 alkyl and the like). Either Compound A3 or Compound A4 is reacted with Compound A5 (where X represents various reactive groups, which may be used to provide a plurality of R 1 functional group substituents by reacting suitable starting materials with Compound A5 or Compound A6 using techniques known to a person of ordinary skill in the art) in the presence of an acid (such as PPA, p-TsOH and the like) and a suitable solvent (such as DMA and the like) to afford Compound A6.

›Scheme B

Compounds of Formula (I), wherein R 2 is a monocyclic or bicyclic heterocyclyl or heteroaryl ring system, may be prepared as described in Scheme B below.

Compound B1 is reacted with Compound B2, an optionally substituted heterocyclyl or heteroaryl ring system (wherein the term “Het” refers to an amidine-like moiety such as, but not limited to, 2-aminopyridine, 2-aminopyrimidine, 2-aminopyrazine, 3-aminopyridazine, 2-aminothiazole, 4-aminothiazole, 4-aminopyrimidine and the like), in a suitable solvent (such as MeOH and the like) to provide Compound B3. Compound B3 is reacted with acetic acid ester Compound A2a (where R y is C 1-4 alkyl and the like) in the presence of a base (such as LDA and the like) in a suitable solvent (such as THF and the like) to afford Compound B4. Compound B4 is reacted with Compound A5 in the presence of an acid (such as PPA, p-TsOH and the like) and a suitable solvent (such as DMA and the like) to afford Compound B5.

›Scheme C

Compounds of Formula (I), wherein R 2 is a monocyclic or bicyclic heteroaryl ring system, may be prepared as described in Scheme C below.

A 2,4-diester pyrazole Compound C1 is reacted with an α-chloro ketone Compound C2 in the presence of a base (such as K 2 CO 3 and the like) and a suitable solvent (such as acetone and the like) to afford Compound C3. Compound C3 is treated with ammonium acetate in a suitable solvent (such as AcOH and the like) to provide Compound C4. Compound C4 is treated with a chlorinating reagent (such as POCl 3 and the like) to provide Compound C5. Compound C5 is reacted with an alkyl boronic acid (where Z is B(OH) 2 and R z is C 1-4 alkyl and the like) or an alkyl boronic acid ester (where Z is B 2 (pin) 2 also referred to as bis(pinacolato)diboron and R z is C 1-4 alkyl and the like) in the presence of a catalyst (such as Pd(dppf)Cl 2 and the like) and a base (such as K 2 CO 3 and the like) in a suitable solvent (such as DMF and the like), undergoing Suzuki cross coupling to give Compound C6. Compound C6 is reacted with acetic acid ester Compound A2a (where R y is C 1-4 alkyl and the like) in the presence of a base (such as LDA and the like) in a suitable solvent (such as THF and the like) to afford Compound C7. Compound C7 is reacted with Compound A5 in the presence of an acid (such as p-TsOH, PPTs and the like) and a suitable solvent to afford Compound C8.

›Scheme D

Compounds of Formula (I), wherein R 2 is a monocyclic or bicyclic aryl or heteroaryl ring system, may be prepared as described in Scheme D below.

Compound A5 is reacted with malonic ester Compound D1 (where R w is C 1-4 alkyl, 2,4,6-trichlorophenyl and the like) to afford Compound D2. Compound D2 is treated with a chlorinating reagent (such as POCl 3 and the like) to provide Compound D3. Compound D3 is reacted with an R 2 substituted alkyl boronic acid (where Z is B(OH) 2 ) or an alkyl boronic acid ester (where Z is B 2 (pin) 2 ), wherein R 2 is aryl or heteroaryl, in the presence of a catalyst (such as Pd(dppf)Cl 2 and the like) and a base (such as K 2 CO 3 and the like) in a suitable solvent (such as DMF and the like), undergoing Suzuki cross coupling to give Compound A6.

›Scheme E

Compounds of Formula (I), wherein R 2 is a monocyclic or bicyclic heteroaryl ring system, may be prepared as described in Scheme E below.

Compound E1 is reacted with Compound D3 in the presence of a catalyst (such as Pd(dppf)Cl 2 and the like) and a base (such as K 2 CO 3 and the like) in a suitable solvent (such as DMF and the like), undergoing Suzuki cross coupling to give Compound E2. Compound E2 is reacted with Compound C2 in a suitable solvent (such as DMSO and the like) to afford Compound E3.

›Scheme F

Compounds of Formula (I), wherein R 2 is a monocyclic or bicyclic heteroaryl ring system, may be prepared as described in Scheme F below.

An optionally substituted 2-aminopyridine Compound F1 is reacted with a brominating reagent (such as Br 2 and NBS and the like) to provide Compound F2. Compound F2 is reacted with Compound C2 in a suitable solvent (such as DMSO and the like) to afford Compound F3. Compound F3 is reacted with Compound F3a in the presence of a catalyst (such as Pd(dppf)Cl 2 and the like) and a base (such as KOAc and the like) in a suitable solvent (such as acetonitrile and the like) to provide Compound F4. Compound F4 is reacted with Compound D3 in the presence of a catalyst (such as Pd(dppf)Cl 2 and the like) and a base (such as K 2 CO 3 and the like) in a suitable solvent (such as DMF and the like), undergoing Suzuki cross coupling to give Compound F5.

›Scheme G

Compounds of Formula (I), wherein R 2 is a monocyclic or bicyclic heteroaryl ring system, may be prepared as described in Scheme G below.

An optionally substituted azole Compound G1 (wherein the term “Het” refers to the azole ring system optionally further containing one, two or three additional nitrogen ring members where allowed by available valences) is reacted with Compound D3 in a suitable solvent (such as DMSO and the like) to provide Compound G2.

›Scheme H

Compounds of Formula (I), wherein R 2 is a monocyclic or bicyclic aryl, heterocyclyl or heteroaryl ring system, may be prepared as described in Scheme H below.

Compound H1 (where R 2 is a monocyclic or bicyclic aryl, heterocyclyl or heteroaryl ring system) is reacted with Bredereck's reagent Compound H2 (or DMF-DMA and the like) to form Compound H3. Compound H3 is reacted with Compound H4 (where X represents various reactive groups, which may be used to provide a plurality of R 1 functional group substituents by reacting suitable starting materials with Compound H4 or Compound H5 using techniques known to a person of ordinary skill in the art) to provide Compound H5.

›Scheme I

Compounds of Formula (I), wherein R 2 is a monocyclic or bicyclic aryl or heteroaryl ring system, may be prepared as described in Scheme I below.

Compound D3 (where X is bromo and the like) is reacted with an R 2 substituted alkyl boronic acid (where Z is B(OH) 2 ) or an alkyl boronic acid ester (where Z is B 2 (pin) 2 ), wherein R 2 is a monocyclic or bicyclic aryl or heteroaryl ring system and the like, in the presence of a catalyst (such as Pd(dppf)Cl 2 and the like) and a base (such as K 2 CO 3 and the like) in a suitable solvent (such as DMF and the like), undergoing Suzuki cross coupling to provide Compound I1. Compound I1 is reacted with R 1 —H (wherein R 1 contains a nucleophilic amino or hydroxyl group and the like) in a suitable solvent (such as DMSO and the like) to provide Compound I3.

Compound I1 may also be reacted with an R 1 substituted alkyl boronic acid (where Z is B(OH) 2 ) or an alkyl boronic acid ester (where Z is B 2 (pin) 2 ) in the presence of a palladium catalyst (such as Pd(dppf)Cl 2 and the like) and a base (such as K 2 CO 3 and the like) in a suitable solvent (such as DMF and the like) undergoing Suzuki coupling to provide Compound I3.

Alternatively, Compound D3 (where X is bromo and the like) may be reacted with R 1 —H (wherein R 1 contains a nucleophilic amino or hydroxyl group and the like) in a suitable solvent (such as DMSO and the like) to provide Compound I2. Compound I2 is reacted with an R 2 substituted alkyl boronic acid (where Z is B(OH) 2 ) or an alkyl boronic acid ester (where Z is B 2 (pin) 2 ) in the presence of a catalyst (such as Pd(dppf)Cl 2 and the like) and a base (such as K 2 CO 3 and the like) in a suitable solvent (such as DMF and the like), undergoing Suzuki cross coupling to give Compound I3.

›Scheme J

Compounds of Formula (I), wherein R 2 is a monocyclic or bicyclic aryl, heterocyclyl or heteroaryl ring system, may be prepared as described in Scheme J below.

Compound J1 (where R 2 is a monocyclic or bicyclic aryl, heterocyclyl or heteroaryl ring system) is reacted with malonic ester Compound D1 in the presence of a base (such as TEA or DIEA and the like), a Lewis acid (such as MgCl 2 and the like) and a suitable solvent (such as ACN and the like) to provide Compound J2. Compound J2 is treated with a chlorinating reagent (such as POCl 3 and the like) in the presence of a base (such as Hünig's base and the like) to provide Compound J3.

Compound J3 is reacted with Compound J4 (where X represents various reactive groups, which may be used to provide a plurality of R 1 functional group substituents by reacting suitable starting materials with Compound J4, Compound J5 or Compound J6 using techniques known to a person of ordinary skill in the art) in the presence of a base (such as NaH and the like) and a suitable solvent (such as DMF and the like) to afford Compound J5. The carboxylic ester groups of Compound J5 may be hydrolyzed and decarboxylated under acidic conditions (such as TFA and the like) in a suitable solvent (such as water and the like) to give Compound J6.

Compound J7 (where X represents various reactive groups, which may be used to provide a plurality of R 1 functional group substituents by reacting suitable starting materials with Compound J7, Compound J8 or Compound J4 using techniques known to a person of ordinary skill in the art) is reacted with malonic diester Compound D1 the presence of a base (such as Cs 2 CO 3 and the like), a metal catalyst (such as CuI and the like) and a ligand (such as 2-nicotinic acid and the like) in the presence of a suitable solvent (such as 1,4-dioxane and the like) to afford the diester Compound J8. The carboxylic ester groups of Compound J8 may be hydrolyzed using a base (such as NaOH and the like) in a suitable solvent system (such as MeOH and water and the like), then decarboxylated and acidified using an acid (such as HCl and the like) in a suitable solvent (such as water and the like) to give Compound J4.

›SPECIFIC SYNTHETIC EXAMPLES

To describe in more detail and assist in understanding, the following non-limiting examples are offered to more fully illustrate the scope of compounds described herein and are not to be construed as specifically limiting the scope thereof. Such variations of the compounds described herein that may be now known or later developed, which would be within the purview of one skilled in the art to ascertain, are considered to fall within the scope of the compounds as described herein and hereinafter claimed. These examples illustrate the preparation of certain compounds. Those of skill in the art will understand that the techniques described in these examples represent techniques, as described by those of ordinary skill in the art, that function well in synthetic practice, and as such constitute preferred modes for the practice thereof. However, it should be appreciated that those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific methods that are disclosed and still obtain a like or similar result without departing from the spirit and scope of the present description.

Other than in the following examples of the embodied compounds, unless indicated to the contrary, all numbers expressing quantities of ingredients, reaction conditions, experimental data, and so forth used in the specification and claims are to be understood as being modified by the term “about”. Accordingly, all such numbers represent approximations that may vary depending upon the desired properties sought to be obtained by a reaction or as a result of variable experimental conditions. Therefore, within an expected range of experimental reproducibility, the term “about” in the context of the resulting data, refers to a range for data provided that may vary according to a standard deviation from the mean. As well, for experimental results provided, the resulting data may be rounded up or down to present data consistently, without loss of significant figures. At the very least, and not as an attempt to limit the application of the doctrine of equivalents to the scope of the claims, each numerical parameter should be construed in light of the number of significant digits and rounding techniques used by those of skill in the art.

While the numerical ranges and parameters setting forth the broad scope of the present description are approximations, the numerical values set forth in the examples set forth below are reported as precisely as possible. Any numerical value, however, inherently contains certain errors necessarily resulting from the standard deviation found in their respective testing measurements.

Compound Examples

As used above, and throughout the present description, the following abbreviations, unless otherwise indicated, shall be understood to have the following meanings:

›Examples44

›Example 1

Preparation of Cpd 72

Step A: 3′-Fluoro-4′-methoxyacetophenone (336 mg, 2 mmol) was dissolved in THF (4 mL). To the solution was added dimethyl carbonate (0.42 mL, 5 mmol) and sodium hydride (200 mg, 5 mmol, 60% dispersion in mineral oil) sequentially. The mixture was heated to 60° C. for 30 minutes. After cooling the mixture to 0° C., the remaining sodium hydride was quenched with 1N aqueous HCl (20 mL). The mixture was extracted with EtOAc (20 mL). The organic layer was washed with brine, dried over Na 2 SO 4 , filtered and concentrated. The residue was eluted from silica gel with EtOAc (25%) in hexanes, affording methyl 3-(3-fluoro-4-methoxyphenyl)-3-oxopropanoate as a pale yellow oil (405 mg, 89%). MS m/z 227.2 [M+H] + ; 1 H NMR (CDCl 3 , 500 MHz): δ 7.76 (1H, dd, J=8.6 Hz, 2.1 Hz), 7.72 (1H, dd, J=11.7 Hz, 2.2 Hz), 7.04 (1H, t, J=8.4 Hz), 3.99 (3H, s), 3.97 (2H, s), 3.78 (3H, s).

Step B: methyl 3-(3-fluoro-4-methoxyphenyl)-3-oxopropanoate (405 mg, 1.8 mmol) was dissolved in methanol (1 mL). p-Toluenesulfonic acid monohydrate (17 mg, 0.09 mmol) was added to the solution, followed by trimethylorthoformate (0.30 mL, 2.7 mmol). The solution was stirred at 60° C. for 1 hour. Volatiles were removed with a stream of nitrogen providing crude methyl 3-(3-fluoro-4-methoxyphenyl)-3,3-dimethoxypropanoate. 1 H NMR (DMSO-d 6 , 500 MHz): δ 7.18-7.15 (3H, m), 3.85 (3H, s), 3.38 (3H, s), 3.10 (6H, s), 2.98 (2H, s).

Step C: To the crude material (1.8 mmol) from Step B was added 5-fluoropyridin-2-amine (213 mg, 1.9 mmol). The mixture was heated neat to 160° C. for 1 hour to provide 7-fluoro-2-(3-fluoro-4-methoxyphenyl)-4H-pyrido[1,2-a]pyrimidin-4-one (475 mg, 92%). MS m/z 289.2 [M+H] + ; 1 H NMR (CDCl 3 , 500 MHz): δ 8.99 (1H, m), 7.92 (1H, dd, J=12.5 Hz, 2.2 Hz), 7.90 (1H, d, 8.5 Hz), 7.88 (1H, m), 7.73 (1H, m), 7.10 (1H, t, J=8.5 Hz), 6.85 (1H, s), 3.99 (3H, s).

Step D: 7-Fluoro-2-(3-fluoro-4-methoxyphenyl)-4H-pyrido[1,2-a]pyrimidin-4-one (200 mg, 0.7 mmol) was combined with piperazine (430 mg, 3.5 mmol) in dimethylacetamide (0.5 mL). The mixture was stirred at 150° C. for 0.5 hours, then chromatographed on silica gel, eluting with 0% to 8% MeOH (3% NH 3 ) in CH 2 Cl 2 . The title compound was obtained as a yellow powder (175 mg, 71%). M.P. 191-195° C.; MS m/z 355.0 [M+H] + ; 1 H NMR (DMSO-d 6 , 500 MHz): δ 8.20 (1H, d, J=2.7 Hz), 8.07-8.02 (3H, m), 7.67 (1H, d, J=9.7 Hz), 7.28 (1H, t, J=8.7 Hz), 6.93 (1H, s), 3.13 (4H, m), 2.90 (3H, s), 2.88 (4H, m), 2.34 (1H, br s).

As shown in Table 1 below, additional compounds disclosed herein may be prepared according to Example 1 by substituting the appropriate starting materials, reagents and reaction conditions.

›Example 2

Preparation of Cpd 239

Step A: A mixture of 7-bromo-2-(3-fluoro-4-methoxyphenyl)-4H-pyrido[1,2-a]pyrimidin-4-one (250 mg, 0.72 mmol), (R)-tert-butyl 3-(methylamino)pyrrolidine-1-carboxylate (180 mg, 0.90 mmol), Pd 2 dba 3 (61 mg, 0.065 mmol), dicyclohexyl(2′,6′-dimethoxybiphenyl-2-yl)phosphine (SPhos, 78 mg, 0.19 mmol), Cs 2 CO 3 (500 mg, 1.53 mmol), and 1,2-dimethoxyethane (DME, 2.0 mL) were stirred under an argon atmosphere at 80° C. for 18 hours. The reaction mixture was then diluted with CH 2 Cl 2 /MeOH (9:1) and was filtered to remove solids. The filtrate was concentrated under vacuum. Purification by silica gel chromatography (10% to 20% acetone in CH 2 Cl 2 ), followed by an ether wash, yielded (R)-tert-butyl 3-((2-(3-fluoro-4-methoxyphenyl)-4-oxo-4H-pyrido[1,2-a]pyrimidin-7-yl)(methyl)amino)pyrrolidine-1-carboxylate (132 mg, 39%) as a light tan solid. MS m/z 469.0 [M+H] + .

Step B: A solution of (R)-tert-butyl 3-((2-(3-fluoro-4-methoxyphenyl)-4-oxo-4H-pyrido[1,2-a]pyrimidin-7-yl)(methyl)amino)pyrrolidine-1-carboxylate (130 mg, 0.28 mmol) in CH 2 Cl 2 (2.0 mL) and TFA (500 μL) was stirred at room temperature for 30 minutes. The mixture was poured into 1N NaOH solution (50 mL). The product was extracted into CH 2 Cl 2 /EtOH (9:1). The organic layer was concentrated under vacuum. Purification by silica gel chromatography (CH 2 Cl 2 /MeOH/NH 4 OH=9/1/0.1) yielded (R)-2-(3-fluoro-4-methoxyphenyl)-7-(methyl(pyrrolidin-3-yl)amino)-4H-pyrido[1,2-a]pyrimidin-4-one (82 mg, 79%) as a yellow solid. MS m/z 369.1 [M+H] + .

Step C: A mixture of (R)-2-(3-fluoro-4-methoxyphenyl)-7-(methyl(pyrrolidin-3-yl)amino)-4H-pyrido[1,2-a]pyrimidin-4-one (45 mg, 0.12 mmol), DCE (500 μL), formaldehyde (37% w/w in H 2 O, 200 μL), and NaBH(OAc) 3 (85 mg, 0.40 mmol) was stirred at room temperature for 15 minutes. The reaction mixture was added to an aqueous K 2 CO 3 solution, and the title product was extracted into CH 2 Cl 2 . The organic layer was concentrated under vacuum. Purification by silica gel chromatography (10% MeOH in CH 2 Cl 2 ) yielded the title compound (39 mg, 85%) as an off-white solid. M.P. 143-149° C.; MS m/z 383.5 [M+H] + ; 1 H NMR (500 MHz, DMSO-d 6 ): δ 8.13 (d, 1H, J=3 Hz), 8.0-8.1 (m, 3H), 7.69 (d, 1H, J=10 Hz), 7.29 (t, 1H, J=9.0 Hz), 6.90 (s, 1H), 4.58 (m, 1H), 3.92 (s, 3H), 2.93 (3H, s), 2.81 (m, 1H), 2.75 (m, 1H), 2.49 (m, 1H, obscured by DMSO-d 6 ), 2.20 (m, 2H), 2.28 (s, 3H), 1.76 (m, 1H).

As shown in Table 1 below, additional compounds disclosed herein may be prepared according to Example 2 by substituting the appropriate starting materials, reagents and reaction conditions.

›Example 3

Preparation of Cpd 6

Step A: A mixture of ethyl 3-(3,4-dimethoxyphenyl)-3-oxopropanoate (2.02 g, 8.0 mmol), 2-amino-5-fluoropyridine (0.897 g, 8.0 mmol) and p-TsOH (152 mg, 0.8 mmol) was heated at 150° C. The mixture was melted and then solidified. After 1 hour, the mixture was cooled to room temperature and washed with MeCN to give 2-(3,4-dimethoxyphenyl)-7-fluoro-4H-pyrido[1,2-a]pyrimidin-4-one as a yellow solid (1.356 g, 56%). MS m/z 367.5 [M+H] + ; 1 H NMR (500 MHz, DMSO-d 6 ): δ 8.92 (1H, dd, J=2.9 Hz, 4.8 Hz), 8.11-8.07 (1H, m), 7.85-7.82 (1H, m), 7.77 (1H, d, J=2.1 Hz), 7.09 (1H, d, J=8.6 Hz), 7.06 (1H, s), 6.93 (1H, s), 3.88 (3H, s), 3.84 (3H, s),

Step B: A mixture of 2-(3,4-dimethoxyphenyl)-7-fluoro-4H-pyrido[1,2-a]pyrimidin-4-one (1.50 g, 5.0 mmol), piperazine (1.29 g, 15 mmol) and DIEA (1.3 mL, 7.5 mmol) in DMSO (10 mL) was heated at 120° C. After 15 hours, the volatiles were removed and the residue was washed with MeCN to give the title compound as a yellow solid (1.674 g, 91%). M.P. 182-184° C.; MS m/z 367.5 [M+H] + ; 1 H NMR (500 MHz, DMSO-d 6 ): δ 8.20 (1H, d, J=2.7 Hz), 8.04 (1H, dd, J=2.8 Hz, 9.8 Hz), 7.79 (1H, dd, J=2.1 Hz, 8.5 Hz), 7.74 (1H, d, J=2.1 Hz), 7.67 (1H, d, J=9.7 Hz), 7.07 (1H, d, J=8.5 Hz), 6.93 (1H, s), 3.87 (3H, s), 3.83 (3H, s), 3.12 (4H, m), 2.88 (4H, m).

As shown in Table 1 below, additional compounds disclosed herein may be prepared according to Example 3 by substituting the appropriate starting materials, reagents and reaction conditions.

›Example 4

Preparation of Cpd 1

Step A: A mixture of ethyl 3-(3-methoxyphenyl)-3-oxopropanoate (2.68 mL, 14.0 mmol) and 2-amino-5-fluoropyridine (1.12 g, 10.0 mmol) in PPA (˜5 g) was heated at 120° C. After 0.5 hours, the dark purple mixture was cooled to room temperature and treated with ice-water. The precipitate was filtered, washed with water and MeCN to give 2-(4-methoxyphenyl)-7-fluoro-4H-pyrido[1,2-a]pyrimidin-4-one as a slightly yellow solid (1.758 g, 65%). MS m/z 271.2 [M+H] + .

Step B: Following the procedure in Example 3, Step B, 7-fluoro-2-(4-methoxyphenyl)-4H-pyrido[1,2-a]pyrimidin-4-one (81 mg, 0.3 mmol) and piperazine (129 mg, 1.5 mmol) in DMSO (1 mL) gave the title compound as a yellow solid (66 mg, 66%). M.P. 182-184° C.; MS m/z 337.3 [M+H] + ; 1 H NMR (500 MHz, DMSO-d 6 ): δ 8.20 (1H, d, J=2.6 Hz), 8.16 (2H, dd, J=2.0 Hz, 7.0 Hz), 8.05 (1H, dd, J=2.7 Hz, 9.7 Hz), 7.67 (1H, d, J=9.7 Hz), 7.05 (2H, d, J=1.9 Hz, 7.0 Hz), 6.86 (1H, s), 3.83 (3H, s), 3.12 (4H, m), 2.87 (4H, m).

As shown in Table 1 below, additional compounds disclosed herein may be prepared according to Example 4 by substituting the appropriate starting materials, reagents and reaction conditions.

›Example 5

Preparation of Cpd 81 and Cpd 82

Step A: To a solution of 4-methoxy-3-(trifluoromethoxy)benzaldehyde (1.0 g, 4.5 mmol) in acetone (30 mL) was added Jone's reagent (5 mL). After stirring at room temperature for 15 hours, methanol (2 mL) was added and the mixture was filtered. The filtrate was concentrated, dissolved in EtOAc and washed with water. The organics were dried and concentrated to give 4-methoxy-3-(trifluoromethoxy)-benzoic acid as a white solid (1.02 g, 96%), MS m/z 235.2 [M−H] − .

Step B: To a solution of 4-methoxy-3-(trifluoromethoxy)benzoic acid (1.02 g, 4.32 mmol) in DCM (10 mL) was added oxalyl chloride (5 mL). After refluxing for 6 hours, the solution was concentrated to give 4-methoxy-3-(trifluoromethoxy)-benzoyl chloride. The crude acid chloride was dissolved in DCM (10 mL) and cooled to 0° C. Diisopropylethylamine (1.56 mL, 9.0 mmol) and N,O-dimethylhydroxylamine (0.658 g, 6.7 mmol) were added. After stirring at room temperature for 2 hours, the mixture was washed with water. The organics were dried, concentrated and chromatographed (5% EtOAc in CH 2 Cl 2 ) to give 4-dimethoxy-N-methyl-3-(trifluoromethoxy)benzamide as an amber oil (0.58 g, 48%).

Step C: To a solution of 4-dimethoxy-N-methyl-3-(trifluoromethoxy)-benzamide (0.58 g, 2.08 mmol) in THF (8 mL) at 0° C. was added MeMgBr (3.0 M, 0.83 mL, 2.5 mmol). After stirring at room temperature for 15 hours, the solution was washed with water. The organics were dried and concentrated to give 11-(4-methoxy-3-(trifluoromethoxy)phenyl)ethanone as a white solid (0.45 g, 96%).

Step D: To a solution of the crude 1-(2-fluoro-4,5-dimethoxyphenyl)-ethanone (0.45 g, 2.0 mmol) and dimethyl carbonate (1.5 mL, 18.2 mmol) in THF (8 mL) at room temperature was added NaH (60%, 0.44 g, 10.9 mmol). After heating at 75° C. for 20 minutes, the mixture was quenched with NH 4 Cl (satd.). The pH of the mixture was adjusted to neutral with 1N HCl. The mixture was extracted with EtOAc. The organics were dried and concentrated to give methyl 3-(4-methoxy-3-(trifluoromethoxy)phenyl)-3-oxopropanoate. MS m/z 299.1 [M+H] + . The crude product was used directly in the next step.

Step E: A solution of the crude methyl 3-(4-methoxy-3-(trifluoromethoxy)phenyl)-3-oxopropanoate (2 mmol) from step D, p-TsOH (38 mg, 0.2 mmol) and trimethoxymethane in MeOH (4 mL) was heated at 60° C. After 1 hour, the volatiles were removed and 2-amino-5-fluoropyridine (0.224 g, 2.0 mmol) was added. The mixture was heated at 150° C. for 1 hour, cooled to room temperature and washed with MeCN to give 7-fluoro-2-(4-methoxy-3-(trifluoromethoxy)phenyl)-4H-pyrido[1,2-a]pyrimidin-4-one (146 mg, 21%). MS m/z 355.1 [M+H] + .

Step F: A mixture of 7-fluoro-2-(4-methoxy-3-(trifluoromethoxy)phenyl)-4H-pyrido[1,2-a]pyrimidin-4-one (71 mg, 0.2 mmol), piperazine (38 mg, 0.4 mmol) and diisopropylethylamine (69 uL, 0.4 mmol) in DMSO (0.5 mL) was heated at 120° C. After 15 hours, the volatiles were removed and the residue was chromatographed (20% MeOH in DCM) to give two products:

Cpd 81 (8 mg, 9%) was obtained as a yellow solid. M.P. 158-162° C.; MS m/z 421.1 [M+H] + ; 1 H NMR (500 MHz, DMSO-d 6 ): δ 8.26 (1H, d, J=2.6 Hz), 8.24 (1H, dd, J=2.2 Hz, 8.8 Hz), 8.19 (1H, m), 8.08 (1H, dd, J=2.8 Hz, 9.7 Hz), 7.75 (1H, d, J=9.7 Hz), 7.37 (1H, d, J=8.8 Hz), 6.99 (1H, s), 3.94 (3H, s), 3.07 (4H, m), 2.50 (4H, m, obscured by DMSO-d 6 ; and,

Cpd 82 (9 mg, 11%) was obtained as a yellow solid. M.P. 245-248° C.; MS m/z 407.2 [M+H] + ; 1 H NMR (500 MHz, DMSO-d 6 ): δ 8.21 (1H, d, J=2.7 Hz), 8.11 (1H, m), 8.07-8.03 (2H, m), 7.68 (1H, d, J=9.7 Hz), 7.11 (1H, d, J=8.6 Hz), 6.87 (1H, s), 3.14 (4H, m), 2.88 (4H, m).

As shown in Table 1 below, additional compounds disclosed herein may be prepared according to Example 5 by substituting the appropriate starting materials, reagents and reaction conditions.

›Example 6

Preparation of Cpd 70

To a suspension of 2-(3,4-dimethoxyphenyl)-9-fluoro-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one (38 mg, 0.1 mmol, prepared by following the procedures in Example 3, Steps A and B in MeOH (0.5 mL) was added NaOMe (0.5 M in MeOH, 1 mL, 0.5 mmol). After heating at 80° C. for 15 hours, the volatiles were removed and the residue was chromatographed (10-15% MeOH/CH 2 Cl 2 ) to give the title compound as a yellow solid (18 mg, 45%). M.P. 185-187° C.; MS m/z 397.3 [M+H] + ; 1 H NMR (500 MHz, DMSO-d 6 ): δ 8.20 (1H, d, J=2.5 Hz), 7.80 (2H, m), 7.08 (1H, d, J=9.0 Hz), 7.00 (1H, s), 6.97 (1H, d, J=2.5 Hz), 3.89 (3H, s), 3.87 (3H, s), 3.83 (3H, s), 3.30 (4H, m), 2.98 (4H, m).

›Example 7

Preparation of Cpd 74

Step A: To a solution of 2-amino-5-methylpyrazine (1.09 g, 10 mmol) in DME (10 mL) was added ethyl 3-bromo-2-oxopropanoate (1.57 mL, 12.5 mmol). The mixture was stirred at room temperature for 45 minutes. The precipitate was filtered, washed with Et 2 O and dried to give a yellow solid. The solid was suspended in EtOH (20 mL) and heated at 90° C. After 1.5 hours, the resulting brown solution was concentrated and adjusted to pH 7. The mixture was extracted with EtOAc. The organics were concentrated and the residue was triturated and washed with MeCN to give ethyl 6-methylimidazo[1,2-a]pyrazine-2-carboxylate as a brown solid (0.993 g, 48%). MS m/z 206.2 [M+H] + .

Step B: To a solution of ethyl 6-methylimidazo[1,2-a]pyrazine-2-carboxylate (0.971 g, 4.73 mmol) and EtOAc (0.98 mL, 10 mmol) in toluene (2 mL) and Me-THF (8 mL) at room temperature was added NaH (60%, 0.503 mg, 12.6 mmol). After heating at 70° C. for 30 minutes, the mixture was cooled to room temperature, quenched with ice, adjusted to pH 7 with 1N HCl and extracted with EtOAc. The organics were combined, dried, concentrated and chromatographed to give ethyl 3-(6-methylimidazo[1,2-a]pyrazin-2-yl)-3-oxopropanoate as a brownish oil (0.93 g, 78%).

Step C: Following the procedure in Example 1 Step B, ethyl 3-(6-methylimidazo[1,2-a]pyrazin-2-yl)-3-oxopropanoate (0.913 g, 3.7 mmol), p-toluenesulfonic acid monohydrate (70 mg, 0.37 mmol) and trimethylorthoformate (0.81 mL, 7.4 mmol) in MeOH (10 mL) afforded the ketal which was used directly in the next step.

Step D: Following the procedure in Example 1 Step C, the crude dimethoxypropanoate (from Step C and 2-amino-5-fluoro-pyridine (0.422 g, 3.7 mmol) gave 7-fluoro-2-(6-methylimidazo[1,2-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one as a brownish solid (0.344 g, 31%). MS m/z 295.9 [M+H] + ; 1 H NMR (500 MHz, DMSO-d 6 ): δ 9.09 (1H, s), 8.97-8.96 (1H, m), 8.67 (1H, s), 8.47 (1H, s), 8.15-8.11 (1H, m), 7.85-7.82 (1H, m), 7.08 (1H, s), 2.42 (3H, S).

Step E: Following the procedure in Example 3, Step B, 7-fluoro-2-(6-methylimidazo[1,2-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one (59 mg, 0.2 mmol) and piperazine (52 mg, 0.6 mmol) in DMSO (0.5 mL) gave the title compound as a yellow solid (28 mg, 39%). M.P. 221-225° C.; MS m/z 362.2 [M+H] + ; 1 H NMR (500 MHz, DMSO-d 6 ): δ 9.07 (1H, s), 8.62 (1H, s), 8.46 (1H, s), 8.25 (1H, d, J=2.6 Hz), 8.09 (1H, d, J=2.7 Hz, 9.7 Hz), 7.67 (1H, d, J=9.7 Hz), 7.00 (1H, s), 3.16 (4H, m), 2.90 (4H, m), 2.44 (3H, s).

As shown in Table 1 below, additional compounds disclosed herein may be prepared according to Example 7 by substituting the appropriate starting materials, reagents and reaction conditions.

›Example 8

Preparation of Cpd 29

Step A: Following the procedure in Example 7, Step A, 2-amino-5-methylpyridine (5.41 g, 50 mmol) and ethyl 3-bromo-2-oxopropanoate (7.0 mL, 50 mmol) in MeOH (50 mL) gave ethyl 6-methylimidazo[1,2-a]pyridine-2-carboxylate as a yellowish solid (9.50 g, 93%), MS m/z 205.1 [M+H] + .

Step B: Following the procedure in Example 7, Step B, ethyl 6-methylimidazo[1,2-a]pyridine-2-carboxylate (0.55 g, 2.5 mmol), EtOAc (0.29 mL, 5.0 mmol) and NaH (60%, 0.20 g, 5 mmol) in toluene (5 mL) gave ethyl 3-(6-methylimidazo[1,2-a]pyridin-2-yl)-3-oxopropanoate as a yellow solid (0.62 g, 100%), MS m/z 243.1 [M+H] + .

Step C: Following the procedure in Example 4, Step A, ethyl 3-(6-methylimidazo[1,2-a]pyridin-2-yl)-3-oxopropanoate (246 mg, 1.0 mmol) and 2-amino-5-fluoropyridine (334 mg, 1.2 mmol) in PPA (˜5 g) gave 7-fluoro-2-(6-methylimidazo[1,2-a]pyridin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one as a yellow solid (17 mg, 6%), MS m/z 295.2 [M+H] + .

Step D: Following the procedure in Example 3, Step B, 7-fluoro-2-(6-methylimidazo[1,2-a]pyridin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one (17 mg, 0.06 mmol) and piperazine (30 mg, 0.3 mmol) in DMSO (10 mL) gave the title compound as a light brown solid (19 mg, 83%). M.P. 193-198° C.; MS m/z 361.3 [M+H] + ; 1 H NMR (500 MHz, DMSO-d 6 ): δ 8.48 (1H, s), 8.41 (1H, s), 8.25 (1H, d, J=2.6 Hz), 8.06 (1H, dd, J=2.7 Hz, 9.7 Hz), 7.66 (1H, d, J=9.7 Hz), 7.55 (1H, d, 9.3 Hz), 7.18 (1H, d, J=9.3 Hz), 6.96 (1H, s), 3.23 (4H, m), 3.01 (4H, m), 2.29 (3H, s).

›Example 9

Preparation of Cpd 170

Step A: To a solution of diethyl 1H-pyrazole-3,5-dicarboxylate (10.0 g, Δ7 mmol) and chloroacetone (3.76 mL, Δ7 mmol) in acetone (200 mL) was added potassium carbonate (7.2 g, 52 mmol). After heating at 30° C. for 6 hours, the mixture was concentrated to remove the volatiles. The residue was taken into EtOAc and washed with water. The organics were dried over MgSO 4 and concentrated to give diethyl 1-(2-oxopropyl)-1H-pyrazole-3,5-dicarboxylate as a light brown solid, which was used directly in the next step, MS m/z 269.1 [M+H] + .

Step B: To a solution of diethyl 1-(2-oxopropyl)-1H-pyrazole-3,5-dicarboxylate (˜47 mmol) in acetic acid (300 mL) was added ammonium acetate (72 g, 940 mmol). After refluxing for 48 hours, the mixture was concentrated to minimum volume and diluted with water. The precipitate was filtered, washed with water and MeCN to give ethyl 4-hydroxy-6-methylpyrazolo[1,5-a]pyrazine-2-carboxylate as a tan solid (6.7 g, 64%), MS m/z 222.1 [M+H] + .

Step C: A mixture of ethyl 4-hydroxy-6-methylpyrazolo[1,5-a]pyrazine-2-carboxylate (7.18 g, 32.5 mmol) in POCl 3 (80 mL) was refluxed for 15 hours. The dark mixture was concentrated and washed with MeCN to give ethyl 4-chloro-6-methylpyrazolo[1,5-a]pyrazine-2-carboxylate (5.197 g) as an off-white solid. The filtrate was concentrated and chromatographed to give an additional 1.42 g product (6.617 g, 85%) MS m/z 240.1 [M+H] + , 242.1 [M+2+H] + .

Step D: A mixture of ethyl 4-chloro-6-methylpyrazolo[1,5-a]pyrazine-2-carboxylate (5.197 g, 21.7 mmol), MeB(OH) 2 (3.90 g, 65.1 mmol), K 2 CO 3 (14.8 g, 107.5 mmol) and Pd(PPh 3 ) 2 Cl 2 in (456 mg, 0.65 mmol) DMF (100 mL) was degassed and heated under N 2 for 15 hours. The mixture was concentrated on a rotovap to remove most of the DMF and washed with water. The residue was chromatographed (2% to 5% MeOH in CH 2 Cl 2 ) to give ethyl 4,6-dimethylpyrazolo[1,5-a]pyrazine-2-carboxylate as a yellow solid (3.90 g, 82%), MS m/z 220.1 [M+H] + ; 1 H NMR (500 MHz, DMSO-d 6 ): δ 8.54 (1H, s), 7.49 (1H, s), 4.36 (2H, q, J=7.2 Hz), 2.70 (3H, s), 2.42 (3H, s), 1.34 (3H, t, J=7.2 Hz).

Step E: To a solution of t-butyl acetate (1.63 mL, 12.1 mmol) in THF (50 mL) at −78° C. was added LDA (1.5 M, 0.97 mL, 14.5 mmol). After 0.5 hours, the solution was cannulated to a solution of ethyl 4,6-dimethylpyrazolo[1,5-a]pyrazine-2-carboxylate (1.33 g, 6.07 mmol) in THF (100 mL) at −30° C. After 1 hour, the mixture was quenched with saturated NH 4 Cl, adjusted to pH 5-6 and extracted with EtOAc. The combined organics were dried and concentrated. The residue was chromatographed (2% to 4% MeOH/CH 2 Cl 2 ) to give t-butyl 3-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-3-oxopropanoate as a yellow oil (1.696 g, 97%), MS m/z 290.2 [M+H] + ; 1 H NMR (500 MHz, DMSO-d 6 ): δ 8.57 (1H, s), 7.50 (1H, s), 4.02 (2H, s), 2.70 (3H, s), 2.43 (3H, s), 1.38 (9H, s).

Step F: A solution of t-butyl 3-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-3-oxopropanoate (4.86 g, 16.8 mmol) in EtOH (30 mmol) was heated at 120° C. in a capped tube. After 1 hour, the solution was cooled to room temperature and the volatiles were removed to give ethyl 3-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-3-oxopropanoate as a yellow solid (4.44 g, 98%), MS m/z 262.2 [M+H] + .

Step G: A mixture of 2-amino-5-fluoro-pyridine (134 mg, 1.2 mmol), ethyl 3-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-3-oxopropanoate (261 mg, 1.0 mmol) and PPTs (12.6 mg, 0.05 mmol) was heated at 130° C. After 8 hours, the mixture was cooled to room temperature and chromatographed to give 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-fluoro-4H-pyrido[1,2-a]pyrimidin-4-one as a yellow solid (220 mg, 71%). MS m/z 310.2 [M+H] + ; 1 H NMR (500 MHz, DMSO-d 6 ): δ 8.97-8.95 (1H, m), 8.55 (1H, s), 8.16-8.12 (1H, m), 7.87-7.85 (1H, m), 7.56 (1H, s), 7.03 (1H, s), 2.73, (3H, s), 2.43 (3H, s).

Step H: Following the procedure in Example 3, Step B, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-fluoro-4H-pyrido[1,2-a]pyrimidin-4-one (309 mg, 1.0 mmol) and piperazine (1.1 mL, 10 mmol) in DMA (1.0 mL) gave the title compound as a yellow solid (313 mg, 80%). M.P. 254-256° C.; MS m/z 390.4 [M+H] + ; 1 H NMR (500 MHz, DMSO-d 6 ): δ 8.55 (1H, s), 8.27 (1H, d, J=2.7 Hz), 8.12 (1H, dd, J=2.8 Hz, 9.7 Hz), 7.71 (1H, d, J=9.7 Hz), 7.54 (1H, s), 6.95 (1H, s), 3.25 (4H, m), 2.72 (3H, s), 2.51 (4H, m, obscured by DMSO-d 6 ), 2.43 (3H, s), 2.25 (3H, s).

As shown in Table 1 below, additional compounds disclosed herein may be prepared according to Example 9 by substituting the appropriate starting materials, reagents and reaction conditions.

›Example 10

Preparation of Cpd 163

Step A: Following the procedure in Example 5, Step E, 2-acetyl-4-methylthiazole (706 mg, 5 mmol), dimethyl carbonate (15 mL, 178 mmol) and NaH (60% dispersion in mineral oil, 1.14 g, 28.5 mmol) provided methyl 3-(4-methylthiazol-2-yl)-3-oxopropanoate. The crude product was used directly in the next step. MS m/z 200.1 [M+H] + .

Step B: Following the procedure in Example 1, Step B, 3-(4-methylthiazol-2-yl)-3-oxopropanoate (199 mg, 1.0 mmo), trimethylorthoformate (0.25 mL, 2.25 mmol) and toluenesulfonic acid monohydrate (14.3 mg, 0.075 mmol) in MeOH (1.5 mL) afforded the dimethoxypropanoate.

Step C: Following the procedure in Example 1, Step C the dimethoxypropanoate from Step B and 2-amino-4-fluoro-pyridine (201.8 mg, 1.8 mmol) in DMA (1.5 mL) provided 7-fluoro-2-(4-methylthiazol-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one (175.5 mg, 67%). MS m/z 262.1 [M+H] + .

Step D: Following the procedure in Example 3, Step B, 7-fluoro-2-(4-methylthiazol-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one (52.2 mg, 0.2 mmol) and piperazine (86 mg, 1 mmol) in DMSO (0.8 mL) provided the title compound (20 mg, 30%). M.P. 142-147° C.; MS m/z 328.2 [M+H] + ; 1 H NMR (500 MHz, DMSO-d 6 ): δ 8.27 (1H, dd, J=2.7 Hz, 18.6 Hz), 8.11-8.16 (1H, m), 7.73 (1H, t, J=9.2 Hz), 7.56 (1H, s), 6.88 (1H, d, J=3.2 Hz), 3.29-3.31 (2H, m), 3.16-3.18 (2H, m), 2.89-2.91 (2H, m), 2.67-2.69 (2H, m), 2.47 (3H, s).

As shown in Table 1 below, additional compounds disclosed herein may be prepared according to Example 10 by substituting the appropriate starting materials, reagents and reaction conditions.

›Example 11

Preparation of Cpd 92

Step A: 5-Fluoronicotinic acid (1.0 g, 7.1 mmol) was dissolved in THF (10 mL) and cooled to 0° C. A 1.4 M solution of methylmagnesium bromide in THF:toluene (3:1) (11.2 mL, 15.6 mmol) was added drop wise to the solution. The solution was allowed to warm to room temperature. The solution was stirred at room temperature for 4 hours, upon which 1N aqueous HCl (50 mL) was slowly added. The mixture was partitioned into EtOAc (200 mL) and aqueous 1N NaOH (200 mL). The organic layer was washed with brine, dried over Na 2 SO 4 , filtered and concentrated. The residue was chromatographed on silica, eluting with EtOAc (0% to 50%) in hexanes to afford 1-(5-fluoropyridin-3-yl)ethanone as a white powder (290 mg, 29%).

Step B: Following the procedure in Example 5, Step D, the methyl ketone from Step A, dimethyl carbonate (0.44 mL, 5.25 mmol) and sodium hydride (210 mg, 60% dispersion in mineral oil, 5.25 mmol) in THF (6 mL) afforded methyl 3-(5-fluoropyridin-3-yl)-3-oxopropanoate as an off white powder (278 mg, 67%).

Step C: Methyl 3-(5-fluoropyridin-3-yl)-3-oxopropanoate (138 mg, 0.7 mmol) was combined with 5-fluoropyridin-2-amine (90 mg, 0.8 mmol) and toluenesulfonic acid monohydrate (6 mg, 0.03 mmol) in dimethylacetamide (0.5 mL). The mixture was heated to 160° C. for 1 hour. The mixture was cooled to 120° C., before adding piperazine (300 mg, 3.5 mmol). The mixture was stirred at 120° C. for 1 hour. The mixture was loaded onto silica in CH 2 Cl 2 and eluted with 0% to 8% MeOH (3% NH 3 ) in CH 2 Cl 2 . The title compound was obtained as a yellow powder (37 mg, 16%). M.P. 201-208° C.; MS m/z 326.2 [M+H] + ; 1 H NMR (DMSO-d 6 , 500 MHz): δ 9.25 (1H, s), 8.70 (1H, d, J=2.8 Hz), 8.42 (1H, d, J=10.2 Hz), 8.22 (1H, d, 2.7 Hz), 8.12 (1H, dd, J=9.8 Hz, 2.8 Hz), 7.74 (1H, d, J=9.7 Hz), 7.11 (1H, s), 3.16 (4H, m), 2.89 (4H, m), 2.37 (1H, br s).

As shown in Table 1 below, additional compounds disclosed herein may be prepared according to Example 11 by substituting the appropriate starting materials, reagents and reaction conditions.

›Example 12

Preparation of Cpd 98

Step A: 1H-Indole-5-carboxylic acid (1.0 g, 6.2 mmol) was combined with N,O-dimethylhydroxylamine hydrochloride (907 mg, 9.3 mmol), N-(3-dimethylaminopropyl)-N′-ethylcarbodiimide hydrochloride (1.78 g, 9.3 mmol) and N,N-diisopropylethylamine (3.2 mL, 18.6 mmol) in CH 2 Cl 2 (12 mL). After stirring for 4 hours at room temperature, the mixture was washed with aqueous HCl (1N, 20 mL). The organic layer was dried over Na 2 SO 4 and concentrated. The crude product was used directly in the next step.

Step B: The crude product from Step A was dissolved in THF (20 mL). A 1.4 M solution of methylmagnesium bromide (11.2 mL, 15.6 mmol) in THF:toluene (3:1), was added drop wise to the solution. The solution was allowed to warm to room temperature. The solution was stirred at 50° C. for 1 hour, upon which 1N aqueous HCl (50 mL) was slowly added. The mixture was partitioned into EtOAc (200 mL) and aqueous 1N NaOH (200 mL). The organic layer was washed with brine, dried over Na 2 SO 4 , filtered and concentrated. The residue was chromatographed on silica, eluting with EtOAc (0% to 50%) in hexanes to afford 1-(1H-indol-5-yl)ethanone as a white powder (323 mg, 33%).

Step C: Following the procedure in Example 5, Step E, the methyl ketone from Step B, dimethyl carbonate (0.46 mL, 5.5 mmol) and sodium hydride (220 mg, 60% dispersion in mineral oil, 5.5 mmol) in THF (6 mL) afforded methyl 3-(1H-indol-5-yl)-3-oxopropanoate as an off white powder (120 mg, 27%). MS m/z 216.1 [M−H] − .

Step D: Following the procedure of Example 11, Step C, methyl 3-(1H-indol-5-yl)-3-oxopropanoate (98 mg, 0.45 mmol), 5-fluoropyridin-2-amine (56 mg, 0.5 mmol), toluenesulfonic acid monohydrate (9 mg, 0.05 mmol) and piperazine (194 mg, 2.25 mmol) in dimethylacetamide (0.5 mL) afforded the title compound as an off-white powder (40 mg, 26%). M.P. 266-272° C. MS m/z 346.2 [M+H] + ; 1 H NMR (DMSO-d 6 , 500 MHz): δ 11.3 (1H, s), 8.46 (1H, s), 8.22 (1H, d, J=2.8 Hz), 8.04 (1H, dd, J=9.7 Hz, 2.8 Hz), 7.95 (1H, d, J=8.7 Hz), 7.69 (1H, d, J=9.7 Hz), 7.49 (1H, d, J=8.6 Hz), 7.42 (1H, t, J=2.7 Hz), 6.90 (1H, s), 6.57 (1H, m), 3.14 (4H, m), 2.89 (4H, m), 2.36 (1H, br s).

As shown in Table 1 below, additional compounds disclosed herein may be prepared according to Example 12 by substituting the appropriate starting materials, reagents and reaction conditions.

›Example 13

Preparation of Cpd 107

Step A: Following the procedure in Example 12, Step A, imidazo[1,2-a]pyridine-7-carboxylic acid (1.0 g, 6.2 mmol), N,O-dimethylhydroxylamine hydrochloride (907 mg, 9.3 mmol), N-(3-dimethylaminopropyl)-N′-ethylcarbodiimide hydrochloride (1.78 g, 9.3 mmol) and N,N-diisopropylethylamine (3.2 mL, 18.6 mmol) in CH 2 Cl 2 (12 mL) gave N-methoxy-N-methylimidazo[1,2-a]pyridine-7-carboxamide (505 mg, 40%).

Step B: Following the procedure in Example 12, Step B, the product from Step A (505 mg, 2.5 mmol), methylmagnesium bromide (3.6 mmol) in THF (10 mL) afforded 1-(imidazo[1,2-a]pyridin-7-yl)ethanone (275 mg, 70%).

Step C: Following the procedure in Example 5, Step E, the methyl ketone from Step B (275 mg, 1.7 mmol), dimethyl carbonate (0.35 mL, 4.25 mmol) and sodium hydride (170 mg, 60% dispersion in mineral oil, 4.25 mmol) in THF (5 mL) afforded methyl 3-(imidazo[1,2-a]pyridin-7-yl)-3-oxopropanoate as an off-white powder (215 mg, 58%).

Step D: Following the procedure of Example 11, Step C, methyl 3-(imidazo[1,2-a]pyridin-7-yl)-3-oxopropanoate (215 mg, 1.0 mmol), 5-fluoropyridin-2-amine (123 mg, 1.1 mmol), toluenesulfonic acid monohydrate (19 mg, 0.1 mmol) and piperazine (430 mg, 5 mmol) in dimethylacetamide (1.0 mL) afforded the title compound as an off-white powder (40 mg, 12%). M.P. 258-270° C.; MS m/z 347.0 [M+H] + ; 1 H NMR (DMSO-d 6 , 500 MHz): δ 8.65 (1H, d, J=7.2 Hz), 8.46 (1H, s), 8.24 (1H, d, J=2.7 Hz), 8.11 (1H, dd, J=9.7 Hz, 2.7 Hz), 8.06 (1H, s), 7.75 (1H, d, J=9.7 Hz), 7.73 (1H, dd, J=7.2 Hz, 2.7 Hz), 7.71 (1H, s), 7.10 (1H, s), 3.16 (4H, m), 2.89 (4H, m), 2.34 (1H, br s).

›Example 14

Preparation of Cpd 171

Part 1, Step A: A mixture of 2-amino-5-fluoropyridine (11.20 g, 0.10 mol) and dimethyl malonate (57.0 mL, 0.50 mol) was heated at 230° C. for 1.5 hours. After cooling to room temperature, the precipitate was filtered and washed with ACN (3×) to give 7-fluoro-2-hydroxy-4H-pyrido[1,2-a]pyrimidin-4-one as a dark solid (14 g), which was used directly in the next step. MS m/z 181.3 [M+H] + .

Part 1, Step B: A dark mixture of crude 7-fluoro-2-hydroxy-4H-pyrido[1,2-a]pyrimidin-4-one (14 g, ˜77 mmol) in POCl 3 (50 mL) and DIEA (13.3 mL, 77 mmol) was heated at 110° C. for 15 hours. The volatiles were removed and the dark residue was treated with ice-water, washed with water (3×) and dried to give a brown solid. The crude brown solid was chromatographed (5% MeOH in CH 2 Cl 2 ) to give 2-chloro-7-fluoro-4H-pyrido[1,2-a]pyrimidin-4-one as a yellow solid (9.84 g, 50%, 2 steps), MS m/z 199.2 [M+H] + ; 1 H NMR (500 MHz, DMSO-d 6 ): δ 8.99 (1H, dd, J=2.8 Hz, 4.7 Hz), 8.27-8.23 (1H, m), 7.85 (1H, dd, J=5.4 Hz, 9.8 Hz), 6.56 (1H, s).

Part 2: A mixture of 6-bromo-2-methylbenzo[d]oxazole (1.06 g, 5.0 mmol), 4,4,4′,4′,5,5,5′,5′-octamethyl-2,2′-bi(1,3,2-dioxaborolane) (1.40 g, 5.5 mmol), KOAc (1.47 g, 15 mmol) and Pd(dppf)Cl 2 .CH 2 Cl 2 (122 mg, 0.15 mmol) in dioxane (8 mL) was degassed and heated under N 2 at 85° C. After 15 hours, the mixture was diluted with EtOAc, filtered through celite and concentrated. The residue was chromatographed to give 2-methyl-6-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)benzo[d]oxazole as a light orange solid (1.30 g, 100%), MS m/z 260.4 [M+H] + .

Part 3, Step A: A mixture of 2-chloro-7-fluoro-4H-pyrido[1,2-a]pyrimidin-4-one (0.436 g, 2.2 mmol), 2-methyl-6-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)benzo[d]oxazole (0.647 g, 2.5 mmol), Pd(dppf)Cl 2 in DCM (90 mg, 0.11 mmol), K 2 CO 3 (2M, 3.0 mL, 6.0 mmol), and ACN (6 mL) was degassed and then heated under N 2 at 60° C. for 3.5 hours. The volatiles were removed and the residue was chromatographed (2.5% MeOH/CH 2 Cl 2 ) to give 7-fluoro-2-(2-methylbenzo[d]oxazol-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one as an off-white solid (0.64 g, 98%). MS m/z 296.4 [M+H] + ; 1 H NMR (500 MHz, DMSO-d 6 ): δ 8.96-8.95 (1H, m), 8.51 (1H, d, J=1.6 Hz), 8.26 (1H, dd, J=8.5 Hz, 1.6 Hz), 8.16-8.12 (1H, m), 7.91-7.88 (1H, m), 7.78 (1H, d, J=8.4 Hz), 7.17 (1H, s), 2.67 (3H, s).

Part 3, Step B: A mixture of 7-fluoro-2-(2-methylbenzo[d]oxazol-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one (60 mg, 0.2 mmol) and 1-Methyl piperazine (0.11 mL, 1.0 mmol) in DMA (0.3 mL) was heated at 120° C. for 15 hours. The volatiles were removed and the residue was chromatographed to give the title compound as a yellow solid (46 mg, 61%). M.P. 178-183° C.; MS m/z 376.5 [M+H] + ; 1 H NMR (500 MHz, DMSO-d 6 ): δ 8.47 (1H, d, J=1.5 Hz), 8.25 (1H, d, J=2.7 Hz), 8.23 (1H, dd, J=1.6 Hz, 8.4 Hz), 8.11 (1H, dd, J=2.8 Hz, 9.7 Hz), 7.76 (1H, d, J=8.6 Hz), 7.74 (1H, d, J=9.9 Hz), 7.06 (1H, s), 3.25 (4H, m), 2.66 (3H, s), 2.25 (3H, s).

As shown in Table 1 below, additional compounds disclosed herein may be prepared according to Example 14 by substituting the appropriate starting materials, reagents and reaction conditions.

›Example 15

Preparation of 109

Step A: 2-Chloro-7-fluoro-4H-pyrido[1,2-a]pyrimidin-4-one (990 mg, 5 mmol, prepared according to the procedure in Example 14, Part 1) was combined with 2-aminopyridine-5-boronic acid pinacol ester (1.21 g, 5.5 mmol), tetrakis(triphenylphosphine) palladium(0) (281 mg, 0.25 mmol), CH 3 CN (10 mL) and aqueous K 2 CO 3 (1M, 10 mL). The mixture was heated to 80° C. for 6 hours. The mixture was cooled to room temperature, and then filtered. The collected precipitate was washed with CH 3 CN and dried under vacuum, providing 2-(6-aminopyridin-3-yl)-7-fluoro-4H-pyrido[1,2-a]pyrimidin-4-one as a yellow powder (1.13 g, 88%). MS m/z 257.0 [M+H] + ; 1 H NMR (DMSO-d 6 , 500 MHz): δ 8.90 (1H, m), 8.83 (1H, d, J=2.1 Hz), 8.17 (1H, dd, J=8.8 Hz, 2.5 Hz), 8.07 (1H, m), 7.78 (1H, dd, J=9.8 Hz, 5.3 Hz), 6.87 (1H, s), 6.58 (2H, s), 6.53 (1H, d, 8.9 Hz).

Step B. 2-(6-Aminopyridin-3-yl)-7-fluoro-4H-pyrido[1,2-a]pyrimidin-4-one (254 mg, 1.0 mmol) was combined with chloroacetone (100 μL, 1.2 mmol) in DMSO (360 μL, 1.65 mmol). The mixture was heated to 120° C. for 30 minutes. After cooling to room temperature, the mixture was partitioned in CH 2 Cl 2 and saturated aqueous NaHCO 3 . The organic layer was concentrated. The residue was eluted from silica with MeOH (0% to 6%) in CH 2 Cl 2 , affording 7-fluoro-2-(2-methylimidazo[1,2-a]pyridin-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one as a tan powder (136 mg, 46%). MS m/z 295.0 [M+H] + ; 1 H NMR (DMSO-d 6 , 500 MHz): δ 9.40 (1H, s), 8.95 (1H, m), 8.14 (1H, m), 7.96 (1H, dd, J=9.5 Hz, 1.9 Hz), 7.85 (2H, m), 7.54 (1H, J=9.4), 7.08 (1H, s), 2.36 (3H, s).

Step C: 7-Fluoro-2-(2-methylimidazo[1,2-a]pyridin-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one (45 mg, 0.15 mmol) was combined with piperazine (65 mg, 0.75 mmol) in dimethylacetamide (0.5 mL). The mixture was heated to 150° C. for 1 hour. The mixture was loaded onto silica and eluted with 0% to 8% MeOH (3% NH 3 ) in CH 2 Cl 2 to afford the title compound as a tan powder (33 mg, 61%). M.P. 259-267° C.; MS m/z 361.1 [M+H] + ; 1 H NMR (DMSO-d 6 , 500 MHz): δ 9.36 (1H, s), 8.23 (1H, d, J=2.7 Hz), 8.10 (1H, dd, J=9.7 Hz, 2.7 Hz), 7.94 (1H, dd, J=9.5 Hz, 1.8 Hz), 7.82 (1H, s), 7.70 (1H, d, J=9.7 Hz), 7.52 (1H, d, J=9.5 Hz), 6.96 (1H, s), 3.15 (4H, m), 2.89 (4H, m), 2.36 (3H, s).

As shown in Table 1 below, additional compounds disclosed herein may be prepared according to Example 15 by substituting the appropriate starting materials, reagents and reaction conditions.

›Example 16

Preparation of Cpd 209

Step A: 3-Fluoropyridin-2-amine (5.0 g, 45 mmol) was combined with N-bromosuccinimide (8.0 g, 45 mmol) in CH 3 CN (40 mL). The mixture was stirred at room temperature for 30 minutes. Chloroacetone (4.3 mL, 54 mmol) was added to the mixture. The mixture was heated to 100° C., allowing the CH 3 CN to evaporate. After 1 hour, the temperature was raised to 120° C. for 2 hours. The mixture solidified upon cooling. The solid material was dissolved in H 2 O (50 mL). To the aqueous solution was added 100 mL of saturated aqueous NaHCO 3 . A precipitate formed, and was collected by vacuum filtration. The solid material was washed with H 2 O and dried under vacuum. The material was loaded onto silica in CH 2 Cl 2 and eluted with EtOAc (0% to 30%) in CH 2 Cl 2 , providing 6-bromo-8-fluoro-2-methylimidazo[1,2-a]pyridine as a tan powder (4.65 g, 45%). MS m/z 229.2 [M+H] + , 231.2 [M+2+H] + ; 1 H NMR (DMSO-d 6 , 500 MHz): δ 8.72 (1H, s), 7.79 (1H, s), 7.39 (1H, d, J=10.7 Hz), 2.35 (3H, s).

Step B: Following the procedure in Example 14, Part 2,6-Bromo-8-fluoro-2-methylimidazo[1,2-a]pyridine (912 mg, 4 mmol), 4,4,4′,4′,5,5,5′,5′-octamethyl-2,2′-bi(1,3,2-dioxaborolane) (1.32 g, 4.8 mmol), [1,1′-bis(diphenylphosphino)ferrocene]-dichloropalladium(II) (163 mg, 0.2 mmol) and potassium acetate (784 mg, 8 mmol) provided 8-fluoro-2-methyl-6-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)imidazo[1,2-a]pyridine. The crude product was used directly in the next step.

Step C: Following the procedure in Example 14, Part 3, Step A, the crude product of 8-fluoro-2-methyl-6-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)imidazo[1,2-a]pyridine from step A and 2-chloro-7-fluoro-4H-pyrido[1,2-a]pyrimidin-4-one (4 mmol, prepared in Example 14, Part 1, Step B), tetrakis(triphenylphosphine) palladium(0) (225 mg, 0.2 mmol) and aqueous K 2 CO 3 (1M, 8 mL) provided 7-fluoro-2-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one as a tan powder (860 mg, 69%). MS m/z 313.0 [M+H] + .

Step D: Following the procedure in Example 14, Part 3, Step B, 7-Fluoro-2-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one (65 mg, 0.21 mmol) and piperazine (90 mg, 1.05 mmol) afforded the title compound as a tan powder (34 mg, 43%). M.P. 282-288° C.; MS m/z 379.4 [M+H] + ; 1 H NMR (DMSO-d 6 , 500 MHz): δ 9.26 (1H, s), 8.21 (1H, d, J=2.6 Hz), 8.10 (1H, dd, J=9.7 Hz, 2.7 Hz), 7.93 (1H, d, J=2.3 Hz), 7.84 (1H, d, J=12.7 Hz), 7.68 (1H, d, J=9.8 Hz), 6.98 (1H, s), 3.14 (4H, m), 2.88 (4H, m), 2.39 (3H, s), 2.35 (1H, br s).

As shown in Table 1 below, additional compounds disclosed herein may be prepared according to Example 16 by substituting the appropriate starting materials, reagents and reaction conditions.

›Example 17

Preparation of Cpd 182

Step A: Following the procedure for Example 14, Part 3, Step A, 3-fluoro-2-methoxy-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)pyridine (˜4.85 mmol, crude product prepared by the procedure in Example 14, Part 2) and 2-chloro-7-fluoro-4H-pyrido[1,2-a]pyrimidin-4-one (0.64 g, 3.23 mmol, prepared in Example 14, Part 1) gave 7-fluoro-2-(5-fluoro-6-methoxypyridin-3-yl)-4H-pyrido[1,2-a]pyrimidin-4-one (1.0 g, 100%) as a brown solid, MS m/z 290.4 [M+H] + .

Step B: A mixture of 7-fluoro-2-(5-fluoro-6-methoxypyridin-3-yl)-4H-pyrido[1,2-a]pyrimidin-4-one (145 mg, 0.5 mmol) and piperazine (43 mg, 0.5 mmol) in DMA (1 mL) was heated at 120° C. After 4 hours, the volatiles were removed and the residue was chromatographed (20% MeOH/CH 2 Cl 2 ) to give the title compound as a yellow solid (63 mg, 36%). M.P. 166-170° C.; MS m/z 356.4 [M+H] + ; 1 H NMR (500 MHz, DMSO-d 6 ): δ 8.83 (1H, d, J=1.9 Hz), 8.39 (1H, dd, J=1.9 Hz, 11.8 Hz), 8.23 (1H, d, J=2.6 Hz), 8.10 (1H, dd, J=2.7 Hz, 9.7 Hz), 7.71 (1H, d, J=9.7 Hz), 7.02 (1H, s), 4.03 (3H, s), 3.20 (4H, m), 2.94 (4H, m).

As shown in Table 1 below, additional compounds disclosed herein may be prepared according to Example 17 by substituting the appropriate starting materials, reagents and reaction conditions.

›Example 18

Preparation of Cpd 191

Step A: Following the procedure of Example 14, Part 3, Step A, 2-chloro-7-fluoro-4H-pyrido[1,2-a]pyrimidin-4-one (199 mg, 1 mmol, prepared in Example 14, Part 1), 1-methyl-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole (239.2 mg 1.15 mmol), Pd(PPh 3 ) 4 (57.8 mg, 0.05 mmol) and K 2 CO 3 (276.4 mg, 2 mmol) in CH 3 CN/H 2 O (1.0 mL/1.0 mL) gave 7-fluoro-2-(1-methyl-1H-pyrazol-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one (97.6 mg, 40%). MS m/z 245.1 [M+H] + .

Step B: Following the procedure of Example 14, Part 3, Step B, 7-fluoro-2-(1-methyl-1H-pyrazol-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one (48.8 mg, 0.2 mmol) and (S)-2-methylpiperazine (100 mg, 1 mmol) in DMSO (0.5 mL) gave the title compound (32.1 mg, 49.5%). M.P. 168-170° C.; MS m/z 325.2 [M+H] + ; 1 H NMR (500 MHz, DMSO-d 6 ): δ 8.35 (1H, s), 8.18 (1H, d, J=2.8 Hz), 8.06 (1H, s), 8.02 (1H, dd, J=9.7 Hz, 2.6 Hz), 7.56 (1H, d, J=9.8 Hz), 6.63 (1H, s), 3.89 (3H, s), 3.54-3.57 (2H, m), 2.99-3.02 (1H, m), 2.80-2.85 (2H, m), 2.58-2.64 (1H, m), 2.24-2.28 (1H, m), 1.05 (3H, d, J=6.3 Hz).

As shown in Table 1 below, additional compounds disclosed herein may be prepared according to Example 18 by substituting the appropriate starting materials, reagents and reaction conditions.

›Example 19

Preparation of Cpd 128

Step A: To a solution of 2-chloro-7-fluoro-4H-pyrido[1,2-a]pyrimidin-4-one (199 mg, 1.0 mmol, prepared in Example 14, Part 1) in 2 mL of acetonitrile were added 5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrrolo[2,3-b]pyridine (293 mg, 1.2 mmol), tetrakistriphenylphosphine Pd (0) (57.8 mg, 0.05 mmol) and aqueous K 2 CO 3 (1M in water, 2 mmol) at room temperature. The mixture was stirred at 85° C. for 3 hours and cooled to room temperature. The solid was filtered off and washed with dichloromethane, water and acetonitrile to give 7-fluoro-2-(1H-pyrrolo[2,3-b]pyridin-5-yl)-4H-pyrido[1,2-a]pyrimidin-4-one (249 mg, 89%). MS m/z 281.1 [M+H] + .

Step B: A solution of 7-fluoro-2-(1H-pyrrolo[2,3-b]pyridin-5-yl)-4H-pyrido[1,2-a]pyrimidin-4-one (100 mg, 0.36 mmol) in DMSO (1 mL) was treated with piperazine (154 mg, 1.79 mmol) at room temperature. The solution was stirred at 160° C. for 30 minutes and cooled to room temperature. The reaction mixture was loaded on silica gel without concentration and eluted with MeOH (0% to 20%) in CH 2 Cl 2 to provide the title compound (74.8 mg, 60%). M.P. 252-255° C.; MS m/z 347.1 [M+H] + ; 1 H NMR (DMSO-d 6 , 500 MHz) δ 11.8 (1H, s), 8.95 (1H, d, J=2.0 Hz)), 8.64 (1H, d, J=1.7 Hz), 8.14 (1H, d, J=2.3 Hz), 8.0-7.9 (1H, m), 7.62 (1H, d, J=9.6 Hz), 7.45 (1H, m), 6.9 (1H, s), 6.48 (1H, br. m). 3.1 (4H, m), 2.85 (4H, m).

As shown in Table 1 below, additional compounds disclosed herein may be prepared according to Example 19 by substituting the appropriate starting materials, reagents and reaction conditions.

›Example 20

Preparation of Cpd 153

Step A: 2-(3-Fluoro-4-hydroxyphenyl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one (180 mg, 0.53 mmol), prepared by Suzuki coupling according to the procedure in Example 14, Part 3, Step A, was combined with di-tert-butyl dicarbonate (131 mg, 0.6 mmol) and triethylamine (85 μL, 0.6 mmol) in MeOH (4 mL). The mixture was stirred at 50° C. for 2 hours. The mixture was filtered, leaving a yellow powder, which was washed with MeOH and dried under vacuum, affording tert-butyl 4-(2-(3-fluoro-4-hydroxyphenyl)-4-oxo-4H-pyrido[1,2-a]pyrimidin-7-yl)piperazine-1-carboxylate (230 mg, 99%). MS m/z 441.0 [M+H] + .

Step B: tert-Butyl 4-(2-(3-fluoro-4-hydroxyphenyl)-4-oxo-4H-pyrido[1,2-a]pyrimidin-7-yl)piperazine-1-carboxylate (60 mg, 0.14 mmol) was combined with K 2 CO 3 (39 mg, 0.28 mmol) and iodoethane (48 μL, 0.21 mmol) in DMF (1 mL). The mixture was stirred at 50° C. for 1 hour. After cooling to room temperature, H 2 O (0.5 mL) was added drop wise to the mixture. The precipitate was collected, washed with H 2 O, and dried under vacuum.

Step C: To the crude product from Step B was added trifluoroacetic acid (1 mL). After standing for 10 minutes, volatiles were removed. The residue was partitioned in CH 2 Cl 2 (4 mL) and aqueous K 2 CO 3 (1M, 2 mL). The organic layer was removed and concentrated, providing the title compound (36 mg, 70%). M.P. 180-186° C.; MS m/z 369.1 [M+H] + ; 1 H NMR (DMSO-d 6 , 500 MHz): δ 8.21 (1H, d, J=2.7 Hz), 8.02 (3H, m), 7.68 (1H, d, J=9.7 Hz), 7.27 (1H, t, J=8.8 Hz), 6.93 (1H, s), 4.20 (2H, q, J=7.0 Hz), 3.14 (4H, m), 2.88 (4H, m), 2.36 (1H, br), 1.39 (3H, t, J=7.0 Hz).

As shown in Table 1 below, additional compounds disclosed herein may be prepared according to Example 20 by substituting the appropriate starting materials, reagents and reaction conditions.

›Example 21

Preparation of Cpd 179

Step A: A mixture of 2-chloro-7-fluoro-4H-pyrido[1,2-a]pyrimidin-4-one (300 mg, 1.5 mmol) and 4-methyl-1H-imidazole (429 mg, 6.0 mmol) in DMSO (1.5 mL) was heated at 90° C. for 15 hours. The mixture was cooled to room temperature and diluted with CH 3 CN. The precipitate was filtered, washed with CH 3 CN (3×) and dried to give 2-(4-methyl-1H-imidazol-1-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one as an off-white solid (225 mg, 61%). MS m/z 345.4 [M+H] + .

Step B: A mixture of 2-(4-methyl-1H-imidazol-1-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one (73 mg, 0.3 mmol) and piperazine (129 mg, 1.5 mmol) in DMA (0.6 mL) was heated at 120° C. for 4 hours. The DMA was removed and the mixture was diluted with CH 3 CN. The precipitate was filtered, washed with CH 3 CN (3×) and dried to give the title compound as a yellow solid (310 mg, 95%). M.P. 204-206° C.; MS m/z 311.1 [M+H] + ; 1 H NMR (500 MHz, DMSO-d 6 ): δ 8.47 (1H, d, J=1.2 Hz), 8.22 (1H, d, J=2.7 Hz), 8.13 (1H, dd, J=2.8 Hz, 9.6 Hz), 7.69 (1H, d, J=1.1 Hz), 7.63 (1H, d, J=9.6 Hz), 6.68 (1H, s), 3.14 (4H, m), 2.87 (4H, m), 2.16 (3H, s).

As shown in Table 1 below, additional compounds disclosed herein may be prepared according to Example 21 by substituting the appropriate starting materials, reagents and reaction conditions.

›Example 22

Preparation of Cpd 143

Step A: Following the procedure in Example 1, Step A, methyl 3-(3,4-dimethoxyphenyl)-3-oxopropanoate (5.0 gram, 20 mmol), trimethylorthoformate (3.5 mL, 30 mmol) and p-toluenesulfonic acid monohydrate (380 mg, 2 mmol) in methanol (50 mL) provided methyl 3-(3,4-dimethoxyphenyl)-3,3-dimethoxypropanoate. The crude product was used directly in the next step without purification. 1 H NMR (DMSO-d 6 , 500 MHz): δ 6.93 (3H, m), 3.82 (2H, q, J=7.2 Hz), 3.75 (3H, s), 3.73 (3H, s), 3.12 (6H, s), 2.92 (2H, s), 0.92 (3H, t, J=7.1 Hz).

Step B: To the above ketal intermediate was added 5-bromopyridin-2-amine (3.5 g, 20 mmol). The mixture was heated to 150° C. for 2 hours, then cooled to room temperature. The crude product was triturated with acetonitrile and filtered to provide the title compound as a white solid (6.8 gram, 94%). MS m/z 360.9 [M+H] + , 362.9 [M+2+H] + .

Step C: Following the procedure in Example 14, Part 3, Step A, 7-bromo-2-(3,4-dimethoxyphenyl)-4H-pyrido[1,2-a]pyrimidin-4-one (181 mg, 0.5 mmol), tert-butyl 4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-5,6-dihydropyridine-1(2H)-carboxylate (170 mg, 0.55 mmol), potassium carbonate (207 mg, 1.5 mmol) and Pd(dppf)Cl 2 (36.5 mg, 0.05 mmol) in acetonitrile (2 mL) provided tert-butyl 4-(2-(3,4-dimethoxyphenyl)-4-oxo-4H-pyrido[1,2-a]pyrimidin-7-yl)-5,6-dihydropyridine-1(2H)-carboxylate as a white solid (0.22 mg, 95%). MS m/z 464.1 [M+H] + ; 1 H NMR (500 MHz, DMSO-d 6 ) δ 8.82 (s, 1H), 8.24 (dd, J=1.5, 9 Hz, 1H), 7.85 (dd, J=2, 8.5 Hz, 1H), 7.78 (d, J=2 Hz, 1H), 7.73 (d, J=9.5 Hz, 1H), 7.10 (d, J=9 Hz, 1H), 7.05 (s, 1H), 6.54 (s, 1H), 4.09 (bs, 2H), 3.89 (s, 3H), 3.85 (s, 3H), 3.60-3.59 (m, 2H), 2.64-2.63 (m, 2H), 1.45 (s, 9H).

Step D: The intermediate obtained from Step A was suspended in a solution of HCl in dioxane (4M, 4 mL). The reaction mixture was stirred at room temperature for 2 hours. The mixture was concentrated and the residue was partitioned between dichloromethane and saturated aqueous sodium bicarbonate. The organics were dried, concentrated and chromatographed on a basic alumina column, eluting with dichloromethane with methanol (10%) to provide the title compound as a white solid (150 mg, 88%). M.P. 196-198° C.; MS m/z 364.1 [M+H] + ; 1 H NMR (500 MHz, DMSO-d 6 ) δ 8.77 (d, J=2 Hz, 1H), 8.24 (dd, J=2, 9.5 Hz, 1H), 7.85 (dd, J=2, 8.5 Hz, 1H), 7.78 (d, J=2 Hz, 1H), 7.71 (d, J=9.5 Hz, 1H), 7.09 (d, J=8.5 Hz, 1H), 7.03 (s, 1H), 6.60 (s, 1H), 3.89 (s, 3H), 3.85 (s, 3H), 3.45 (d, J=2.5 Hz, 2H), 2.97 (t, J=5.5 Hz, 2H), 2.41 (bs, 2H).

As shown in Table 1 below, additional compounds disclosed herein may be prepared according to Example 22 by substituting the appropriate starting materials, reagents and reaction conditions.

›Example 23

Preparation of Cpd 188

A mixture of 2-(3,4-dimethoxyphenyl)-7-(1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one (30 mg, 0.08 mmol), formaldehyde (0.05 mL, 37%, ˜0.8 mmol) and sodium triacetoxyborohydride (50 mg, 0.24 mmol) was stirred in dichloromethane (1 mL) for 2 hr. The reaction mixture was diluted with dichloromethane and neutralized with sodium bicarbonate. The organics were dried and concentrated to provide the title compound as a white solid (26 mg, 83%). M.P. 165-168° C.; MS m/z 378.4 [M+H] + ; 1 H NMR (500 MHz, DMSO-d 6 ) δ 8.79 (d, J=2 Hz, 1H), 8.25 (dd, J=2, 9.5 Hz, 1H), 7.85 (dd, J=2, 8.5 Hz, 1H), 7.78 (d, J=2 Hz, 1H), 7.71 (d, J=9.5 Hz, 1H), 7.10 (d, J=8.5 Hz, 1H), 7.04 (s, 1H), 6.56 (s, 1H), 3.89 (s, 3H), 3.85 (s, 3H), 3.09 (bs, 2H), 2.64-2.61 (m, 2H), 2.56 (bs, 2H), 2.51 (s, 3H).

As shown in Table 1 below, additional compounds disclosed herein may be prepared according to Example 23 by substituting the appropriate starting materials, reagents and reaction conditions.

›Example 24

Preparation of Cpd 144

Step A: A mixture of tert-butyl 4-(2-(3,4-dimethoxyphenyl)-4-oxo-4H-pyrido[1,2-a]pyrimidin-7-yl)-5,6-dihydropyridine-1(2H)-carboxylate (100 mg, 0.22 mmol, prepared as depicted in Example 22, Step C) and Pd/C (10%) (10 mg) in ethyl acetate (25 mL) was stirred under 1 atmosphere of hydrogen overnight. The reaction mixture was filtered through celite, concentrated and chromatographed on a silica column, eluting with EtOAc/CH 2 Cl 2 (30/70) to provide tert-butyl 4-(2-(3,4-dimethoxyphenyl)-4-oxo-4H-pyrido[1,2-a]pyrimidin-7-yl)piperidine-1-carboxylate as a white solid (75 mg, 75%), which was used directly in the next step without further purification. MS m/z 466.4 [M+H] + ; 1 H NMR (500 MHz, DMSO-d 6 ) δ 8.57 (s, 1H), 7.80 (dd, J=2.5, 9.5 Hz, 1H), 7.64 (dd, J=2, 8.5 Hz, 1H), 7.57 (d, J=2 Hz, 1H), 7.53 (d, J=9 Hz, 1H), 6.9 (d, J=9 Hz, 1H), 6.82 (s, 1H), 3.92 (bs, 2H), 3.69 (s, 3H), 3.65 (s, 3H), 2.78-2.71 (m, 2H), 2.69-2.65 (1H, m), 1.69-1.67 (m, 2H), 1.41-1.38 (m, 2H), 1.24 (s, 9H).

Step B: Following the procedure in Example 22, Step D, the above product from Step A and HCl in dioxane (4M, 3 mL) provided the title compound as a white solid (49 mg, 83%). M.P. 214-217° C.; MS m/z 366.4 [M+H] + ; 1 H NMR (500 MHz, DMSO-d 6 ) δ 8.88 (d, J=2 Hz, 1H), 8.09 (dd, J=2, 9.5 Hz, 1H), 7.98 (dd, J=2, 8.5 Hz, 1H), 7.91 (d, J=2 Hz, 1H), 7.88 (d, J=9 Hz, 1H), 7.23 (d, J=8.5 Hz, 1H), 7.15 (s, 1H), 4.02 (s, 3H), 3.98 (s, 3H), 3.30 (d, J=11.5 Hz, 2H), 3.01 (tt, J=2 Hz, 12 Hz, 1H), 2.87 (t, J=12 Hz, 2H), 2.02 (d, J=12.5 Hz, 2H), 1.80-1.73 (m, 2H).

›Example 25

Preparation of Cpd 164

Following the procedure in Example 23, 2-(3,4-dimethoxyphenyl)-7-(piperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one (10 mg, 0.027 mmol), formaldehyde (10 μL, 37%, 0.13 mmol) and sodium triacetoxyborohydride (17 mg, 5.7 mmol) in dichloromethane (0.5 mL) provided the title compound as a white solid (7.6 mg, 73%). M.P. 181-183° C.; MS m/z 380.1 [M+H] + ; 1 H NMR (500 MHz, DMSO-d 6 ) δ 8.76 (d, J=2 Hz, 1H), 8.0 (dd, J=2, 9 Hz, 1H), 7.84 (dd, J=2, 8.5 Hz, 1H), 7.77 (d, J=2 Hz, 1H), 7.72 (d, J=9.5 Hz, 1H), 7.09 (d, J=8.5 Hz, 1H), 7.01 (s, 1H), 3.89 (s, 3H), 3.84 (s, 3H), 2.91 (d, J=9.5 Hz, 2H), 2.73-2.64 (m, 1H), 2.22 (s, 3H), 2.01 (t, J=8.5 Hz, 2H), 1.88-1.85 (m, 2H), 1.71-1.69 (m, 2H).

As shown in Table 1 below, additional compounds disclosed herein may be prepared according to Example 25 by substituting the appropriate starting materials, reagents and reaction conditions.

›Example 26

Preparation of Cpd 263

Part 1: Following the procedure in Example 14, Part 2,7-Bromo-2-(3,4-dimethoxyphenyl)-4H-pyrido[1,2-a]pyrimidin-4-one (661 mg, 1.8 mmol), prepared in Example 22, Step B, KOAc (530 mg, 5.4 mmol), bis(pincolato)diboron (700 mg, 2.7 mmol), and Pd(dppf)Cl 2 (60 mg, 0.09 mmol) in dioxane (5 mL) provided 2-(3,4-dimethoxyphenyl)-7-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one as a white solid (560 mg, 76%). MS m/z 327.1 [M+H] + for boronic acid.

Part 2: To a solution of tert-butyl 3-oxopiperidine-1-carboxylate (482 mg, 2.4 mmol) in 2-methyltetrahydrofuran (2.5 mL) was added drop wise a solution of sodium bis(trimethylsilyl)amide (2.6 mL, 2.6 mmol, 1.0M in THF) at −78° C. under argon. The mixture was stirred at −78° C. for 1 hr, followed by the addition of a solution of N-(5-chloropyridin-2-yl)-1,1,1-trifluoro-N-(trifluoromethylsulfonyl)-methanesulfonamide (1.0 gram, 2.5 mmol) in 2-methyltetrahydrofuran (2.5 mL), and then the reaction was allowed to warm to room temperature over 2 hours. After stirring at room temperature overnight, the reaction was quenched with saturated aqueous sodium carbonate, diluted with ether, and the organics were washed with water, dried and concentrated. The crude product was chromatographed on a basic alumina column, eluting with 5% ethyl acetate in hexane to provide the title compound as a colorless oil (290 mg, 37%).

Part 3, Step A: Following the procedure of Example 14, Part 3, Step A, 2-(3,4-dimethoxyphenyl)-7-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one (370 mg, 0.91 mmol), tert-butyl 3-(trifluoromethylsulfonyloxy)-5,6-dihydropyridine-1(2H)-carboxylate (290 mg, 0.88 mmol), potassium carbonate (364 mg, 2.6 mmol) and Pd(dppf)Cl 2 (58 mg, 0.08 mmol) in acetonitrile (4 mL) provided tert-butyl 3-(2-(3,4-dimethoxyphenyl)-4-oxo-4H-pyrido[1,2-a]pyrimidin-7-yl)-5,6-dihydropyridine-1(2H)-carboxylate as a white solid (0.22 mg, 62%). MS m/z 464.3 [M+H] + .

Part 3, Step B: Following the procedure in Example 22, Step B, tert-butyl 3-(2-(3,4-dimethoxyphenyl)-4-oxo-4H-pyrido[1,2-a]pyrimidin-7-yl)-5,6-dihydropyridine-1(2H)-carboxylate (220 mg, 0.47 mmol) and HCl in dioxane (4M, 5 mL) provided the title compound (160 mg, 79%). M.P. 146-150° C.; MS m/z 364.2 [M+H] + ; 1 H NMR (500 MHz, DMSO-d 6 ) δ 8.73 (d, J=2 Hz, 1H), 8.23 (dd, J=2, 9.5 Hz, 1H), 7.85 (dd, J=2, 8.5 Hz, 1H), 7.78 (d, J=2.5 Hz, 1H), 7.71 (d, J=9.5 Hz, 1H), 7.10 (d, J=8.5 Hz, 1H), 7.05 (s, 1H), 6.60 (s, 1H), 3.89 (s, 3H), 3.85 (s, 3H), 3.29 (bs, 2H), 2.40-2.36 (m, 4H).

›Example 27

Preparation of Cpd 237

Step A: NaH (60% dispersion in mineral oil, 12 mg, 0.3 mmol) was added slowly to 1-Boc-4-hydroxypiperidine (48.3 mg, 0.24 mmol) in anhydrous THF at room temperature. The reaction mixture was stirred at room temperature for 10 minutes, and 2-(3,4-dimethoxyphenyl)-7-F-4H-pyrido[1,2-a]pyrimidin-4-one (60 mg, 0.2 mmol) was added. The reaction mixture was then heated at 70° C. for 3 hours. A small amount of ice water was added to quench the reaction. After most of the THF was evaporated, ether was added to the mixture, and the precipitate was filtered and dried to provide tert-butyl 4-(2-(3,4-dimethoxyphenyl)-4-oxo-4H-pyrido[1,2-a]pyrimidin-7-yloxy)piperidine-1-carboxylate, which was used in the next step without further purification.

Step B: tert-Butyl 4-(2-(3,4-dimethoxyphenyl)-4-oxo-4H-pyrido[1,2-a]pyrimidin-7-yloxy)piperidine-1-carboxylate was dissolved into CH 2 Cl 2 /TFA (0.5 mL/0.5 mL) at 0° C. The mixture was stirred at 0° C. for 2 hours, until the starting material disappeared. After most of the TFA was evaporated, ice cold saturated NaHCO 3 was added to the reaction mixture. The mixture was extracted with CH 2 Cl 2 . The organic layer was dried over MgSO 4 and concentrated to provide the title compound (57 mg, 74.8% for 2 steps). M.P. 221-224° C.; MS m/z 382.2 [M+H] + ; 1 H NMR (500 MHz, DMSO-d 6 ): δ 8.58 (1H, d, J=2.9 Hz), 7.81-7.86 (2H, m), 7.73-7.78 (2H, m), 7.08 (1H, d, J=8.7 Hz), 7.01 (1H, s), 4.82-4.86 (1H, m), 3.87 (3H, s), 3.83 (3H, s), 3.23-3.27 (2H, m), 3.04-3.09 (2H, m), 2.13-2.18 (2H, m), 1.85-1.91 (2H, m).

As shown in Table 1 below, additional compounds disclosed herein may be prepared according to Example 27 by substituting the appropriate starting materials, reagents and reaction conditions.

›Example 28

Preparation of Cpd 52

Step A: Ethyl 2-(3,4-dimethoxyphenyl)acetate (673 mg, 3 mmol) was combined with 1-tert-butoxy-N,N,N′,N′-tetramethylmethanediamine (0.68 mL, 3.3 mmol). The mixture was heated to 60° C. for 2 hours. The mixture was used directly in the next step without work-up.

Step B: 4-Chloropyridin-2-amine (424 mg, 3.3 mmol) was added directly to the mixture. The mixture was heated to 120° C. for 20 minutes. The mixture was used directly in the next step without work-up.

Step C: piperazine (1.3 g, 15 mmol) was added to the mixture from Step B, which stirred for an additional 30 minutes at 120° C. The mixture was chromatographed on silica with 10% MeOH (1% triethylamine) in CH 2 Cl 2 affording the title compound as a yellow powder (120 mg, 11%). M.P. 175-179° C.; MS m/z 367.2 [M+H] + ; 1 H NMR (DMSO-d 6 , 500 MHz): δ 8.84 (1H, d, J=8.2 Hz), 8.40 (1H, s), 7.44 (1H, d, J=2.1 Hz), 7.34 (1H, dd, J=8.4 Hz, 2.1 Hz), 7.28 (1H, dd, J=8.2 Hz, 2.8 Hz), 6.99 (1H, d, J=8.5 Hz), 6.73 (1H, d, J=2.8 Hz), 3.80 (3H, s), 3.78 (3H, s), 3.48 (4H, m), 2.82 (4H, m).

›Example 29

Preparation of Cpd 220

Step A: 7-Bromo-2-chloro-4H-pyrido[1,2-a]pyrimidin-4-one (130 mg, 0.5 mmol), prepared according to Example 14, Part 1, was combined with tert-butyl piperazine-1-carboxylate (140 mg, 0.75 mmol) and triethylamine (0.14 mL, 1.0 mmol) in EtOH (2 mL). The mixture was heated to 80° C. for 1 hour. The reaction mixture was cooled to room temperature, and then filtered. The collected material was chromatographed on silica with 0% to 50% EtOAc in CH 2 Cl 2 , providing tert-butyl 4-(7-bromo-4-oxo-4H-pyrido[1,2-a]pyrimidin-2-yl)piperazine-1-carboxylate (130 mg, 64%). MS m/z 409.4 [M+H] + .

Step B: The intermediate (0.3 mmol) from Step A was combined with 3-fluoro-4-methoxyphenylboronic acid (77 mg, 0.45 mmol) and tetrakis(triphenylphosphine) palladium(0) (35 mg, 0.03 mmol) in CH 3 CN (2 mL) and aqueous K 2 CO 3 (1M, 2 mL). The mixture was heated at 80° C. with vigorous stirring under argon for 2 hours. The organic layer was removed and concentrated. The residue was chromatographed on silica with 0% to 50% EtOAc in CH 2 Cl 2 .

Step C: The Boc-protected intermediate from Step B was dissolved in trifluoroacetic acid (1 mL). After 20 minutes, volatiles were removed. The residue was partitioned in CH 2 Cl 2 and aqueous K 2 CO 3 (1M). The organic layer was removed and concentrated, affording the title compound as a white powder (30 mg, 17%). M.P. 202-206° C.; MS m/z 355.0 [M+H] + ; 1 H NMR (DMSO-d 6 , 500 MHz): δ 8.93 (1H, d, J=2.0 Hz), 8.15 (1H, dd, J=9.3 Hz, 2.3 Hz), 7.67 (1H, dd, J=12.7 Hz, 2.3 Hz), 7.54 (1H, m), 7.37 (1H, d, J=9.2), 7.30 (1H, t, J=8.8 Hz), 5.62 (1H, s), 3.90 (3H, s), 3.57 (4H, m), 2.75 (4H, m), 2.42 (1H, br s).

As shown in Table 1 below, additional compounds disclosed herein may be prepared according to Example 29 by substituting the appropriate starting materials, reagents and reaction conditions.

›Example 30

Preparation of Cpd 276

Step A. 7-Bromo-2-chloro-4H-pyrido[1,2-a]pyrimidin-4-one (1.29 g, 5 mmol) was combined with 3-fluoro-4-methoxyphenylboronic acid (850 mg, 5 mmol), tetrakis(triphenylphosphine) palladium(0) (281 mg, 0.25 mmol), CH 3 CN (10 mL) and aqueous K 2 CO 3 (1M, 10 mL). The mixture was heated to 80° C. for 6 hours. After cooling to room temperature, the mixture was partitioned in CH 2 Cl 2 (75 mL) and H 2 O (50 mL). The organic layer was collected and concentrated. The residue was chromatographed on silica, eluting with EtOAc (0% to 50%) in CH 2 Cl 2 , to afford 2-chloro-7-(3-fluoro-4-methoxyphenyl)-4H-pyrido[1,2-a]pyrimidin-4-one as a white powder (520 mg, 34%). MS m/z 305.0 [M+H] + .

Step B. 2-Chloro-7-(3-fluoro-4-methoxyphenyl)-4H-pyrido[1,2-a]pyrimidin-4-one (180 mg, 0.6 mmol) was combined with 4-aminopiperidine (90 mg, 0.9 mmol) and triethylamine (165 μL, 1.2 mmol) in DMSO (0.75 mL). The mixture was heated to 120° C. for 30 minutes. After cooling to room temperature, CH 3 CN (2 mL) was added to the mixture. The mixture was filtered. The collected material was washed with CH 3 CN and dried under vacuum, affording the title compound as a white powder (115 mg, 52%). M.P. 268-283° C.; MS m/z 369.3 [M+H] + ; 1 H NMR (DMSO-d 6 , 500 MHz): δ 8.94 (1H, d, J=2.0 Hz), 8.16 (1H, dd, J=9.3 Hz, 2.3 Hz), 7.68 (1H, dd, J=12.7 Hz, 2.3 Hz), 7.55 (1H, d, J=8.5 Hz), 7.39 (1H, d, J=9.2), 7.30 (1H, t, J=8.9 Hz), 5.70 (1H, s), 5.20 (2H, br), 4.36 (2H, br), 3.92 (3H, s), 3.04 (3H, m), 1.87 (2H, m), 1.32 (2H, m).

As shown in Table 1 below, additional compounds disclosed herein may be prepared according to Example 30 by substituting the appropriate starting materials, reagents and reaction conditions.

›Example 31

Preparation of Cpd 85

Part 1, Step A: To a suspension of MgCl 2 (2.85 g, 30 mmol) in acetonitrile (27 mL) at 0° C. was added dropwise diethyl malonate (3.4 mL, 30 mmol) and triethylamine (8.3 mL, 60 mmol). The mixture was stirred at 0° C. for 30 minutes. 3,4-dimethoxybenzoyl chloride (5.0 g, 25 mmol) was then added portionwise. The mixture was allowed to stir at room temperature overnight, after which it was treated with 1N HCl, extracted with ether, dried and evaporated. The residue was purified on silica with ethyl acetate (5% to 40%) in hexanes to give dimethyl 2-(3,4-dimethoxybenzoyl)malonate (7.38 g, 100%). MS m/z 297.1 [M+H] + .

Part 1, Step B: To a solution of dimethyl 2-(3,4-dimethoxybenzoyl)malonate (2.96 g, 10 mmol) in POCl 3 (9.4 mL, 100 mmol) at room temperature was added DIPEA (2.75 mL, 16.7 mmol) dropwise. The mixture was then stirred at 100° C. for 3 hours. POCl 3 was removed under vacuum and the residue was treated with ice-water and extracted with ether. The organic layer was washed with 1N HCl, dried and evaporated. The residue was purified on silica with ethyl acetate (5% to 50%) in hexanes to give the title compound (2.0 g, 64%). MS m/z 282.9 [M+H] + .

Part 2: To a solution of LDA (1.5 M, 13.3 mL, 20 mmol) in THF (15 mL) at −78° C. was added dropwise a solution of 2,5-difluoropyridine (1.15 g, 10 mmol) in THF (10 mL). The temperature was then allowed to rise to room temperature, and the mixture was stirred at room temperature for 2 hours before the reaction was quenched with aqueous NH4Cl. The mixture was extracted with ethyl acetate, dried, and evaporated. The residue was purified on silica with ethyl acetate (5% to 50%) in hexanes to give 2-(5-fluoropyridin-2-yl)acetonitrile (0.8 g, 59%). MS m/z 137.0 [M+H] + .

Part 3, Step A: To a solution of 2-(5-fluoropyridin-2-yl)acetonitrile (44 mg, 0.325 mmol) in DMF (0.5 mL) was added 60% NaH (20 mg, 0.325 mmol). The mixture was stirred at room temperature for 10 minutes and then treated with dimethyl 2-(chloro(3,4-dimethoxyphenyl)methylene)malonate (102 mg, 0.325 mmol). The mixture was stirred for 15 minutes, and the reaction was quenched with saturated NH 4 Cl solution. The mixture was filtered. The solid was washed with water and used directly in the next step without further purification.

Part 3, Step B: The crude solid from Step A was treated with TFA (2.0 mL) and water (0.2 mL). The mixture was stirred at 100° C. overnight. The solvent was then removed under vacuum and the crude product was used in the next step without further purification.

Part 3, Step C: The crude product from Step B was heated with piperazine (86 mg, 1.0 mmol) in DMSO (1.0 mL) at 120° C. overnight. Removal of the solvent by N 2 followed by purification over silica with methanol (10%) in dichloromethane provided the title compound (30 mg, 25%). M.P. 199-202° C.; MS m/z 391.2 [M+H] + ; 1 H NMR (500 MHz, CDCl 3 ) δ: 8.60 (1H, d, J=2.2 Hz), 7.98 (1H, d, J=9.8 Hz), 7.59 (1H, dd, J=9.5, 2.5 Hz), 7.20 (1H, dd, J=8.5, 2.2 Hz), 7.12 (1H, d, J=2.2 Hz), 6.93 (1H, d, J=8.2 Hz), 6.52 (1H, s), 3.89 (3H, s), 3.88 (3H, s), 3.23-3.21 (4H, m), 3.05-3.03 (4H, m).

›Example 32

Preparation of Cpd 91

Step A: To a solution of 2-(5-fluoropyridin-2-yl)acetonitrile (0.78 g, 5.7 mmol) in MeOH (15 mL) was added trimethysilyl chloride (4.4 mL, 34.4 mmol) dropwise. The mixture was stirred at 50° C. overnight. Organic volatiles were removed under vacuum and the residue was partitioned between ether and aqueous sodium bicarbonate. The aqueous layer was extracted with ether. The ether extractions were combined, dried and evaporated to give methyl 2-(5-fluoropyridin-2-yl)acetate as an oil (0.9 g, 93%), which was used without further purification. MS m/z 170.1 [M+H] + .

Step B: Following the procedure in Example 31, Part 3, Step A, methyl 2-(5-fluoropyridin-2-yl)acetate (0.34 g, 2.0 mmol), 60% NaH (176 mg, 4.4 mmol) and dimethyl 2-(chloro(3,4-dimethoxyphenyl)methylene)malonate (0.69 g, 2.2 mmol, prepared in Example 31, Part 1, Step B) in DMF (3.0 mL) provided the desired dimethyl 2-(3,4-dimethoxyphenyl)-7-fluoro-4-oxo-4H-quinolizine-1,3-dicarboxylate (0.2 g, 24%). MS m/z 416.1 [M+H] + .

Step C: A solution of dimethyl 2-(3,4-dimethoxyphenyl)-7-fluoro-4-oxo-4H-quinolizine-1,3-dicarboxylate (0.2 g, 0.48 mmol) in methanol (6.0 mL) was treated with aqueous LiOH (2.0 N, 2.0 mL, 4.0 mmol) and stirred at 90° C. for 2 hours. Aqueous workup followed by evaporation provided a dark residue, which was treated with TFA (2.0 mL) and water (0.2 mL) and stirred at 100° C. for 1 hour. Removal of the solvents by N 2 followed by chromatography with ethyl acetate (25% to 75%) in hexanes provided 2-(3,4-dimethoxyphenyl)-7-fluoro-4H-quinolizin-4-one (30 mg, 21%). MS m/z 300.2 [M+H] + .

Step D: A solution of 2-(3,4-dimethoxyphenyl)-7-fluoro-4H-quinolizin-4-one (30 mg, 0.1 mmol), (S)-2-methyl piperazine (30 mg, 0.3 mmol) and K 2 CO 3 (27 mg, 0.2 mmol) in DMSO (0.2 mL) was stirred at 120° C. for 48 hours. Removal of the solvents by N 2 followed by purification by dichloromethane and methanol (10%) provided the title compound (24 mg, 63%). M.P. 243-245° C.; MS m/z 380.2 [M+H] + ; 1 H NMR (500 MHz, CDCl 3 ) δ: 8.52 (1H, d, J=2.2 Hz), 7.46 (1H, d, J=9.8 Hz), 7.30 (2H, dt, J=10.4, 2.2 Hz), 7.22 (1H, d, J=1.9 Hz), 6.98 (1H, d, J=8.5 Hz), 6.84 (2H, s), 3.96 (3H, s), 3.95 (3H, s), 3.58-3.54 (2H, m), 3.50 (1H, s), 3.21-3.19 (1H, m), 3.12-3.04 (2H, m), 2.85-2.80 (1H, m), 2.49 (1H, t, J=11.1 Hz), 1.20 (3H, d, J=6.6 Hz).

›Example 33

Preparation of Cpd 106

Step A: To a mixture of Pd 2 (dba) 3 (0.55 g, 0.6 mmol) and DavePhos (0.50 g, 1.26 mmol) in toluene (40 mL) at room temperature under an argon atmosphere was added a solution of LHMDS in hexane (1.0 M×50 mL, 50 mmol) dropwise. The mixture was stirred for 10 minutes and then cooled to −10° C., into which tert-butyl acetate (6.2 mL, 46 mmol) was added and stirred for another 10 minutes. 2-Bromo-5-fluoropyridine (3.52 g, 20 mmol) was then added portionwise. Upon completion of the addition, the temperature was allowed to rise to room temperature and the mixture was stirred for another 1 hour. The reaction was then quenched by saturated NH 4 Cl solution. Aqueous workup followed by chromatography with ethyl acetate (0% to 20%) in hexanes provided tert-butyl 2-(5-fluoropyridin-2-yl)acetate (2.6 g, 62%).

Step B: Following the procedure in Example 31 Part 3, Step A, tert-butyl 2-(5-fluoropyridin-2-yl)acetate, 60% NaH (80 mg, 2.0 mmol) and dimethyl 2-(chloro(3,4-dimethoxyphenyl)-methylene)malonate (0.32 g, 1.0 mmol, prepared in Example 31, Part 2, Step B) in DMF (1.0 mL) provided 1-tert-butyl 3-methyl 2-(3,4-dimethoxyphenyl)-7-fluoro-4-oxo-4H-quinolizine-1,3-dicarboxylate. The crude solid was used directly in the next step without purification.

Step C: Following the procedure in Example 31 Part 3, Step B, The crude solid from Step B, TFA (5 mL) and water (2 mL) provided 2-(3,4-dimethoxyphenyl)-7-fluoro-4H-quinolizin-4-one (145 mg, 48%). MS m/z 300.2 [M+H] + .

Step D: Following the procedure in Example 31 Part 3, Step C, 2-(3,4-dimethoxyphenyl)-7-fluoro-4H-quinolizin-4-one (75 mg, 0.25 mmol) and piperazine (75 mg, 0.87 mmol) in DMSO (0.5 mL) provided the title compound (30 mg, 33%). M.P. 170-172° C.; MS m/z 366.1 [M+H] + ; 1 H NMR (500 MHz, CDCl 3 ) δ: 8.53 (1H, d, J=2.2 Hz), 7.46 (1H, d, J=9.5 Hz), 7.32-7.27 (2H, m), 7.22 (1H, d, J=1.9 Hz), 6.97 (1H, d, J=8.5 Hz), 6.84 (2H, s), 3.98 (3H, s), 3.95 (3H, s), 3.25-3.20 (4H, m), 3.13-3.07 (4H, m).

As shown in Table 1 below, additional compounds disclosed herein may be prepared according to Example 33 by substituting the appropriate starting materials, reagents and reaction conditions.

›Example 34

Preparation of Cpd 245

Step A: A mixture of 5-bromo-2-iodopyridine (2.84 g, 10 mmol), tert-butyl ethyl malonate (3.76 g, 20 mmol), Cs 2 CO 3 (9.77 g, 30 mmol), CuI (0.19 g, 1.0 mmol) and 2-nicotinic acid (0.246 g, 2.0 mmol) in dioxane (20 mmol) was stirred at 90° C. overnight under nitrogen atmosphere. The mixture was then treated with water, extracted with ethyl acetate, dried and evaporated. The residue was dissolved in MeOH (100 mL) and water (40 mL) and NaOH (1.2 g, 30 mmol) were added. The mixture was stirred at room temperature for 3 hours, then acidified with 1N HCl to pH 4, extracted with ethyl acetate, dried and chromatographed with ethyl acetate (10% to 50%) in hexanes to give tert-butyl 2-(5-bromopyridin-2-yl)acetate (1.2 g, 44%).

Step B: Following the procedure in Example 33, Step B and C, tert-butyl 2-(5-bromopyridin-2-yl)acetate (0.54 g, 2.0 mmol) was treated with NaH (60% in mineral oil, 0.16 g, 4.0 mmol) in DMF (2.0 mL) followed by reaction with 2-(chloro(3,4-dimethoxyphenyl)methylene)malonate (2.0 mmol). Deprotection and decarboxylation in TFA (5.0 mL) and water (2.0 mL) at 100° C. afforded 7-bromo-2-(3,4-dimethoxyphenyl)-4H-quinolizin-4-one (0.17 g, 68%). MS m/z 360.1 [M+H] + , 362.0 [M+2+H] + .

Step C: A mixture of 7-bromo-2-(3,4-dimethoxyphenyl)-4H-quinolizin-4-one (0.17 g, 0.47 mmol), tert-butyl 4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-5,6-dihydropyridine-1(2H)-carboxylate (0.18 g, 0.57 mmol), PdCl 2 dppf (38 mg, 0.047 mmol), K 2 CO 3 (2.0 M×0.75 mL, 1.5 mmol) in acetonitrile (1.5 mL) was stirred at 100° C. for 16 hours. The mixture was then treated with water, extracted with dichloromethane, dried and chromatographed with ethyl acetate (20% to 100%) in dichloromethane to give tert-butyl 4-(2-(3,4-dimethoxyphenyl)-4-oxo-4H-quinolizin-7-yl)-5,6-dihydropyridine-1(2H)-carboxylate (0.16 g, 73%). MS m/z 463.3 [M+H] + .

Step D: tert-butyl 4-(2-(3,4-dimethoxyphenyl)-4-oxo-4H-quinolizin-7-yl)-5,6-dihydropyridine-1(2H)-carboxylate (80 mg, 0.17 mmol) was treated with dichloromethane (1.0 mL) and TFA (1.0 mL) and stirred at room temperature for 1 hour. The mixture was then evaporated, treated with dichloromethane and washed with saturated aqueous sodium bicarbonate solution. The organic layer was dried and evaporated to give the title compound (63 mg, 100%). M.P. 174-176° C.; MS m/z 363.2 [M+H] + ; 1 H NMR (500 MHz, CDCl 3 ) δ: 9.04 (1H, s), 7.53 (1H, dd, J=9.2, 1.9 Hz), 7.47 (1H, d, J=9.2 Hz), 7.31 (1H, dd, J=8.5, 2.2 Hz), 7.23 (1H, d, J=2.2 Hz), 6.99 (1H, J=8.2 Hz), 6.86 (2H, br s), 6.36 (1H, s), 3.99 (3H, s), 3.97 (3H, s), 3.67-3.60 (2H, m), 3.24-3.13 (2H, m), 2.62-2.55 (2H, m), 2.21 (1H, br s).

›Example 35

Preparation of Cpd 249

Following the procedure in Example 23, 2-(3,4-dimethoxyphenyl)-7-(1,2,3,6-tetrahydropyridin-4-yl)-4H-quinolizin-4-one (30 mg, 0.083 mmol), sodium triacetoxyborohydride (53 mg, 0.25 mmol) and aqueous solution of formaldehyde (30%, 14 μL, 0.166 mmol) in 10% methanol in dichloromethane (1.0 mL) gave the title compound (26 mg, 83%). M.P. 194-196° C.; MS m/z 377.2 [M+H] + ; 1 H NMR (500 MHz, CDCl 3 ) δ: 9.03 (1H, s), 7.51-7.44 (2H, m), 7.29 (1H, dd, J=8.5, 2.2 Hz), 7.21 (1H, d, J=1.9 Hz), 6.98 (1H, J=8.2 Hz), 6.87-6.82 (2H, m), 6.26 (1H, s), 3.98 (3H, s), 3.95 (3H, s), 3.48 (2H, br s), 3.06-2.97 (2H, m), 2.90-2.80 (2H, m), 2.65 (3H, s).

›Example 36

Preparation of Cpd 306

Part 1, Step A: To a solution of 2-(benzyloxy)-4-bromo-6-fluoroaniline (3.74 g, 12.6 mmol) in THF (25 mL), prepared from 1,3-difluoro-2-nitrobenzene in 3 steps according to known procedures (WO2007/067612), was added PtO 2 (0.23 g, 1.0 mmol). After stirring under hydrogen (1 atm, balloon) at room temperature for 23 hours, the mixture was filtered through celite. The filtrate was concentrated to give 2-amino-5-bromo-3-fluorophenol as a brown solid, which was used in the next step without further purification. MS m/z 206.1 [M+H] + , 208.0 [M+2+H] + .

Part 1, Step B: To a solution of the crude 2-amino-5-bromo-3-fluorophenol from Step A in 1,1,1-triethoxyethane (10 mL) was added TFA (0.96 mL, 12.6 mmol) at room temperature. After 15 hours, the mixture was neutralized with Na 2 CO 3 and filtered. The filtrated was concentrated and chromatographed with CH 2 Cl 2 to give 6-bromo-4-fluoro-2-methylbenzo[d]oxazole as a tan solid (2.531 g, 88%). MS m/z 230.0 [M+H] + , 232.1 [M+2+H] + .

Part 1, Step C: A mixture of 6-bromo-4-fluoro-2-methylbenzo[d]oxazole (2.531 g, 11.0 mmol), 4,4,4′,4′,5,5,5′,5′-octamethyl-2,2′-bi(1,3,2-dioxaborolane) (3.087 g, 12.2 mmol), KOAc (3.25 g, 33.2 mmol) and Pd(dppf)Cl 2 .CH 2 Cl 2 (449 mg, 0.55 mmol) in dioxane (25 mL) was degassed and heated under N 2 at 85° C. After 15 hours, LC-MS indicated disappearance of the starting material and the products as a mixture of boronic acid and boronic pinacol ester in a ratio of ˜2/1:boronic acid product:MS m/z 196.1 [M+H] + ; pinacol boronic ester product: MS m/z 278.2 [M+H] + . The reaction mixture was concentrated to dryness and used as is in the next step.

Part 2, Step A: A mixture of crude boronic pinacol ester/boronic acid from Part 1 (˜4 g, ˜4 mmol), 2-chloro-7-fluoro-4H-pyrido[1,2-a]pyrimidin-4-one (0.792 g, 4.0 mmol, prepared in Example 14, Part 1), Pd(dppf)Cl 2 .CH 2 Cl 2 (146 mg, 0.20 mmol), K 2 CO 3 (2M, 6.0 mL, 12.0 mmol), and CH 3 CN (12 mL) was degassed and then heated under N 2 at 60° C. for 2.5 hours. The volatiles were removed and the residue was washed with water and CH 3 CN to give 7-fluoro-2-(4-fluoro-2-methylbenzo[d]oxazol-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one as a grayish solid (1.119 g, 89%). MS m/z 314.2 [M+H] + . 1 H NMR (500 MHz, DMSO-d 6 ) δ 8.88-9.01 (1H, m), 8.39-8.48 (1H, m), 8.11-8.20 (2H, m), 7.86-7.96 (1H, m), 7.21-7.29 (1H, m), 2.69 (3H, s).

Part 2, Step B: A mixture of 7-fluoro-2-(4-fluoro-2-methylbenzo[d]oxazol-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one (63 mg, 0.2 mmol) and (S)-2-methylpiperazine (30 mg, 0.3 mmol) in DMA (0.5 mL) was heated at 120° C. for 15 hours. The volatiles were removed and the residue was chromatographed (10-15% MeOH in CH 2 Cl 2 ) to give the title compound as a yellow solid (26 mg, 33%). M.P. 207-209° C.; MS m/z 394.3 [M+H] + ; 1 H NMR (500 MHz, DMSO-d 6 ) δ 8.39 (1H, d, J=1.3 Hz), 8.20-8.24 (1H, m), 8.05-8.16 (2H, m), 7.71-7.77 (1H, m), 7.11 (1H, s), 3.56-3.68 (2H, m), 2.98-3.06 (1H, m), 2.78-2.88 (2H, m), 2.68 (3H, s), 2.62-2.68 (1H, m), 2.27-2.34 (1H, m), 1.06 (3H, d, J=6.3 Hz).

As shown in Table 1 below, additional compounds disclosed herein may be prepared according to Example 36 by substituting the appropriate starting materials, reagents and reaction conditions.

›Example 37

Preparation of Cpd 443

Step A: A mixture of 7-bromo-2-(3,4-dimethoxyphenyl)-4H-pyrido[1,2-a]pyrimidin-4-one (516 mg, 2.0 mmol), tort-butyl 4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-5,6-dihydropyridine-1(2H)-carboxylate (740 mg, 2.4 mmol), potassium carbonate (828 mg, 6.0 mmol) and Pd(dppf)Cl 2 (144 mg, 0.2 mmol) in acetonitrile (4 mL) was degassed and then heated under N 2 at 60° C. overnight. The volatiles were removed and the residue was chromatographed (30% EtOAc/CH 2 Cl 2 ) to give tert-butyl 4-(2-(3,4-dimethoxyphenyl)-4-oxo-4H-pyrido[1,2-a]pyrimidin-7-yl)-5,6-dihydropyridine-1(2H)-carboxylate as a yellow solid (579 mg, 80%). MS m/z 362.8 [M+H] + .

Step B: To the product from Step A (400 mg, 1.1 mmol) was added 1-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-indazole (220 mg, 1.2 mmol), Pd(dppf)Cl 2 (40 mg, 0.05 mmol), potassium carbonate (455 mg, 3.3 mmol) and CH 3 CN (2 mL). The mixture was degassed and then heated at 75° C. overnight. The mixture was washed with water and CH 3 CN. The volatiles were removed and the residue was chromatographed with 0-2% MeOH in CH 2 Cl 2 to give tert-butyl 4-(2-(1-methyl-1H-indazol-5-yl)-4-oxo-4H-pyrido[1,2-a]pyrimidin-7-yl)-5,6-dihydropyridine-1(2H)-carboxylate as an off-white solid (327 mg, 65%). MS m/z 458.5 [M+H] + .

Step C: Following the procedure in Example 22, Step D, the above product from Step B (327 mg, 0.72 mmol) and HCl in dioxane (4 M, 5 mL) provided the title compound as an off-white solid (194 mg, 76%). M.P. 200-203° C.; MS m/z 358.2 [M+H] + ; 1 H NMR (DMSO-d 6 , 500 MHz) δ 8.80 (d, J=1.6 Hz, 1H), 8.72 (d, J=1.6 Hz, 1H), 8.30-8.26 (m, 2H), 8.22 (d, J=1.6 Hz, 1H), 7.77 (d, J=1.6 Hz, 2H), 7.09 (s, 1H), 6.62 (s, 1H), 4.11 (s, 3H), 3.46-3.44 (m, 2H), 2.98-2.96 (m, 2H), 2.43-2.39 (m, 2H).

As shown in Table 1 below, additional compounds disclosed herein may be prepared according to Example 37 by substituting the appropriate starting materials, reagents and reaction conditions.

›Example 38

Preparation of Cpd 342

Step A: Following the procedure in Example 9, Step G, 2-amino-5-bromo-pyridine (415 mg, 2.4 mmol), ethyl 3-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-3-oxopropanoate (520 mg, 2.0 mmol) and PPTs (25 mg, 0.1 mmol) gave 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-bromo-4H-pyrido[1,2-a]pyrimidin-4-one as a yellow solid (498 mg, 67%). MS m/z 370.2 [M+H] + , 372.2 [M+2+H] + ; 1 H NMR (500 MHz, DMSO-d 6 ) δ 8.99-9.09 (1H, m), 8.53-8.62 (1H, m), 8.08-8.18 (1H, m), 7.68-7.75 (1H, m), 7.55-7.63 (1H, m), 7.01-7.09 (1H, m), 2.74 (3H, s), 2.44 (3H, s).

Step B: Following the procedure in Example 22, Step C, 7-bromo-2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one (498 mg, 1.3 mmol), tert-butyl 4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-5,6-dihydropyridine-1(2H)-carboxylate (482 mg, 1.56 mmol), potassium carbonate (538 mg, 3.9 mmol) and Pd(dppf)Cl 2 (95 mg, 0.13 mmol) in acetonitrile (3 mL) gave tert-butyl 4-(2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4-oxo-4H-pyrido[1,2-a]pyrimidin-7-yl)-5,6-dihydropyridine-1(2H)-carboxylate as an off-white solid (0.57 g, 84%). MS m/z 473.5 [M+H] + ; 1 H NMR (500 MHz, DMSO-d 6 ) δ 8.80-8.89 (1H, m), 8.53-8.61 (1H, m), 8.23-8.32 (1H, m), 7.71-7.79 (1H, m), 7.55-7.61 (1H, m), 6.99-7.04 (1H, m), 4.03-4.14 (2H, m), 3.55-3.65 (2H, m), 2.74 (3H, s), 2.53-2.58 (2H, m), 2.43 (3H, s), 1.44 (9H, s).

Step C: Following the procedure in example 22, Step D, tert-butyl 4-(2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4-oxo-4H-pyrido[1,2-a]pyrimidin-7-yl)-5,6-dihydropyridine-1(2H)-carboxylate, HCl (2 mL, 4N in dioxane) in CH 2 Cl 2 (4 mL) gave the title compound as an off-white solid (234 mg, 84%). M.P. 207-210° C.; MS m/z 373.4 [M+H] + ; 1 H NMR (500 MHz, DMSO-d 6 ) δ 8.80 (1H, s), 8.55-8.60 (1H, m), 8.27-8.32 (1H, m), 7.73-7.78 (1H, m), 7.58-7.63 (1H, m), 7.00-7.05 (1H, m), 6.57-6.65 (1H, m), 3.42-3.47 (2H, m), 2.93-2.98 (2H, m), 2.72-2.76 (2H, m), 2.44 (3H, s), 2.39 (3H, s).

As shown in Table 1 below, additional compounds disclosed herein may be prepared according to Example 38 by substituting the appropriate starting materials, reagents and reaction conditions.

›Example 39

Preparation of Cpd 629

A mixture of (R)-2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-(3-methylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one (48 mg, 0.12 mmol, prepared according to Example 9), formaldehyde (0.039 ml, 0.48 mmol, 37% in water) and sodium triacetoxyborohydride (51 mg, 0.24 mmol) was stirred in dichloromethane (1 mL) for 1 hour. The reaction mixture was diluted with dichloromethane and neutralized with sodium bicarbonate. The organics were dried, concentrated and chromatographed with 0-5% MeOH/CH 2 Cl 2 to provide the title compound as a yellow solid (45 mg, 90%). M.P. 257-259° C.; MS m/z 418.5 [M+H] + ; 1 H NMR (500 MHz, DMSO-d 6 ) δ 8.56 (1H, s), 8.25-8.26 (1H, m), 8.12-8.14 (1H, m), 7.72-7.74 (1H, m), 7.55 (1H, s), 6.95 (1H, s), 3.60-3.65 (2H, m), 3.08 (2H, q, J=7.6 Hz), 2.84-2.89 (2H, m), 2.43-2.52 (2H, m, obscured by DMSO-d 6 ), 2.45 (3H, s), 2.29-2.31 (1H, m), 2.24 (3H, s), 1.33 (3H, t, J=7.6 Hz), 1.91 (3H, d, J=6.2 Hz).

As shown in Table 1 below, additional compounds disclosed herein may be prepared according to Example 39 by substituting the appropriate starting materials, reagents and reaction conditions.

›Example 40

Preparation of Cpd 625 and Cpd 626

Step A: A mixture of ethyl 4-chloro-6-methylpyrazolo[1,5-a]pyrazine-2-carboxylate (2.39 g, 10 mmol, prepared in Example 9, Step C) and sodium methoxide (60 mL, 30 mmol, 0.5 M in MeOH) was stirred at 30° C. for 1 hour. The mixture was concentrated to remove most of the methanol, diluted with water and neutralized with 6 N HCl. A white solid precipitated out and was filtered, washed with water and CH 3 CN, and dried to give ethyl 4-methoxy-6-methylpyrazolo[1,5-a]pyrazine-2-carboxylate as a white solid (1.387 g, 62%). MS m/z 222.2 [M−CH 3 +H] + .

Step B: Following the procedure in Example 9, Step E, tert-butyl acetate (1.6 mL, 12.3 mmol), LDA (10.2 mL, 15.4 mmol, 1.5 M in THF) and ethyl 4-methoxy-6-methylpyrazolo[1,5-a]pyrazine-2-carboxylate (1.387 g, 6.2 mmol) gave tert-butyl 3-(4-methoxy-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-3-oxopropanoate as an oil (1.35 g, 72%). MS m/z 306.3 [M+H] + ; 1 H NMR (500 MHz, DMSO-d 6 ) δ 8.35 (1H, s), 7.27 (1H, s) 4.05 (3H, s), 4.01 (2H, s), 2.36 (3H, s), 1.38 (9H, s).

Step C: Following the procedure in Example 9, Step F, tert-butyl 3-(4-methoxy-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-3-oxopropanoate (1.35 g, 4.43 mmol) and EtOH (10 mL) gave ethyl 3-(4-methoxy-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-3-oxopropanoate as a yellowish solid, which was used directly in the next step without further purification. MS m/z 278.3 [M+H] + .

Step D: A mixture of ethyl 3-(4-methoxy-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-3-oxopropanoate (˜4.43 mmol), 2-amino-5-fluoro-pyridine (0.596 g, 5.3 mmol), PPTs (100 mg, 0.4 mmol) and tetraethyl orthosilicate (1.0 mL, 4.43 mmol) in m-xylene (2.2 mL) was heated at 130° C. After 15 hours, the mixture was cooled to room temperature and washed with CH 2 Cl 2 to give 7-fluoro-2-(4-methoxy-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one as a yellow solid (1.015 g, 70%). MS m/z 326.3 [M+H] + .

Step E: A mixture of 7-fluoro-2-(4-methoxy-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one (98 mg, 0.30 mmol) and N-methyl-piperazine (150 mg, 1.5 mmol) in DMA (0.6 mL) was heated at 130° C. After 6 hours, the mixture was cooled to room temperature and chromatographed with 5% MeOH/CH 2 Cl 2 and 10% 3.5 N NH 3 in MeOH/CH 2 Cl 2 to give Cpd 625 (12 mg, 10%) and Cpd 626 (8.5 mg, 7%), each as yellow solids.

Cpd 625: M.P. 242-244° C.; MS m/z 406.5 [M+H] + ; 1 H NMR (500 MHz, DMSO-d 6 ) δ 8.33-8.38 (1H, m), 8.24-8.30 (1H, m), 8.09-8.15 (1H, m), 7.70-7.74 (1H, m), 7.34-7.39 (1H, m), 6.92-6.96 (1H, m), 4.07 (3H, s), 3.21-3.29 (4H, m), 2.5 (4H, m, obscured by DMSO-d 6 ), 2.37 (3H, s), 2.26 (3H, s).

Cpd 626: M.P. 280-283° C.; MS m/z 392.4 [M+H] + ; 1 H NMR (500 MHz, DMSO-d 6 ) δ 11.4 (1H, s), 8.24-8.28 (1H, m), 8.09-8.14 (1H, m), 7.70-7.75 (1H, m), 7.63-7.67 (1H, m), 7.48 (1H, s), 6.88 (1H, s), 3.22-3.29 (4H, m), 2.51-2.56 (4H, m), 2.24-2.30 (3H, s), 2.15 (3H, s).

›Example 41

Preparation of Cpd 688

Step A: A mixture of ethyl 4-chloro-6-methylpyrazolo[1,5-a]pyrazine-2-carboxylate (0.956 g, 4 mmol, prepared in Example 9, Step C), dimethylamine (2.1 mL, 4.2 mmol, 2.0 M in THF) and Et 3 N (0.84 mL, 6.0 mmol) was heated at 60° C. After 15 hours, the mixture was concentrated, the residue was dissolved in EtOAc, washed with water, dried and concentrated to give ethyl 4-(dimethylamino)-6-methylpyrazolo[1,5-a]pyrazine-2-carboxylate as an off-white solid (0.99 g, 99%). MS m/z 249.3 [M+H] + .

Step B: To a solution of ethyl 4-(dimethylamino)-6-methylpyrazolo[1,5-a]pyrazine-2-carboxylate (0.99 g, 4.0 mmol) and EtOAc (1.95 mL, 20 mmol) in THF (30 mL) at −20° C. was added LiHMDS (11.1 mL, 10 mmol, 0.9 M in THF). After 1 hours, the mixture was quenched with saturated NH 4 Cl, extracted with EtOAc. The organics were concentrated and chromatographed with 2% MeOH/DCM to give ethyl 3-(4-(dimethylamino)-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-3-oxopropanoate as a pale yellow oil (0.48 g, 40%). MS m/z 291.3 [M+H] + ; 1 H NMR (500 MHz, DMSO-d 6 ) δ 7.73 (1H, s), 7.05 (1H, s), 5.43 (2H, s), 3.96 (2H, q, J=7.0 Hz), 3.28 (6H, s), 2.20 (3H, s), 1.16 (3H, t, J=7.0 Hz)

Step C: Following the procedure in Example 40, Step D, ethyl 3-(4-(dimethylamino)-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-3-oxopropanoate (0.48 g, 1.6 mmol), 2-amino-5-fluoro-pyridine (179 mg, 1.6 mmol), PPTs (40 mg, 0.16 mmol) and tetraethyl orthosilicate (0.36 mL, 1.6 mmol) in m-xylene (0.8 mL) gave 2-(4-(dimethylamino)-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-fluoro-4H-pyrido[1,2-a]pyrimidin-4-one as a yellow solid (0.39 g, 72%). MS m/z 339.2 [M+H] + ; 1 H NMR (500 MHz, DMSO-d 6 ) δ 8.92-9.00 (1H, m), 8.06-8.18 (1H, m), 7.91-7.94 (1H, m), 7.85-7.91 (1H, m), 7.55-7.61 (1H, m), 6.98-7.08 (1H, m), 3.36 (6H, s), 2.25 (3H, s).

Step D: A mixture of 7-fluoro-2-(4-methoxy-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one (50 mg, 0.15 mmol) and piperazine (86 mg, 1.0 mmol) in DMA (0.5 mL) was heated at 150° C. After 2 hours, the mixture was cooled to room temperature and washed with CH 3 CN to give the title compound as a yellow solid (60 mg, 98%). M.P. 245-248° C.; MS m/z 405.4 [M+H] + ; 1 H NMR (500 MHz, DMSO-d 6 ) δ 8.23-8.28 (1H, m), 8.06-8.11 (1H, m), 7.89-7.92 (1H, m), 7.69-7.75 (1H, m), 7.50-7.55 (1H, m), 6.92 (1H, s), 3.35 (6H, s), 3.12-3.19 (4H, m), 2.87-2.92 (4H, m), 2.80 (1H, s), 2.24 (3H, s).

›Example 42

Preparation of Cpd 694

Step A: To a mixture of 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-(piperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one (78 mg, 0.2 mmol, prepared according to the procedure in Examples 38 and 24) and 2,2-dimethyl-1,3-dioxan-5-one (72 mg, 0.5 mmol, 90% tech grade) in dichloroethane (1 mL) were added NaBH(OAc) 3 (106 mg, 0.5 mmol) and 1 drop of AcOH. The mixture was stirred at 60° C. After 1 hour, the mixture was quenched with saturated NaHCO 3 , extracted with CH 2 Cl 2 , concentrated and chromatographed (2-5% MeOH/CH 2 Cl 2 ) to give 7-(1-(2,2-dimethyl-1,3-dioxan-5-yl)piperidin-4-yl)-2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one as a white solid (70 mg, 70%). MS m/z 503.5 [M+H] + ; 1 H NMR (500 MHz, DMSO-d 6 ) δ 8.75-8.82 (1H, m), 8.54-8.61 (1H, m), 8.00-8.10 (1H, m), 7.72-7.79 (1H, m), 7.58-7.63 (1H, m), 6.99-7.03 (1H, m), 3.86-3.95 (2H, m), 3.71-3.81 (2H, m), 3.06-3.15 (2H, m), 3.00-3.06 (2H, m), 2.70-2.80 (1H, m), 2.53-2.59 (1H, m), 2.45 (3H, s), 2.28-2.38 (2H, m), 1.82-1.90 (2H, m), 1.59-1.71 (2H, m), 1.32-1.37 (6H, m), 1.27 (3H, s).

Step B: To a mixture of 7-(1-(2,2-dimethyl-1,3-dioxan-5-yl)piperidin-4-yl)-2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one (50 mg, 0.1 mmol) in THF (10 mL) was added HCl (1.3 mL, 2.6 mmol, 2 N). The mixture was stirred at room temperature. After 15 hours, the mixture was treated with excess of 7N NH 3 in MeOH, concentrated and chromatographed (10% 2.5 N NH 3 in MeOH/CH 2 Cl 2 ) to give the title compound as a yellow solid (45 mg, 97%). M.P. 228-230° C.; MS m/z 463.6 [M+H] + ; 1 H NMR (500 MHz, DMSO-d 6 ) δ 8.77-8.84 (1H, m), 8.54-8.61 (1H, m), 8.02-8.10 (1H, m), 7.90-7.94 (1H, m), 7.74-7.79 (1H, m), 7.57-7.63 (1H, m), 6.99-7.05 (1H, m), 4.21-4.31 (2H, m), 3.42-3.59 (4H, m), 3.10 (2H, q, J=7.5 Hz), 2.89-3.00 (2H, m), 2.70-2.72 (1H, m), 2.57-2.62 (1H, m), 2.45 (3H, s), 1.79-1.89 (2H, m), 1.63-1.75 (2H, m), 1.34 (3H, t, J=7.5 Hz).

›Example 43

Preparation of Cpd 662

A mixture of 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one (56 mg, 0.15 mmol, prepared according to the procedure in Example 24), 1-bromo-2-fluoroethane (23 mg, 0.18 mmol) and K 2 CO 3 (23 mg, 0.18 mmol) in DMF (1 mL) was heated at 80° C. After 7 hours, the mixture was cooled to room temperature and chromatographed (5% MeOH/CH 2 Cl 2 ) to give the title compound as a yellow solid (29 mg, 44%). M.P. 197-199° C.; MS m/z 421.4 [M+H] + ; 1 H NMR (500 MHz, DMSO-d 6 ) δ 8.79-8.85 (1H, m), 8.55-8.60 (1H, m), 8.05-8.11 (1H, m), 7.73-7.80 (1H, m), 7.57-7.62 (1H, m), 7.02 (1H, s), 4.59-4.65 (1H, m), 4.48-4.55 (1H, m), 3.01-3.07 (2H, m), 2.69-2.75 (1H, m), 2.74 (3H, s), 2.68-2.72 (1H, m), 2.62-2.67 (1H, m), 2.43 (3H, s), 2.12-2.21 (2H, m), 1.85-1.88 (2H, m), 1.70-1.88 (2H, m).

As shown in Table 1 below, additional compounds disclosed herein may be prepared according to Example 43 by substituting the appropriate starting materials, reagents and reaction conditions.

›Example 44

Preparation of Cpd 798

Part 1, Step A: To a solution of 2,6-dimethylpiperidin-4-one (1.27 g, 10 mmol, a mixture of trans/cis isomers in a ratio of ˜1.5/1) and di-tert-butyl dicarbonate (2.40 g, 11 mmol) in ether was added NaOH (11 mL, 11 mmol, 1 N in water). The mixture was stirred at room temperature. After 36 hours, the mixture was extracted with ether. The organics were concentrated and chromatographed (5-30% EtOAc/Hexanes) to give a mixture of tert-butyl 2,6-dimethyl-4-oxopiperidine-1-carboxylate as a Tran/cis mixture in a ratio of ˜1.2/1 (1.99 g, 87%, clear oil). Upon standing overnight, a solid precipitated from the oil, which was filtered and washed with ether to give the tert-butyl trans-2,6-dimethyl-4-oxopiperidine-1-carboxylate (0.376 g, 16%)(95% trans by 1 H NMR). 1 H NMR (500 MHz, CDCl 3 ) δ 4.33-4.45 (2H, m), 2.80-2.90 (2H, m), 2.33-2.44 (2H, m), 1.50 (9H, s), 1.26 (6H, d, J=6.9 Hz). The 1 H NMR is consistent with that of the trans-isomer in a mixture of cis and trans-isomers (US200839454, JOC, 1993, 58, 1109-1117).

Part 1, Step B: To a solution of the tert-butyl trans-2,6-dimethyl-4-oxopiperidine-1-carboxylate (266 mg, 1.17 mmol) in THF (7 mL) at −78° C. was added NaHMDS. After 1 hour, N-Phenyl-bis(trifluoromethanesulfonimide) (0.50 g, 1.4 mmol) in THF (3 mL) was added. The reaction mixture was stirred at room temperature for 2 hours, quenched with saturated NH 4 Cl and extracted with ether. The organics were concentrated and chromatographed with 1% EtOAc/Hexanes to give tert-butyl-trans-2,6-dimethyl-4-(trifluoromethylsulfonyloxy)-5,6-dihydropyridine-1(2H)-carboxylate (0.415 g, 98%). 1 H NMR (500 MHz, CDCl 3 ) δ 5.77-5.85 (1H, m), 4.29-4.44 (2H, m), 2.81-2.90 (1H, m), 2.15-2.23 (1H, m), 1.48 (9H, s), 1.37 (3H, d, J=6.6 Hz), 1.24 (3H, d, J=6.6 Hz).

Part 2, Step A: Following the procedure of Example 14, Part 2,7-bromo-2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one (0.74 g, 2.0 mmol, prepared in Example 38, Step A), KOAc (590 mg, 6.0 mmol), bis(pincolato)diboron (560 mg, 2.2 mmol), and Pd(dppf)Cl 2 .CH 2 Cl 2 (82 mg, 0.1 mmol) in dioxane (6 mL) provided 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4-oxo-4H-pyrido[1,2-a]pyrimidin-7-ylboronic acid. The crude intermediate was used directly in the next step. MS m/z 336.3 [M+H] + .

Part 2, Step B: Following the procedure of Example 14, Part 3, Step A, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4-oxo-4H-pyrido[1,2-a]pyrimidin-7-ylboronic acid (˜2 mmol), tert-butyl-trans-2,6-dimethyl-4-(trifluoromethylsulfonyloxy)-5,6-dihydropyridine-1(2H)-carboxylate (0.415 g, 1.15 mmol), potassium carbonate (3.5 mL, 2.0M) and Pd(dppf)Cl 2 . CH 2 Cl 2 (82 mg, 0.1 mmol) in acetonitrile (10 mL) provided tert-butyl 4-(2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4-oxo-4H-pyrido[1,2-a]pyrimidin-7-yl)-trans-2,6-dimethyl-5,6-dihydropyridine-1(2H)-carboxylate as a yellow solid (0.5 g, 87%). MS m/z 501.4 [M+H] + .

Part 2, Step C: Following the procedure in Example 38, Step C, tert-butyl 4-(2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4-oxo-4H-pyrido[1,2-a]pyrimidin-7-yl)-trans-2,6-dimethyl-5,6-dihydropyridine-1(2H)-carboxylate (50 mg, 0.1 mmol) and HCl in dioxane (4 M, 0.5 mL) provided the title compound as a yellow solid (25 mg, 62%). M.P. 228-231° C.; MS m/z 401.3 [M+H] + ; 1 HNMR (500 MHz, DMSO-d 6 ) δ 8.77-8.82 (1H, m), 8.54-8.58 (1H, m), 8.25-8.32 (1H, m), 7.70-7.76 (1H, m), 7.57 (1H, s), 7.02 (1H, s), 6.50-6.58 (1H, m), 3.64-3.75 (1H, m), 3.08-3.18 (1H, m), 2.73 (3H, s), 2.41-2.44 (1H, m), 2.43 (3H, s),

›Tables in the description — 25

Abbreviation	Meaning
Δ	heating (chemistry) or deletion (biology)
AcOH or HOAc	acetic acid
Ac 2 O	acetic anhydride
Ar	argon
ACN	acetonitrile
BINAP	2,2′-bis(diphenylphosphino)-1,1′-binaphthalene
B(OiPr) 3	triisopropyl borate
Boc	tert-butoxy-carbonyl
Boc 2 O	di-tert-butyl dicarbonate
BuOH	n-butanol
° C.	degrees Centigrade
CDI	1,1-carbonyldiimidazole or N,N′-carbonyldiimidazole
(CHO) n or (HCHO) n	paraformaldehyde
d/h/hr/hrs/min/s	day(d)/hour(h, hr or hrs)/minute(min)/second(s)
DavePhos	2-dicyclohexylphosphino-2′-(N,N-
	dimethylamino)biphenyl
DCE	1,2-dichloroethane
DCM	dichloromethane (CH 2 Cl 2 )
DIAD	diisopropyl azodicarboxylate
DIEA or DIPEA	N,N-diisopropylethylamine
DMA	dimethylacetamide
DMAP	4-(dimethylamino)pyridine
DME	1,2-dimethoxyethane
DMF	dimethylformamide
DMSO	dimethylsulfoxide
EDC or EDCI	N-(3-dimethylaminopropyl)-N′-ethylcarbodiimide
	hydrochloride
EtOAc	ethyl acetate
EtOH	ethanol
Et 2 O	diethyl ether
HCOH	formaldehyde
iPrI	iodopropane
JohnPhos	(2-biphenyl)-di-t-butylphosphine
KOAc	potassium acetate
LAH	lithium aluminum hydride
LC/MS, LCMS or LC-MS	liquid chromatographic mass spectroscopy
LDA	lithium diisopropylamine
LiHMDS or LHMDS	lithium bis(trimethylsilyl)amide
MeOH	methanol
MeI	iodomethane
Me—THF	2-methyltetrahydrofuran
Me 2 Zn	dimethylzinc
MnO 2	manganese dioxide
MS	mass spectroscopy
NaH	sodium hydride
NaHS	sodium hydrosulfide
NaHMDS	sodium bis(trimethylsilyl)amide or sodium
	hexamethyldisilazide
NaI	sodium iodide
NaOAc	sodium acetate
NaOMe	sodium methoxide
NBS	N-bromosuccinimide
NMP	N-methylpyrrolidone
NMR	nuclear magnetic resonance
o/n	overnight
Pd	palladium
Pd/C	palladium on carbon
Pd(dba) 2	bis(dibenzylideneacetone)palladium
Pd 2 (dba) 3 or Pd 2 dba 3	tris(dibenzylideneacetone)dipalladium(0)
PdCl 2 (PhCN) 2	trans-bis(benzonitrile)dichloropalladium(II)
PdCl 2 (dppf), PdCl 2 dppf or	[1,1′-
Pd(dppf)Cl 2	bis(diphenylphosphino)ferrocene]dichloropalladium(II)
Pd(OAc) 2	palladium(II) acetate
Pd(PPh 3 ) 4 or Pd(Ph 3 P) 4	tetrakis(triphenylphosphine)palladium(0)
Pd(PPh 3 ) 2 Cl 2 , PdCl 2 (PPh 3 ) 2 or	bis(triphenylphosphine)palladium(II) dichloride
PdCl 2 (Ph 3 P) 2
PHBu 3 BF 4 or tBu 3 PHBF 4	tri-tert-butylphosphonium tetrafluoroborate
PhI	iodobenzene
PhI(OTFA) 2	[bis(trifluoroacetoxy)iodo]benzene
PhMe	toluene
Ph-NTf2 or PhNTf 2	N-phenyl triflimide, also referred to as N-phenyl-
	bis(trifluoromethanesulfonimide)
POCl 3	phosphoryl chloride
PPh 3	triphenylphosphine
PPA	polyphosphoric acid
PPTs	pyridinium p-toluenesulfonate
Psi	pounds per square inch pressure
PyBOP	(benzotriazol-1-yloxy)tripyrrolidinophosphonium
	hexafluorophosphate
rt	room temperature
S-Phos, SPhos or Sphos	2-dicyclohexylphosphino-2′,6′-dimethoxybiphenyl
T 3 P	propylphosphonic anhydride
TEA, Et 3 N or NEt 3	triethylamine
Tf 2 O	triflic anhydride
TFA	trifluoroacetic acid
THF	tetrahydrofuran
TLC	thin layer chromatography
TMS	trimethylsilane
TMSCl	trimethylchlorosilane or trimethylsilyl chloride
TMSOK	potassium trimethylsilanolate
t-Bu	tert-butyl
TsOH, p-TsOH or pTSA	tosylic acid or p-toluenesulfonic acid
xantphos	4,5-bis(diphenylphosphino)-9,9-dimethylxanthene

TABLE 1 — or a salt, isotopologue, stereoisomer, racemate, enantiomer, diastereomer or tautomer thereof.

Ex	Cpd	Name	M.P.	MS
4*	1	2-(4-methoxyphenyl)-7-(piperazin-1-yl)-4H-	182-184	337.3
		pyrido[1,2-a]pyrimidin-4-one
4	2	2-(4-methoxyphenyl)-7-(4-methylpiperazin-1-yl)-	178-182	351.3
		4H-pyrido[1,2-a]pyrimidin-4-one
4	3	2-(4-methoxyphenyl)-7-[(3R)-3-methylpiperazin-1-	152-154	351.3
		yl]-4H-pyrido[1,2-a]pyrimidin-4-one
4	4	7-[(3R,5S)-3,5-dimethylpiperazin-1-yl]-2-(4-	185-187	365.3
		methoxyphenyl)-4H-pyrido[1,2-a]pyrimidin-4-one
4	5	7-(1,4-diazepan-1-yl)-2-(4-methoxyphenyl)-4H-	149-152	351.3
		pyrido[1,2-a]pyrimidin-4-one
3*	6	2-(3,4-dimethoxyphenyl)-7-(piperazin-1-yl)-4H-	182-184	367.5
		pyrido[1,2-a]pyrimidin-4-one
3	7	2-(3,4-dimethoxyphenyl)-7-(3,3-dimethylpiperazin-	138-140	395.3
		1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one
3	8	2-(3,4-dimethoxyphenyl)-7-[(3R)-3-methylpiperazin-	181-184	381.3
		1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one
3	9	2-(3,4-dimethoxyphenyl)-7-(4-ethylpiperazin-1-yl)-	159-162	395.3
		4H-pyrido[1,2-a]pyrimidin-4-one
3	10	7-(1,4-diazepan-1-yl)-2-(3,4-dimethoxyphenyl)-4H-	ND	381.3
		pyrido[1,2-a]pyrimidin-4-one
3	11	2-(3,4-dimethoxyphenyl)-7-(4-methyl-1,4-diazepan-	166-168	395.3
		1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one
3	12	2-(4-methoxyphenyl)-7-[(3S)-3-methylpiperazin-1-	158-160	351.3
		yl]-4H-pyrido[1,2-a]pyrimidin-4-one
3	13	2-(3,4-dimethoxyphenyl)-7-(4-methylpiperazin-1-	183-185	381.3
		yl)-4H-pyrido[1,2-a]pyrimidin-4-one
3	14	2-(3,4-dimethoxyphenyl)-7-[(3R,5S)-3,5-	182-187	395.3
		dimethylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-
		4-one
3	15	2-(3,4-dimethoxyphenyl)-7-(4-propylpiperazin-1-yl)-	185-189	409.3
		4H-pyrido[1,2-a]pyrimidin-4-one
4	16	2-(4-methoxyphenyl)-7-(4-methyl-1,4-diazepan-1-	137-141	365.3
		yl)-4H-pyrido[1,2-a]pyrimidin-4-one
4	17	7-(3,3-dimethylpiperazin-1-yl)-2-(4-	ND	365.3
		methoxyphenyl)-4H-pyrido[1,2-a]pyrimidin-4-one
4	18	2-(1,3-benzodioxol-5-yl)-7-(piperazin-1-yl)-4H-	198-201	351.3
		pyrido[1,2-a]pyrimidin-4-one
4	19	2-(1,3-benzodioxol-5-yl)-7-(4-methylpiperazin-1-yl)-	235-237	365.2
		4H-pyrido[1,2-a]pyrimidin-4-one
4	20	2-(1,3-benzodioxol-5-yl)-7-[(3R)-3-methylpiperazin-	195-197	365.3
		1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one
4	21	2-(1,3-benzodioxol-5-yl)-7-[(3R,5S)-3,5-	198-201	379.3
		dimethylpiperazin-1-yl]-4H-pyrido [1,2-a]pyrimidin-
		4-one
4	22	2-(3-methoxyphenyl)-7-(piperazin-1-yl)-4H-	147-149	337.2
		pyrido[1,2-a]pyrimidin-4-one
4	23	2-(3-methoxyphenyl)-7-(4-methylpiperazin-1-yl)-	173-175	351.2
		4H-pyrido[1,2-a]pyrimidin-4-one
4	24	2-(3-methoxyphenyl)-7-[(3R)-3-methylpiperazin-1-	164-166	351.2
		yl]-4H-pyrido[1,2-a]pyrimidin-4-one
4	25	7-[(3R,5S)-3,5-dimethylpiperazin-1-yl]-2-(3-	189-191	365.3
		methoxyphenyl)-4H-pyrido[1,2-a]pyrimidin-4-one
4	26	7-(4-ethylpiperazin-1-yl)-2-(3-methoxyphenyl)-4H-	158-160	365.3
		pyrido[1,2-a]pyrimidin-4-one
4	27	7-(1,4-diazepan-1-yl)-2-(3-methoxyphenyl)-4H-	ND	351.2
		pyrido[1,2-a]pyrimidin-4-one
4	28	2-(3-methoxyphenyl)-7-(4-methyl-1,4-diazepan-1-	130-132	365.2
		yl)-4H-pyrido[1,2-a]pyrimidin-4-one
8*	29	2-(6-methylimidazo[1,2-a]pyridin-2-yl)-7-(piperazin-	193-198	361.3
		1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one
3	30	2-(3,4-dimethoxyphenyl)-7-[(3S)-3-methylpiperazin-	153-158	381.3
		1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one
4	31	2-(2,3-dihydro-1,4-benzodioxin-6-yl)-7-(piperazin-1-	230-232	365.3
		yl)-4H-pyrido[1,2-a]pyrimidin-4-one
4	32	2-(2,3-dihydro-1,4-benzodioxin-6-yl)-7-[(3S)-3-	205-207	379.3
		methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-
		one
3	33	2-phenyl-7-(piperazin-1-yl)-4H-pyrido[1,2-	151-153	307.2
		a]pyrimidin-4-one
3	34	7-[(3S)-3-methylpiperazin-1-yl]-2-phenyl-4H-	170-173	321.3
		pyrido[1,2-a]pyrimidin-4-one
4	35	2-(2,3-dihydro-1,4-benzodioxin-6-yl)-7-[(3R)-3-	212-214	379.2
		methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-
		one
4	36	2-(2,3-dihydro-1,4-benzodioxin-6-yl)-7-(3,3-	196-198	393.3
		dimethylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-
		4-one
4	37	2-(2,3-dihydro-1,4-benzodioxin-6-yl)-7-[(3R,5S)-	247-250	393.3
		3,5-dimethylpiperazin-1-yl]-4H-pyrido[1,2-
		a]pyrimidin-4-one
4	38	7-(1,4-diazepan-1-yl)-2-(2,3-dihydro-1,4-	180-182	379.3
		benzodioxin-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one
4	39	2-(2,3-dihydro-1,4-benzodioxin-6-yl)-7-(4-methyl-	150-152	393.3
		1,4-diazepan-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one
1	40	2-(3,4-dimethoxyphenyl)-9-fluoro-7-(4-	183-185	399.3
		methylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-
		one
1	41	2-(3-chlorophenyl)-7-(piperazin-1-yl)-4H-	185-189	341.2
		pyrido[1,2-a]pyrimidin-4-one
1	42	2-(4-chlorophenyl)-7-(piperazin-1-yl)-4H-	207-212	341.2
		pyrido[1,2-a]pyrimidin-4-one
1	43	7-(piperazin-1-yl)-2-[3-(trifluoromethyl)phenyl]-4H-	199-207	375.2
		pyrido[1,2-a]pyrimidin-4-one
1	44	7-(piperazin-1-yl)-2-[4-(trifluoromethyl)phenyl]-4H-	285 (D)	375.2
		pyrido[1,2-a]pyrimidin-4-one
1	45	2-(3-methylphenyl)-7-(piperazin-1-yl)-4H-	183-187	321.2
		pyrido[1,2-a]pyrimidin-4-one
1	46	2-(4-fluorophenyl)-7-(piperazin-1-yl)-4H-pyrido[1,2-	214-218	325.2
		a]pyrimidin-4-one
1	47	2-(4-nitrophenyl)-7-(piperazin-1-yl)-4H-pyrido[1,2-	237-242	352.2
		a]pyrimidin-4-one
1	48	2-(3,4-dimethoxyphenyl)-9-fluoro-7-(piperidin-4-	224-226	399.3
		ylamino)-4H-pyrido[1,2-a]pyrimidin-4-one
3	49	2-[4-(dimethylamino)phenyl]-9-fluoro-7-(piperazin-	216-218	368.3
		1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one
3	50	2-[4-(dimethylamino)phenyl]-9-fluoro-7-[(3R)-3-	205-207	382.3
		methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-
		one
1	51	2-(2-fluorophenyl)-7-(piperazin-1-yl)-4H-pyrido[1,2-	142-146	325.2
		a]pyrimidin-4-one
28*	52	3-(3,4-dimethoxyphenyl)-8-(piperazin-1-yl)-4H-	175-179	367.2
		pyrido[1,2-a]pyrimidin-4-one
3	53	2-[4-(dimethylamino)phenyl]-7-(piperazin-1-yl)-4H-	211-215	350.3
		pyrido[1,2-a]pyrimidin-4-one
3	54	2-[4-(dimethylamino)phenyl]-7-[(3S)-3-	199-202	364.3
		methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-
		one
3	55	2-(3,4-dimethylphenyl)-7-(piperazin-1-yl)-4H-	186-188	335.2
		pyrido[1,2-a]pyrimidin-4-one
3	56	2-(3,4-dimethylphenyl)-7-[(3S)-3-methylpiperazin-1-	207-209	349.3
		yl]-4H-pyrido[1,2-a]pyrimidin-4-one
3	57	2-[3-(dimethylamino)phenyl]-7-(piperazin-1-yl)-4H-	178-180	350.2
		pyrido[1,2-a]pyrimidin-4-one
3	58	2-[3-(dimethylamino)phenyl]-7-[(3S)-3-	144-146	364.3
		methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-
		one
3	59	2-[4-(difluoromethoxy)phenyl]-7-(piperazin-1-yl)-	131-133	373.5
		4H-pyrido[1,2-a]pyrimidin-4-one
3	60	2-[4-(difluoromethoxy)phenyl]-7-[(3S)-3-	166-168	387.2
		methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-
		one
1	61	2-(3-fluorophenyl)-7-(piperazin-1-yl)-4H-pyrido[1,2-	153-156	325.2
		a]pyrimidin-4-one
1	62	2-(3-nitrophenyl)-7-(piperazin-1-yl)-4H-pyrido[1,2-	175 (D)	352.2
		a]pyrimidin-4-one
1	63	2-(4-methylphenyl)-7-(piperazin-1-yl)-4H-	192-195	321.2
		pyrido[1,2-a]pyrimidin-4-one
3	64	2-(2-fluoro-4,5-dimethoxyphenyl)-7-(piperazin-1-	177-180	385.2
		yl)-4H-pyrido[1,2-a]pyrimidin-4-one
3	65	2-(2-fluoro-4,5-dimethoxyphenyl)-7-[(3S)-3-	167-170	399.2
		methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-
		one
3	66	7-(3,8-diazabicyclo[3.2.1]oct-3-yl)-2-(3,4-	158-161	393.3
		dimethoxyphenyl)-4H-pyrido[1,2-a]pyrimidin-4-one
1	67	2-[4-methoxy-3-(trifluoromethyl)phenyl]-7-	177-181	405.1
		(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one
1	68	2-[4-methoxy-3-(trifluoromethyl)phenyl]-7-[(3R)-3-	205-212	419.3
		methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-
		one
1	69	2-[4-methoxy-3-(trifluoromethyl)phenyl]-7-[(3S)-3-	195-200	419.3
		methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-
		one
6*	70	2-(3,4-dimethoxyphenyl)-9-methoxy-7-(piperazin-1-	185-187	397.3
		yl)-4H-pyrido[1,2-a]pyrimidin-4-one
11	71a	2-(3,5-difluoro-4-hydroxyphenyl)-7-(piperazin-1-yl)-	NI	NI
		4H-pyrido[1,2-a]pyrimidin-4-one
1*	72	2-(3-fluoro-4-methoxyphenyl)-7-(piperazin-1-yl)-	191-195	355.0
		4H-pyrido[1,2-a]pyrimidin-4-one
3	73	4-[4-oxo-7-(piperazin-1-yl)-4H-pyrido[1,2-	146-151	332.1
		a]pyrimidin-2-yl]benzonitrile
7*	74	2-(6-methylimidazo[1,2-a]pyrazin-2-yl)-7-	221-225	362.2
		(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one
7	75	2-(6-methylimidazo[1,2-a]pyrazin-2-yl)-7-[(3S)-3-	235-238	376.2
		methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-
		one
1	76	2-[3-fluoro-5-(trifluoromethyl)phenyl]-7-(piperazin-	ND	393
		1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one
1	77	2-[4-fluoro-3-(trifluoromethyl)phenyl]-7-(piperazin-	214-217	393.1
		1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one
1	78	2-[2-methoxy-3-(trifluoromethyl)phenyl]-7-	194-200	405.1
		(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one
1	79	2-(3,5-difluorophenyl)-7-(piperazin-1-yl)-4H-	195-198	343
		pyrido[1,2-a]pyrimidin-4-one
1	80	7-(piperazin-1-yl)-2-[3-(trifluoromethoxy)phenyl]-	140-143	391
		4H-pyrido[1,2-a]pyrimidin-4-one
5*	81	2-[4-methoxy-3-(trifluoromethoxy)phenyl]-7-	158-162	421.1
		(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one
5*	82	2-[4-hydroxy-3-(trifluoromethoxy)phenyl]-7-	245-248	407.2
		(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one
5	83	2-[4-methoxy-3-(trifluoromethoxy)phenyl]-7-[(3S)-	176-178	435.9
		3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-
		4-one
5	84	2-[4-hydroxy-3-(trifluoromethoxy)phenyl]-7-[(3S)-	152-155	421.2
		3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-
		4-one
31*	85	2-(3,4-dimethoxyphenyl)-4-oxo-7-(piperazin-1-yl)-	199-202	391.2
		4H-quinolizine-1-carbonitrile
1	86	2-(3-fluoro-4-methoxyphenyl)-7-[(3R)-3-	175-178	369.1
		methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-
		one
1	87	2-(3-fluoro-4-methoxyphenyl)-7-[(3S)-3-	175-178	369.1
		methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-
		one
1	88	2-(6-methoxypyridin-3-yl)-7-(piperazin-1-yl)-4H-	173-178	338.2
		pyrido[1,2-a]pyrimidin-4-one
1	89	2-(2,4-dimethoxyphenyl)-7-(piperazin-1-yl)-4H-	171-173	367.3
		pyrido[1,2-a]pyrimidin-4-one
1	90	2-(2,4-dimethoxyphenyl)-7-[(3S)-3-methylpiperazin-	172-177	381.2
		1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one
32*	91	2-(3,4-dimethoxyphenyl)-7-[(3S)-3-methylpiperazin-	243-245	380.2
		1-yl]-4H-quinolizin-4-one
11*	92	2-(5-fluoropyridin-3-yl)-7-(piperazin-1-yl)-4H-	201-208	326.2
		pyrido[1,2-a]pyrimidin-4-one
11	93	2-(5-fluoropyridin-3-yl)-7-[(3S)-3-methylpiperazin-	191-199	340.1
		1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one
11	94	2-(5-chloropyridin-3-yl)-7-(piperazin-1-yl)-4H-	208-218	342
		pyrido[1,2-a]pyrimidin-4-one
11	95	2-(5-chloropyridin-3-yl)-7-[(3S)-3-methylpiperazin-	227-232	356
		1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one
1	96	2-(5-chloro-6-methoxypyridin-3-yl)-7-(piperazin-1-	201-209	372.1
		yl)-4H-pyrido[1,2-a]pyrimidin-4-one
12	97	2-(1H-indol-6-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-	202-206	346.2
		a]pyrimidin-4-one
12*	98	2-(1H-indol-5-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-	266-272	346.2
		a]pyrimidin-4-one
3	99	2-[3-(difluoromethoxy)-4-methoxyphenyl]-7-	ND	403.4
		(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one
3	100	2-[3-(difluoromethoxy)-4-hydroxyphenyl]-7-	233-237	389.2
		(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one
3	101	2-[3-(difluoromethoxy)-4-methoxyphenyl]-7-[(3S)-	167-169	417
		3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-
		4-one
3	102	2-[3-(difluoromethoxy)-4-hydroxyphenyl]-7-[(3S)-3-	192-197	403.2
		methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-
		one
33	103	2-(3-fluoro-4-methoxyphenyl)-7-(piperazin-1-yl)-	200-202	354.1
		4H-quinolizin-4-one
33	104	2-(3-fluoro-4-methoxyphenyl)-7-[(3S)-3-	188-192	368.1
		methylpiperazin-1-yl]-4H-quinolizin-4-one
1	105	2-(3,5-difluorophenyl)-7-[(3S)-3-methylpiperazin-1-	189-194	357.2
		yl]-4H-pyrido[1,2-a]pyrimidin-4-one
33*	106	2-(3,4-dimethoxyphenyl)-7-(piperazin-1-yl)-4H-	170-172	366.1
		quinolizin-4-one
13*	107	2-(imidazo[1,2-a]pyridin-7-yl)-7-(piperazin-1-yl)-	258-270	347
		4H-pyrido[1,2-a]pyrimidin-4-one
12	108	2-(imidazo[1,2-a]pyridin-6-yl)-7-(piperazin-1-yl)-	ND	347
		4H-pyrido[1,2-a]pyrimidin-4-one
15*	109	2-(2-methylimidazo[1,2-a]pyridin-6-yl)-7-(piperazin-	259-267	361.1
		1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one
3	110	2-(3-chloro-4-methoxyphenyl)-7-(piperazin-1-yl)-	201-203	371.4,
		4H-pyrido[1,2-a]pyrimidin-4-one		373.4
3	111	2-(3-chloro-4-methoxyphenyl)-7-[(3S)-3-	187-189	385.5,
		methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-		387.5
		one
1	112	2-(3-ethoxy-4-methoxyphenyl)-7-(piperazin-1-yl)-	194-196	381.1
		4H-pyrido[1,2-a]pyrimidin-4-one
1	113	2-(3-ethoxy-4-methoxyphenyl)-7-[(3S)-3-	159-162	395.1
		methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-
		one
15	114	2-(2-methylimidazo[1,2-a]pyridin-6-yl)-7-(4-	ND	375.1
		methylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-
		one
15	115	2-(2-methylimidazo[1,2-a]pyridin-6-yl)-7-[(3S)-3-	ND	375.1
		methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-
		one
15	116	7-(1,4-diazepan-1-yl)-2-(2-methylimidazo[1,2-	ND	375.1
		a]pyridin-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one
15	117	7-[(3R,5S)-3,5-dimethylpiperazin-1-yl]-2-(2-	181-186	389.1
		methylimidazo[1,2-a]pyridin-6-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
7	118	2-(6,8-dimethylimidazo[1,2-a]pyrazin-2-yl)-7-	189-192	376.5
		(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one
7	119	2-(6,8-dimethylimidazo[1,2-a]pyrazin-2-yl)-7-[(3S)-	202-208	390.5
		3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-
		4-one
9	120	2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-	195-200	376.5
		(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one
9	121	2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[(3S)-	192-194	390.5
		3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-
		4-one
22	122	2-(3,4-dimethoxyphenyl)-7-(2-methylpyridin-4-yl)-	197-200	374
		4H-pyrido[1,2-a]pyrimidin-4-one
15	123	7-(piperazin-1-yl)-2-[2-(trifluoromethyl)imidazo[1,2-	250-255	415.5
		a]pyridin-6-yl]-4H-pyrido[1,2-a]pyrimidin-4-one
15	124	2-(2-ethylimidazo[1,2-a]pyridin-6-yl)-7-(piperazin-	228-232	375.5
		1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one
15	125	2-(2,3-dimethylimidazo[1,2-a]pyridin-6-yl)-7-	236-240	375.5
		(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one
2	126	2-(3,4-dimethoxyphenyl)-7-[(3aR,6aS)-	286-290	393.1
		hexahydropyrrolo[3,4-c]pyrrol-2(1H)-yl]-4H-
		pyrido[1,2-a]pyrimidin-4-one
2	127	7-(4-aminopiperidin-1-yl)-2-(3,4-dimethoxyphenyl)-	182-185	381.1
		4H-pyrido[1,2-a]pyrimidin-4-one
19*	128	7-(piperazin-1-yl)-2-(1H-pyrrolo[2,3-b]pyridin-5-yl)-	252-255	347.1
		4H-pyrido[1,2-a]pyrimidin-4-one
19	129	2-(1-methyl-1H-pyrrolo[2,3-b]pyridin-5-yl)-7-	230-233	361.1
		(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one
19	130	7-[(3R,5S)-3,5-dimethylpiperazin-1-yl]-2-(1-methyl-	265-268	389.1
		1H-pyrrolo[2,3-b]pyridin-5-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
9	131	7-[(3R,5S)-3,5-dimethylpiperazin-1-yl]-2-(4,6-	ND	404.5
		dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-
		pyrido[1,2-a]pyrimidin-4-one
9	132	7-(1,4-diazepan-1-yl)-2-(4,6-dimethylpyrazolo[1,5-	ND	390.5
		a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one
14	133	2-(2-methyl-1,3-benzoxazol-6-yl)-7-(piperazin-1-yl)-	219-222	362.5
		4H-pyrido[1,2-a]pyrimidin-4-one
14	134	2-(2-methyl-1,3-benzoxazol-6-yl)-7-[(3S)-3-	191-193	376.5
		methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-
		one
14	135	2-(2-methyl-1,3-benzothiazol-5-yl)-7-[(3S)-3-	174-180	392.2
		methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-
		one
14	136	2-(2-methyl-1,3-benzothiazol-5-yl)-7-(piperazin-1-	228-230	378.1
		yl)-4H-pyrido[1,2-a]pyrimidin-4-one
14	137	2-(2-methyl-2H-indazol-5-yl)-7-(piperazin-1-yl)-4H-	175-180	361.5
		pyrido[1,2-a]pyrimidin-4-one
14	138	2-(2-methyl-2H-indazol-5-yl)-7-[(3S)-3-	166-170	375.5
		methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-
		one
14	139	2-(3-fluoro-5-methoxyphenyl)-7-(piperazin-1-yl)-	168-170	355.5
		4H-pyrido[1,2-a]pyrimidin-4-one
14	140	2-(3-fluoro-5-methoxyphenyl)-7-[(3S)-3-	154-156	369.5
		methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-
		one
16	141	2-(2,8-dimethylimidazo[1,2-a]pyridin-6-yl)-7-	270-274	375.1
		(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one
2	142	2-(3,4-dimethoxyphenyl)-9-methyl-7-[(3S)-3-	176-182	395.5
		methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-
		one
22*	143	2-(3,4-dimethoxyphenyl)-7-(1,2,3,6-	196-198	364.1
		tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-
		4-one
24*	144	2-(3,4-dimethoxyphenyl)-7-(piperidin-4-yl)-4H-	214-217	366.4
		pyrido[1,2-a]pyrimidin-4-one
1	145	2-(3-fluoro-4,5-dimethoxyphenyl)-7-(piperazin-1-	ND	385.5
		yl)-4H-pyrido[1,2-a]pyrimidin-4-one
3	146	2-(3,4-dimethoxyphenyl)-7-(4-hydroxypiperazin-1-	202-204	383.5
		yl)-4H-pyrido[1,2-a]pyrimidin-4-one
2	147	2-(3,4-dimethoxyphenyl)-7-[(3S)-3-	156-158	395.4
		(dimethylamino)pyrrolidin-1-yl]-4H-pyrido[1,2-
		a]pyrimidin-4-one
2	148	2-(3,4-dimethoxyphenyl)-7-[4-	158-161	409.1
		(dimethylamino)piperidin-1-yl]-4H-pyrido[1,2-
		a]pyrimidin-4-one
14	149	2-(4-methoxy-3-methylphenyl)-7-(piperazin-1-yl)-	198-203	351.5
		4H-pyrido[1,2-a]pyrimidin-4-one
14	150	3-[4-oxo-7-(piperazin-1-yl)-4H-pyrido[1,2-	224-231	332.1
		a]pyrimidin-2-yl]benzonitrile
14	151	2-methoxy-5-[4-oxo-7-(piperazin-1-yl)-4H-	191-197	362
		pyrido[1,2-a]pyrimidin-2-yl]benzonitrile
14	152	2-(3-fluoro-4-hydroxyphenyl)-7-(piperazin-1-yl)-4H-	259-266	341.5
		pyrido[1,2-a]pyrimidin-4-one
20*	153	2-(4-ethoxy-3-fluorophenyl)-7-(piperazin-1-yl)-4H-	180-186	369.1
		pyrido[1,2-a]pyrimidin-4-one
20	154	2-[3-fluoro-4-(2,2,2-trifluoroethoxy)phenyl]-7-	198-201	423.1
		(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one
14	155	2-(2-methyl-1,3-benzoxazol-5-yl)-7-(piperazin-1-yl)-	178-183	362
		4H-pyrido[1,2-a]pyrimidin-4-one
14	156	2-(2-methyl-1,3-benzoxazol-5-yl)-7-[(3S)-3-	ND	376.5
		methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-
		one
14	157	2-(3-fluoro-4-methylphenyl)-7-(piperazin-1-yl)-4H-	174-176	339.5
		pyrido[1,2-a]pyrimidin-4-one
14	158	2-(3-fluoro-4-methylphenyl)-7-[(3S)-3-	175-178	353.5
		methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-
		one
2	159	7-[(3S)-3-aminopyrrolidin-1-yl]-2-(3,4-	148-151	367.1
		dimethoxyphenyl)-4H-pyrido[1,2-a]pyrimidin-4-one
2	160	2-(3,4-dimethoxyphenyl)-9-methyl-7-(piperazin-1-	175 (S),	381.1
		yl)-4H-pyrido[1,2-a]pyrimidin-4-one	216-222
14	161	7-(1,4-diazepan-1-yl)-2-(2-methyl-1,3-benzothiazol-	208-212	392.2
		5-yl)-4H-pyrido[1,2-a]pyrimidin-4-one
10	162	7-[(3S)-3-methylpiperazin-1-yl]-2-(4-methyl-1,3-	225-230	342.1
		thiazol-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one
10*	163	2-(4-methyl-1,3-thiazol-2-yl)-7-(piperazin-1-yl)-4H-	142-147	328.2
		pyrido[1,2-a]pyrimidin-4-one
25*	164	2-(3,4-dimethoxyphenyl)-7-(1-methylpiperidin-4-yl)-	181-183	380.1
		4H-pyrido[1,2-a]pyrimidin-4-one
2	165	2-(3,4-dimethoxyphenyl)-7-[(3S)-3-(propan-2-	169-172	409.1
		ylamino)pyrrolidin-1-yl]-4H-pyrido[1,2-a]pyrimidin-
		4-one
1	166	2-(3-fluoro-4-methoxyphenyl)-7-(4-methyl-1,4-	176-178	383.1
		diazepan-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one
14	167	2-(4-methoxy-3-nitrophenyl)-7-(piperazin-1-yl)-4H-	183-187	382.5
		pyrido[1,2-a]pyrimidin-4-one
14	168	2-[3-fluoro-4-(methylsulfanyl)phenyl]-7-(piperazin-	174-176	371.1
		1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one
15	169	7-(4-methyl-1,4-diazepan-1-yl)-2-(2-	208-213	389.1
		methylimidazo[1,2-a]pyridin-6-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
9*	170	2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-(4-	254-256	390.4
		methylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-
		one
14*	171	2-(2-methyl-1,3-benzoxazol-6-yl)-7-(4-	178-183	376.5
		methylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-
		one
14	172	7-[(3R,5S)-3,5-dimethylpiperazin-1-yl]-2-(2-methyl-	233-235	390.3
		1,3-benzoxazol-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-
		one
17	173	2-(5-fluoro-6-methoxypyridin-3-yl)-7-[(3S)-3-	175-180	370.5
		methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-
		one
17	174	7-[(3R,5S)-3,5-dimethylpiperazin-1-yl]-2-(5-fluoro-	160-165	384.5
		6-methoxypyridin-3-yl)-4H-pyrido[1,2-a]pyrimidin-
		4-one
14	175	7-[(3R,5S)-3,5-dimethylpiperazin-1-yl]-2-(2-methyl-	208-212	406.1
		1,3-benzothiazol-5-yl)-4H-pyrido[1,2-a]pyrimidin-4-
		one
14	176	2-(2-methyl-1,3-benzothiazol-5-yl)-7-(4-	214-218	392.1
		methylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-
		one
14	177	2-(2-methyl-1,3-benzothiazol-5-yl)-7-(4-methyl-1,4-	165-170	406.1
		diazepan-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one
14	178	7-[(8aS)-hexahydropyrrolo[1,2-a]pyrazin-2(1H)-yl]-	254-256	418.1
		2-(2-methyl-1,3-benzothiazol-5-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
21*	179	2-(4-methyl-1H-imidazol-1-yl)-7-(piperazin-1-yl)-	204-206	311.1
		4H-pyrido[1,2-a]pyrimidin-4-one
21	180	2-(4-methyl-1H-imidazol-1-yl)-7-[(3S)-3-	204-206	325.5
		methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-
		one
2	181	2-(3,4-dimethoxyphenyl)-7-{[2-	135-138	355
		(methylamino)ethyl]amino}-4H-pyrido[1,2-
		a]pyrimidin-4-one
17*	182	2-(5-fluoro-6-methoxypyridin-3-yl)-7-(piperazin-1-	166-170	356.4
		yl)-4H-pyrido[1,2-a]pyrimidin-4-one
17	183	2-(3,5-difluoro-4-methoxyphenyl)-7-(piperazin-1-	167-169	373.4
		yl)-4H-pyrido[1,2-a]pyrimidin-4-one
17	184	2-(3,5-difluoro-4-methoxyphenyl)-7-[(3S)-3-	182-184	387.5
		methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-
		one
2	185	7-[4-(dimethylamino)piperidin-1-yl]-2-(3-fluoro-4-	196-201	397.1
		methoxyphenyl)-4H-pyrido[1,2-a]pyrimidin-4-one
2	186	2-(3-fluoro-4-methoxyphenyl)-7-(1,2,3,6-	182-184	352
		tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-
		4-one
2	187	2-(3,4-dimethoxyphenyl)-7-(piperidin-4-ylamino)-	ND	381.1
		4H-pyrido[1,2-a]pyrimidin-4-one
23*	188	2-(3,4-dimethoxyphenyl)-7-(1-methyl-1,2,3,6-	165-168	378.3
		tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-
		4-one
14	189	2-(3-chloro-5-fluorophenyl)-7-[(3S)-3-	188-190	373
		methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-
		one
14	190	2-(3-chloro-5-fluorophenyl)-7-(piperazin-1-yl)-4H-	180-184	359.1
		pyrido[1,2-a]pyrimidin-4-one
18*	191	7-[(3S)-3-methylpiperazin-1-yl]-2-(1-methyl-1H-	168-170	325.2
		pyrazol-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one
18	192	2-(1-methyl-1H-pyrazol-4-yl)-7-(piperazin-1-yl)-4H-	ND	311.1
		pyrido[1,2-a]pyrimidin-4-one
14	193	2-(2-methyl-1,3-benzoxazol-6-yl)-7-[(3R)-3-	175-177	376.5
		methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-
		one
14	194	7-(3,3-dimethylpiperazin-1-yl)-2-(2-methyl-1,3-	160-162	390.5
		benzoxazol-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one
14	195	7-(1,4-diazepan-1-yl)-2-(2-methyl-1,3-benzoxazol-6-	134-137	376.5
		yl)-4H-pyrido[1,2-a]pyrimidin-4-one
14	196	2-(2-methyl-1,3-benzoxazol-6-yl)-7-(4-methyl-1,4-	146-150	390.5
		diazepan-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one
14	197	7-[(8aS)-hexahydropyrrolo[1,2-a]pyrazin-2(1H)-yl]-	214-217	402.5
		2-(2-methyl-1,3-benzoxazol-6-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
14	198	7-[(8aR)-hexahydropyrrolo[1,2-a]pyrazin-2(1H)-yl]-	194-199	402.5
		2-(2-methyl-1,3-benzoxazol-6-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
14	199	2-(4,5-dimethoxypyridin-2-yl)-7-(piperazin-1-yl)-	207-209	368.4
		4H-pyrido[1,2-a]pyrimidin-4-one
33	200	7-[3-(dimethylamino)pyrrolidin-1-yl]-2-(3-fluoro-4-	259-261	382.1
		methoxyphenyl)-4H-quinolizin-4-one
33	201	7-(4-aminopiperidin-1-yl)-2-(3-fluoro-4-	ND	368.2
		methoxyphenyl)-4H-quinolizin-4-one
14	202	7-(4-ethylpiperazin-1-yl)-2-(2-methyl-1,3-	212-216	390.5
		benzoxazol-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one
33	203a	7-[4-(dimethylamino)piperidin-1-yl]-2-(3-fluoro-4-	NI	NI
		methoxyphenyl)-4H-quinolizin-4-one
23	204	2-(3-fluoro-4-methoxyphenyl)-7-(1-methyl-1,2,3,6-	129-132	366
		tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-
		4-one
2	205	7-[(3S)-3-(dimethylamino)pyrrolidin-1-yl]-2-(3-	187-192	383.1
		fluoro-4-methoxyphenyl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
2	206	7-[(3R,4R)-3-(dimethylamino)-4-hydroxypyrrolidin-	223-228	399
		1-yl]-2-(3-fluoro-4-methoxyphenyl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
2	207	7-(4-aminopiperidin-1-yl)-2-(3-fluoro-4-	173-179	369.1
		methoxyphenyl)-4H-pyrido[1,2-a]pyrimidin-4-one
2	208	2-(3-fluoro-4-methoxyphenyl)-7-[4-	167-171	383.1
		(methylamino)piperidin-1-yl]-4H-pyrido[1,2-
		a]pyrimidin-4-one
16*	209	2-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-	282-288	379.4
		(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one
16	210	7-[(3R,5S)-3,5-dimethylpiperazin-1-yl]-2-(8-fluoro-	255-259	407.1
		2-methylimidazo[1,2-a]pyridin-6-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
16	211	2-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-	262-266	407.6
		(4-methyl-1,4-diazepan-1-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
2	212	2-(3-fluoro-4-methoxyphenyl)-7-[(3aR,6aS)-	195-200	381.1
		hexahydropyrrolo[3,4-c]pyrrol-2(1H)-yl]-4H-
		pyrido[1,2-a]pyrimidin-4-one
2	213	2-(3-fluoro-4-methoxyphenyl)-7-[(3aR,6aS)-5-	204-210	395.1
		methylhexahydropyrrolo[3,4-c]pyrrol-2(1H)-yl]-4H-
		pyrido[1,2-a]pyrimidin-4-one
25	214	2-(3,4-dimethoxyphenyl)-7-[1-(2-	145-148	410
		hydroxyethyl)piperidin-4-yl]-4H-pyrido[1,2-
		a]pyrimidin-4-one
14	215	2-(4-fluoro-3-methoxyphenyl)-7-[(3S)-3-	130-135	369.2
		methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-
		one
14	216	2-(4-fluoro-3-methoxyphenyl)-7-(piperazin-1-yl)-	170-172	355.2
		4H-pyrido[1,2-a]pyrimidin-4-one
14	217	2-(3,4-difluoro-5-methoxyphenyl)-7-[(3S)-3-	160-164	387.1
		methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-
		one
14	218	2-(3,4-difluoro-5-methoxyphenyl)-7-(piperazin-1-	155-160	373.1
		yl)-4H-pyrido[1,2-a]pyrimidin-4-one
14	219	2-(2-methyl-1,3-benzothiazol-6-yl)-7-(piperazin-1-	218-220	378.1
		yl)-4H-pyrido[1,2-a]pyrimidin-4-one
29*	220	7-(3-fluoro-4-methoxyphenyl)-2-(piperazin-1-yl)-	202-206	355
		4H-pyrido[1,2-a]pyrimidin-4-one
14	221	2-(2-methyl-1,3-benzothiazol-6-yl)-7-[(3S)-3-	214-216	392.1
		methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-
		one
2	222	2-(3-fluoro-4-methoxyphenyl)-7-[(3S)-3-	208-216	369.1
		(methylamino)pyrrolidin-1-yl]-4H-pyrido[1,2-
		a]pyrimidin-4-one
2	223	2-(3-fluoro-4-methoxyphenyl)-7-{4-	163-170	397.1
		[(methylamino)methyl]piperidin-1-yl}-4H-
		pyrido[1,2-a]pyrimidin-4-one
2	224	7-[(3S)-3-aminopyrrolidin-1-yl]-2-(3-fluoro-4-	193-198	355
		methoxyphenyl)-4H-pyrido[1,2-a]pyrimidin-4-one
2	225	2-(3-fluoro-4-methoxyphenyl)-7-{[(3R)-1-	197-202	369.1
		methylpyrrolidin-3-yl]amino}-4H-pyrido[1,2-
		a]pyrimidin-4-one
2	226	7-{4-[(dimethylamino)methyl]piperidin-1-yl}-2-(3-	178-185	411.1
		fluoro-4-methoxyphenyl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
14	227	2-(6-methoxypyridin-2-yl)-7-(piperazin-1-yl)-4H-	214-218	338.1
		pyrido[1,2-a]pyrimidin-4-one
14	228	7-(piperazin-1-yl)-2-(pyridin-3-yl)-4H-pyrido[1,2-	175-178	308
		a]pyrimidin-4-one
14	229	2-(5-methoxypyridin-3-yl)-7-(piperazin-1-yl)-4H-	192-195	338
		pyrido[1,2-a]pyrimidin-4-one
14	230	3-fluoro-5-{7-[(3S)-3-methylpiperazin-1-yl]-4-oxo-	185-188	364.2
		4H-pyrido[1,2-a]pyrimidin-2-yl}benzonitrile
14	231	3-fluoro-5-[4-oxo-7-(piperazin-1-yl)-4H-pyrido[1,2-	238-244	350.1
		a]pyrimidin-2-yl]benzonitrile
2	232	2-(3-fluoro-4-methoxyphenyl)-7-[(3′S,4′S)-4′-	226-232	425.1
		hydroxy-1,3′-bipyrrolidin-1′-yl]-4H-pyrido[1,2-
		a]pyrimidin-4-one
2	233	2-(3-fluoro-4-methoxyphenyl)-7-{methyl[(3R)-	143-147	369.1
		pyrrolidin-3-yl]amino}-4H-pyrido[1,2-a]pyrimidin-
		4-one
14	234	7-[(3S)-3,4-dimethylpiperazin-1-yl]-2-(2-methyl-1,3-	205-209	390.6
		benzoxazol-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one
27	235	2-(3,4-dimethoxyphenyl)-7-[(1-methylpiperidin-4-	ND	396.2
		yl)oxy]-4H-pyrido[1,2-a]pyrimidin-4-one
27	236	2-(3,4-dimethoxyphenyl)-7-[(3S)-pyrrolidin-3-	164-166	368.1
		yloxy]-4H-pyrido[1,2-a]pyrimidin-4-one
27*	237	2-(3,4-dimethoxyphenyl)-7-(piperidin-4-yloxy)-4H-	221-224	382.2
		pyrido[1,2-a]pyrimidin-4-one
2	238	7-(1,4-diazepan-1-yl)-2-(3,4-dimethoxyphenyl)-9-	160-177	395.5
		methyl-4H-pyrido[1,2-a]pyrimidin-4-one
2*	239	2-(3-fluoro-4-methoxyphenyl)-7-{methyl[(3R)-1-	143-149	383.5
		methylpyrrolidin-3-yl]amino}-4H-pyrido[1,2-
		a]pyrimidin-4-one
14	240	7-[4-(dimethylamino)piperidin-1-yl]-2-(2-methyl-	206-210	404.5
		1,3-benzoxazol-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-
		one
14	241	7-[(3S)-3-(dimethylamino)pyrrolidin-1-yl]-2-(2-	189-193	390.5
		methyl-1,3-benzoxazol-6-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
14	242	7-(4-aminopiperidin-1-yl)-2-(2-methyl-1,3-	ND	376.2
		benzoxazol-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one
14	243	7-[(3aR,6aS)-hexahydropyrrolo[3,4-c]pyrrol-2(1H)-	ND	388.3
		yl]-2-(2-methyl-1,3-benzoxazol-6-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
14	244	7-[(3R)-3,4-dimethylpiperazin-1-yl]-2-(2-methyl-	181-187	390.5
		1,3-benzoxazol-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-
		one
34*	245	2-(3,4-dimethoxyphenyl)-7-(1,2,3,6-	174-176	363.2
		tetrahydropyridin-4-yl)-4H-quinolizin-4-one
2	246	2-(3-fluoro-4-methoxyphenyl)-7-[(3aR,6aR)-1-	205-209	395.2
		methylhexahydropyrrolo[3,4-b]pyrrol-5(1H)-yl]-4H-
		pyrido[1,2-a]pyrimidin-4-one
2	247	2-(3,4-dimethoxyphenyl)-9-methyl-7-(1,2,3,6-	186-191	378.2
		tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-
		4-one
23	248	2-(3,4-dimethoxyphenyl)-7-[1-(2-hydroxyethyl)-	134-137	408.2
		1,2,3,6-tetrahydropyridin-4-yl]-4H-pyrido[1,2-
		a]pyrimidin-4-one
35*	249	2-(3,4-dimethoxyphenyl)-7-(1-methyl-1,2,3,6-	194-196	377.2
		tetrahydropyridin-4-yl)-4H-quinolizin-4-one
24	250	2-(3,4-dimethoxyphenyl)-9-methyl-7-(piperidin-4-	176-181	380.3
		yl)-4H-pyrido[1,2-a]pyrimidin-4-one
23	251	2-(3,4-dimethoxyphenyl)-9-methyl-7-(1-methyl-	187-196	392.2
		1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
25	252	2-(3,4-dimethoxyphenyl)-9-methyl-7-(1-	170-174	394.2
		methylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-
		one
14	253	7-(1,4-diazepan-1-yl)-2-(2-methyl-1,3-benzothiazol-	205-207	392.2
		6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one
14	254	2-(2-methyl-1,3-benzothiazol-6-yl)-7-(4-methyl-1,4-	158-160	406.1
		diazepan-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one
14	255	7-[(8aS)-hexahydropyrrolo[1,2-a]pyrazin-2(1H)-yl]-	250-260	418.1
		2-(2-methyl-1,3-benzothiazol-6-yl)-4H-pyrido[1,2-	(DR)
		a]pyrimidin-4-one
14	256	2-(2-methyl-1,3-benzothiazol-6-yl)-7-(4-	230-234	392.1
		methylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-
		one
2	257	2-(3,4-dimethoxyphenyl)-7-[(3aR,6aS)-	215 (S),	407.3
		hexahydropyrrolo[3,4-c]pyrrol-2(1H)-yl]-9-methyl-	246-251
		4H-pyrido[1,2-a]pyrimidin-4-one
9	258	7-[(3S)-3,4-dimethylpiperazin-1-yl]-2-(4,6-	220-223	404.3
		dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-
		pyrido[1,2-a]pyrimidin-4-one
9	259	2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-	254-260	418.3
		[(3R,5S)-3,4,5-trimethylpiperazin-1-yl]-4H-
		pyrido[1,2-a]pyrimidin-4-one
2	260	2-(3,4-dimethoxyphenyl)-9-methyl-7-[(3aR,6aS)-5-	212-218	421.2
		methylhexahydropyrrolo[3,4-c]pyrrol-2(1H)-yl]-4H-
		pyrido[1,2-a]pyrimidin-4-one
2	261	2-(3,4-dimethoxyphenyl)-7-[4-	167-171	423.3
		(dimethylamino)piperidin-1-yl]-9-methyl-4H-
		pyrido[1,2-a]pyrimidin-4-one
22	262	7-[(1R,5S)-8-azabicyclo[3.2.1]oct-2-en-3-yl]-2-(3,4-	191-194	390.2
		dimethoxyphenyl)-4H-pyrido[1,2-a]pyrimidin-4-one
26*	263	2-(3,4-dimethoxyphenyl)-7-(1,2,5,6-	146-150	364.2
		tetrahydropyridin-3-yl)-4H-pyrido[1,2-a]pyrimidin-
		4-one
14	264	7-[(3R)-3-(dimethylamino)pyrrolidin-1-yl]-2-(2-	203-207	390.2
		methyl-1,3-benzoxazol-6-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
14	265	2-(2-ethyl-1,3-benzoxazol-6-yl)-7-(piperazin-1-yl)-	170-175	376.2
		4H-pyrido[1,2-a]pyrimidin-4-one
14	266	2-(2-ethyl-1,3-benzoxazol-6-yl)-7-[(3S)-3-	168-170	390.2
		methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-
		one
14	267	2-(2-methyl-1,3-benzoxazol-6-yl)-7-[(3aR,6aS)-5-	200-204	402.2
		methylhexahydropyrrolo[3,4-c]pyrrol-2(1H)-yl]-4H-
		pyrido[1,2-a]pyrimidin-4-one
29	268	7-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-2-	308 (D)	379.2
		(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one
16	269	2-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-	283-286	393.3
		(4-methylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-
		4-one
16	270	2-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-	ND	393.3
		[(3R)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-
		a]pyrimidin-4-one
16	271	2-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-	270-274	419.3
		[(8aS)-hexahydropyrrolo[1,2-a]pyrazin-2(1H)-yl]-
		4H-pyrido[1,2-a]pyrimidin-4-one
16	272	2-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-	277-280	419.2
		[(8aR)-hexahydropyrrolo[1,2-a]pyrazin-2(1H)-yl]-
		4H-pyrido[1,2-a]pyrimidin-4-one
16	273	7-(4-aminopiperidin-1-yl)-2-(8-fluoro-2-	ND	393.3
		methylimidazo[1,2-a]pyridin-6-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
16	274	7-[(3R)-3-(dimethylamino)pyrrolidin-1-yl]-2-(8-	300 (D)	407.3
		fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-4H-
		pyrido[1,2-a]pyrimidin-4-one
16	275	7-[(3S)-3-(dimethylamino)pyrrolidin-1-yl]-2-(8-	294-297	407.3
		fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-4H-
		pyrido[1,2-a]pyrimidin-4-one
30*	276	2-(4-aminopiperidin-1-yl)-7-(3-fluoro-4-	268-283	369.3
		methoxyphenyl)-4H-pyrido[1,2-a]pyrimidin-4-one
30	277	2-[(3R)-3-(dimethylamino)pyrrolidin-1-yl]-7-(3-	167-170	383.2
		fluoro-4-methoxyphenyl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
30	278	2-[(3S)-3-(dimethylamino)pyrrolidin-1-yl]-7-(3-	167-169	383.2
		fluoro-4-methoxyphenyl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
2	279	2-(3-fluoro-4-methoxyphenyl)-7-[(3aR,6aS)-5-(2-	180-186	425.3
		hydroxyethyl)hexahydropyrrolo[3,4-c]pyrrol-2(1H)-
		yl]-4H-pyrido[1,2-a]pyrimidin-4-one
2	280	2-(3-fluoro-4-methoxyphenyl)-7-[(3aS,6aS)-1-	207-211	395.3
		methylhexahydropyrrolo[3,4-b]pyrrol-5(1H)-yl]-4H-
		pyrido[1,2-a]pyrimidin-4-one
2	281	2-(3-fluoro-4-methoxyphenyl)-7-[(3aR,6aS)-5-	189-192	423.3
		(propan-2-yl)hexahydropyrrolo[3,4-c]pyrrol-2(1H)-
		yl]-4H-pyrido[1,2-a]pyrimidin-4-one
2	282	7-[(3R)-3-(dimethylamino)pyrrolidin-1-yl]-2-(3-	188-191	383.3
		fluoro-4-methoxyphenyl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
14	283	7-(3,3-dimethylpiperazin-1-yl)-2-(2-methyl-1,3-	200-202	406.3
		benzothiazol-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one
14	284	7-[(8aR)-hexahydropyrrolo[1,2-a]pyrazin-2(1H)-yl]-	254-256	418.2
		2-(2-methyl-1,3-benzothiazol-6-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
14	285	7-[4-(dimethylamino)piperidin-1-yl]-2-(2-methyl-	ND	420.2
		1,3-benzothiazol-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-
		one
27	286	2-(2-methyl-1,3-benzothiazol-6-yl)-7-(piperidin-4-	218-220	393.1
		yloxy)-4H-pyrido[1,2-a]pyrimidin-4-one
16	287	2-(8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-	245-251	395.2
		(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one
16	288	2-(8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-	289-295	423.1
		[(3R,5S)-3,5-dimethylpiperazin-1-yl]-4H-pyrido[1,2-
		a]pyrimidin-4-one
16	289	2-(8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-	239-244	423.2
		(4-methyl-1,4-diazepan-1-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
16	290	2-(8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-	236-239	409.1
		[(3R)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-
		a]pyrimidin-4-one
16	291	2-(8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-	236-239	409.1
		[(3S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-
		a]pyrimidin-4-one
16	292	2-(8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-	274-280	435.2
		[(8aR)-hexahydropyrrolo[1,2-a]pyrazin-2(1H)-yl]-
		4H-pyrido[1,2-a]pyrimidin-4-one
16	293	2-(8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-	269-275	435.2
		[(8aS)-hexahydropyrrolo[1,2-a]pyrazin-2(1H)-yl]-
		4H-pyrido[1,2-a]pyrimidin-4-one
46*	294	7-(3-fluoro-4-methoxyphenyl)-2-(1,2,3,6-	188-192	352.1
		tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-
		4-one
39	295	7-[(3S)-3,4-dimethylpiperazin-1-yl]-2-(8-fluoro-2-	269-275	407.3
		methylimidazo[1,2-a]pyridin-6-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
39	296	7-[(3R)-3,4-dimethylpiperazin-1-yl]-2-(8-fluoro-2-	279-282	407.3
		methylimidazo[1,2-a]pyridin-6-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
39	297	7-[4-(dimethylamino)piperidin-1-yl]-2-(8-fluoro-2-	250-257	421.3
		methylimidazo[1,2-a]pyridin-6-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
39	298	2-[4-(dimethylamino)piperidin-1-yl]-7-(3-fluoro-4-	157-160	397.2
		methoxyphenyl)-4H-pyrido[1,2-a]pyrimidin-4-one
37	299	2-(4-fluoro-2-methyl-1,3-benzoxazol-6-yl)-7-	177-180	377.2
		(1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
23	300	2-(4-fluoro-2-methyl-1,3-benzoxazol-6-yl)-7-(1-	178-181	391.3
		methyl-1,2,3,6-tetrahydropyridin-4-yl)-4H-
		pyrido[1,2-a]pyrimidin-4-one
2	301	2-(3-fluoro-4-methoxyphenyl)-7-[(4aR,7aR)-	194-201	395.2
		octahydro-6H-pyrrolo[3,4-b]pyridin-6-yl]-4H-
		pyrido[1,2-a]pyrimidin-4-one
37	302	2-(2-methyl-1,3-benzoxazol-6-yl)-7-(1,2,3,6-	ND	359.2
		tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-
		4-one
23	303	2-(2-methyl-1,3-benzoxazol-6-yl)-7-(1-methyl-	132-135	373.3
		1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
23	304	7-(1-ethyl-1,2,3,6-tetrahydropyridin-4-yl)-2-(2-	128-131	387.3
		methyl-1,3-benzoxazol-6-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
36	305	2-(4-fluoro-2-methyl-1,3-benzoxazol-6-yl)-7-	184-186	380.3
		(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one
36*	306	2-(4-fluoro-2-methyl-1,3-benzoxazol-6-yl)-7-[(3S)-	207-209	394.3
		3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-
		4-one
39	307	7-[(3S)-3,4-dimethylpiperazin-1-yl]-2-(4-fluoro-2-	194-196	408.3
		methyl-1,3-benzoxazol-6-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
36	308	2-(4-fluoro-2-methyl-1,3-benzoxazol-6-yl)-7-(4-	219-221	394.1
		methylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-
		one
36	309	7-(4-ethylpiperazin-1-yl)-2-(4-fluoro-2-methyl-1,3-	212-214	408.2
		benzoxazol-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one
36	310	2-(4-fluoro-2-methyl-1,3-benzoxazol-6-yl)-7-(4-	175-178	422.1
		propylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-
		one
2	311	7-[(3aR,6aS)-5-ethylhexahydropyrrolo[3,4-c]pyrrol-	157-167	409.1
		2(1H)-yl]-2-(3-fluoro-4-methoxyphenyl)-4H-
		pyrido[1,2-a]pyrimidin-4-one
22	312	2-(3-fluoro-4-methoxyphenyl)-9-methyl-7-(1,2,3,6-	211-215	366.1
		tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-
		4-one
2	313	2-(3-fluoro-4-methoxyphenyl)-7-[(4aR,7aR)-1-	223-227	409.1
		methyloctahydro-6H-pyrrolo[3,4-b]pyridin-6-yl]-4H-
		pyrido[1,2-a]pyrimidin-4-one
2	314	2-(3,4-dimethoxyphenyl)-9-methyl-7-[(3R)-3-	177-184	395.2
		methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-
		one
23	315	2-(3-fluoro-4-methoxyphenyl)-9-methyl-7-(1-	184-190	380.1
		methyl-1,2,3,6-tetrahydropyridin-4-yl)-4H-
		pyrido[1,2-a]pyrimidin-4-one
24	316	7-(3-fluoro-4-methoxyphenyl)-2-(piperidin-4-yl)-	278-281	354.1
		4H-pyrido[1,2-a]pyrimidin-4-one
25	317	7-(3-fluoro-4-methoxyphenyl)-2-(1-methylpiperidin-	202-205	368.1
		4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one
23	318	7-(1-ethyl-1,2,3,6-tetrahydropyridin-4-yl)-2-(4-	151-154	405.2
		fluoro-2-methyl-1,3-benzoxazol-6-yl)-4H-
		pyrido[1,2-a]pyrimidin-4-one
23	319	2-(4-fluoro-2-methyl-1,3-benzoxazol-6-yl)-7-(1-	159-162	419.3
		propyl-1,2,3,6-tetrahydropyridin-4-yl)-4H-
		pyrido[1,2-a]pyrimidin-4-one
25	320	2-(3,4-dimethoxyphenyl)-7-[(1R,5S)-8-methyl-8-	ND	406.2
		azabicyclo[3.2.1]oct-3-yl]-4H-pyrido[1,2-
		a]pyrimidin-4-one
2	321	2-(3,4-dimethoxyphenyl)-7-[(2R)-2-methylpiperazin-	ND	381.1
		1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one
54*	322	2-(2-methyl-1,3-benzoxazol-6-yl)-7-[(3S)-3-	115-117	375.3
		methylpiperazin-1-yl]-4H-quinolizin-4-one
54	323	2-(2-methyl-1,3-benzoxazol-6-yl)-7-(4-	ND	375.1
		methylpiperazin-1-yl)-4H-quinolizin-4-one
39	324	7-[(3S)-4-ethyl-3-methylpiperazin-1-yl]-2-(2-	288-290	403.2
		methyl-1,3-benzoxazol-6-yl)-4H-quinolizin-4-one
39	325	7-[(3S)-3,4-dimethylpiperazin-1-yl]-2-(2-methyl-1,3-	>300	389.2
		benzoxazol-6-yl)-4H-quinolizin-4-one
45	326	7-(4-aminopiperidin-1-yl)-2-(2-methyl-1,3-	288-290	375.2
		benzoxazol-6-yl)-4H-quinolizin-4-one
2	327	2-(3-fluoro-4-methoxyphenyl)-9-methyl-7-[(3S)-3-	198-202	383.1
		methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-
		one
2	328	7-[4-(dimethylamino)piperidin-1-yl]-2-(3-fluoro-4-	141-145	411.2
		methoxyphenyl)-9-methyl-4H-pyrido[1,2-
		a]pyrimidin-4-one
25	329	2-(3-fluoro-4-methoxyphenyl)-9-methyl-7-(1-	198-203	382.2
		methylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-
		one
53	330	7-[4-(cyclopropylamino)piperidin-1-yl]-2-(3,4-	141 (S),	435.3
		dimethoxyphenyl)-9-methyl-4H-pyrido[1,2-	158-161
		a]pyrimidin-4-one
39	331	2-(8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-	258-262	423.2
		[(3S)-3,4-dimethylpiperazin-1-yl]-4H-pyrido[1,2-
		a]pyrimidin-4-one
2	332	2-(3,4-dimethoxyphenyl)-7-[(3R,5S)-3,5-	225-233	409.3
		dimethylpiperazin-1-yl]-9-methyl-4H-pyrido[1,2-
		a]pyrimidin-4-one
2	333	2-(3,4-dimethoxyphenyl)-7-[(3R)-3,4-	148 (S),	409.3
		dimethylpiperazin-1-yl]-9-methyl-4H-pyrido[1,2-	168-177
		a]pyrimidin-4-one
9	334	2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-(4-	169-171	404.4
		methyl-1,4-diazepan-1-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
9	335	2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-	ND	390.4
		[(3R)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-
		a]pyrimidin-4-one
9	336	2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-	215-218	416.3
		[(8aS)-hexahydropyrrolo[1,2-a]pyrazin-2(1H)-yl]-
		4H-pyrido[1,2-a]pyrimidin-4-one
9	337	2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-	228-230	416.4
		[(8aR)-hexahydropyrrolo[1,2-a]pyrazin-2(1H)-yl]-
		4H-pyrido[1,2-a]pyrimidin-4-one
9	338	2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-(4-	251-253	404.4
		ethylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-
		one
9	339	7-[4-(dimethylamino)piperidin-1-yl]-2-(4,6-	208-210	418.4
		dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-
		pyrido[1,2-a]pyrimidin-4-one
9	340	7-(3,3-dimethylpiperazin-1-yl)-2-(4,6-	195-197	404.4
		dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-
		pyrido[1,2-a]pyrimidin-4-one
9	341	7-(4-cyclopropylpiperazin-1-yl)-2-(4,6-	189-192	416.4
		dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-
		pyrido[1,2-a]pyrimidin-4-one
38*	342	2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-	207-210	373.3
		(1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
39	343	2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-	ND	418.4
		[(3R)-4-ethyl-3-methylpiperazin-1-yl]-4H-
		pyrido[1,2-a]pyrimidin-4-one
2	344	2-(3,4-dimethoxyphenyl)-9-methyl-7-(4-	191-198	395.3
		methylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-
		one
2	345	2-(3,4-dimethoxyphenyl)-7-[4-	146-150	437.3
		(dimethylamino)piperidin-1-yl]-9-ethyl-4H-
		pyrido[1,2-a]pyrimidin-4-one
23	346	2-(3,4-dimethoxyphenyl)-7-[1-(2-hydroxyethyl)-	169-179	422.3
		1,2,3,6-tetrahydropyridin-4-yl]-9-methyl-4H-
		pyrido[1,2-a]pyrimidin-4-one
14	347	7-[4-(dimethylamino)piperidin-1-yl]-2-(2-methyl-	218-220	420.2
		1,3-benzothiazol-5-yl)-4H-pyrido[1,2-a]pyrimidin-4-
		one
45	348	7-(4-aminopiperidin-1-yl)-2-(2-methyl-1,3-	190-192	392.1
		benzothiazol-5-yl)-4H-pyrido[1,2-a]pyrimidin-4-one
45	349	7-[(3aR,6aS)-hexahydropyrrolo[3,4-c]pyrrol-2(1H)-	ND	404.1
		yl]-2-(2-methyl-1,3-benzothiazol-5-yl)-4H-
		pyrido[1,2-a]pyrimidin-4-one
23	350	2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-(1-	193-197	387.4
		methyl-1,2,3,6-tetrahydropyridin-4-yl)-4H-
		pyrido[1,2-a]pyrimidin-4-one
23	351	2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-(1-	202-204	401.4
		ethyl-1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
23	352	2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-(1-	191-193	415.5
		propyl-1,2,3,6-tetrahydropyridin-4-yl)-4H-
		pyrido[1,2-a]pyrimidin-4-one
49*	353	2-(3,4-dimethoxyphenyl)-7-(1,2,3,6-	ND	365.1
		tetrahydropyridin-4-yl)-4H-pyrimido[1,2-
		a]pyrimidin-4-one
23	354	7-(1-cyclopropyl-1,2,3,6-tetrahydropyridin-4-yl)-2-	ND	413.4
		(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-
		pyrido[1,2-a]pyrimidin-4-one
23	355	2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[1-	186-189	415.4
		(propan-2-yl)-1,2,3,6-tetrahydropyridin-4-yl]-4H-
		pyrido[1,2-a]pyrimidin-4-one
23	356	7-(1-cyclobutyl-1,2,3,6-tetrahydropyridin-4-yl)-2-	191-193	427.4
		(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-
		pyrido[1,2-a]pyrimidin-4-one
23	357	2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[1-	ND	429.3
		(oxetan-3-yl)-1,2,3,6-tetrahydropyridin-4-yl]-4H-
		pyrido[1,2-a]pyrimidin-4-one
53	358	2-(3,4-dimethoxyphenyl)-9-methyl-7-[4-	ND	409.3
		(methylamino)piperidin-1-yl]-4H-pyrido[1,2-
		a]pyrimidin-4-one
53	359	2-(3,4-dimethoxyphenyl)-7-[4-	ND	423.4
		(ethylamino)piperidin-1-yl]-9-methyl-4H-pyrido[1,2-
		a]pyrimidin-4-one
2	360	2-(3,4-dimethoxyphenyl)-8-methyl-7-(piperazin-1-	161-169	381.3
		yl)-4H-pyrido[1,2-a]pyrimidin-4-one
39	361	2-(3,4-dimethoxyphenyl)-7-[4-(propan-2-	ND	423.3
		ylamino)piperidin-1-yl]-4H-pyrido[1,2-a]pyrimidin-
		4-one
23	362	7-(1-cyclobutyl-1,2,3,6-tetrahydropyridin-4-yl)-2-	152-154	418.3
		(3,4-dimethoxyphenyl)-4H-pyrido[1,2-a]pyrimidin-
		4-one
23	363	2-(3,4-dimethoxyphenyl)-7-[1-(propan-2-yl)-1,2,3,6-	116-118	406.3
		tetrahydropyridin-4-yl]-4H-pyrido[1,2-a]pyrimidin-
		4-one
23	364	2-(3,4-dimethoxyphenyl)-7-[1-(oxetan-3-yl)-1,2,3,6-	178-180	420.3
		tetrahydropyridin-4-yl]-4H-pyrido[1,2-a]pyrimidin-
		4-one
23	365	2-(3,4-dimethoxyphenyl)-7-(1-propyl-1,2,3,6-	158-160	406.2
		tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-
		4-one
22	366	2-(3,4-dimethoxyphenyl)-7-[4-	232-235	392.3
		(methylamino)cyclohex-1-en-1-yl]-4H-pyrido[1,2-
		a]pyrimidin-4-one
23	367	2-(3,4-dimethoxyphenyl)-7-[4-	162-164	406.2
		(dimethylamino)cyclohex-1-en-1-yl]-4H-pyrido[1,2-
		a]pyrimidin-4-one
23	368	2-(3,4-dimethoxyphenyl)-7-{4-	132-134	420.4
		[ethyl(methyl)amino]cyclohex-1-en-1-yl}-4H-
		pyrido[1,2-a]pyrimidin-4-one
23	369	2-(3,4-dimethoxyphenyl)-7-{4-	116-118	434.4
		[methyl(propyl)amino]cyclohex-1-en-1-yl}-4H-
		pyrido[1,2-a]pyrimidin-4-one
23	370	2-(3,4-dimethoxyphenyl)-7-(1-ethyl-1,2,3,6-	170-172	392.3
		tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-
		4-one
46	371	7-(3,4-dimethoxyphenyl)-2-(1,2,3,6-	172-178	364.3
		tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-
		4-one
46	372	7-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-2-	ND	376.2
		(1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
16	373	2-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-	260-264	421.3
		[4-(propan-2-yl)piperazin-1-yl]-4H-pyrido[1,2-
		a]pyrimidin-4-one
16	374	2-(8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-	287-292	437.4
		[4-(propan-2-yl)piperazin-1-yl]-4H-pyrido[1,2-
		a]pyrimidin-4-one
46	375	7-(2-methylimidazo[1,2-a]pyridin-6-yl)-2-(1,2,3,6-	197-201	358.2
		tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-
		4-one
23	376	7-(2-methylimidazo[1,2-a]pyridin-6-yl)-2-(1-methyl-	203-207	372.2
		1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
23	377	7-(3,4-dimethoxyphenyl)-2-(1-methyl-1,2,3,6-	149-152	378.3
		tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-
		4-one
23	378	2-(3,4-dimethoxyphenyl)-9-methyl-7-(1-propyl-	171-177	420.3
		1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
23	379	7-(1-cyclobutyl-1,2,3,6-tetrahydropyridin-4-yl)-2-	167-178	432.3
		(3,4-dimethoxyphenyl)-9-methyl-4H-pyrido[1,2-
		a]pyrimidin-4-one
55	380a	2-(2-methyl-1,3-benzothiazol-6-yl)-7-(piperidin-4-	NI	NI
		yl)-4H-pyrimido[1,2-b]pyridazin-4-one
45	381	7-(4-aminopiperidin-1-yl)-2-(2-methyl-1,3-	190-194	392.2
		benzothiazol-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one
45	382	7-(3-aminopyrrolidin-1-yl)-2-(2-methyl-1,3-	196-200	378.2
		benzothiazol-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one
14	383	7-[(3R)-3-(dimethylamino)pyrrolidin-1-yl]-2-(2-	235-240	406.3
		methyl-1,3-benzothiazol-6-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
37	384	2-(2-methyl-1,3-benzothiazol-6-yl)-7-(1,2,3,6-	124-126	375.2
		tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-
		4-one
16	385	2-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-	258-262	437.5
		[4-(2-methoxyethyl)piperazin-1-yl]-4H-pyrido[1,2-
		a]pyrimidin-4-one
23	386	2-(3,4-dimethoxyphenyl)-9-methyl-7-[1-(oxetan-3-	180-195	434.3
		yl)-1,2,3,6-tetrahydropyridin-4-yl]-4H-pyrido[1,2-	(DR)
		a]pyrimidin-4-one
23	387	2-(3,4-dimethoxyphenyl)-9-methyl-7-[1-(propan-2-	153-163	420.4
		yl)-1,2,3,6-tetrahydropyridin-4-yl]-4H-pyrido[1,2-
		a]pyrimidin-4-one
23	388	2-(3,4-dimethoxyphenyl)-7-(1-ethyl-1,2,3,6-	ND	406.4
		tetrahydropyridin-4-yl)-9-methyl-4H-pyrido[1,2-
		a]pyrimidin-4-one
22	389	2-(3,4-dimethoxyphenyl)-8-methyl-7-(1,2,3,6-	175 (D)	378.3
		tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-
		4-one
23	390	7-(1-cyclopropyl-1,2,3,6-tetrahydropyridin-4-yl)-2-	180-189	418.4
		(3,4-dimethoxyphenyl)-9-methyl-4H-pyrido[1,2-
		a]pyrimidin-4-one
23	391	2-(3,4-dimethoxyphenyl)-8-methyl-7-(1-methyl-	174-178	392.4
		1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
23	392	2-(2-methyl-1,3-benzothiazol-6-yl)-7-(1-methyl-	170-172	389.2
		1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
23	393	7-[1-(2-hydroxyethyl)-1,2,3,6-tetrahydropyridin-4-	178-180	419.2
		yl]-2-(2-methyl-1,3-benzothiazol-6-yl)-4H-
		pyrido[1,2-a]pyrimidin-4-one
23	394	2-(2-methyl-1,3-benzothiazol-6-yl)-7-[1-(propan-2-	168-170	417.2
		yl)-1,2,3,6-tetrahydropyridin-4-yl]-4H-pyrido[1,2-
		a]pyrimidin-4-one
23	395	7-(1-cyclopropyl-1,2,3,6-tetrahydropyridin-4-yl)-2-	158-160	415.3
		(2-methyl-1,3-benzothiazol-6-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
23	396	7-(1-ethyl-1,2,3,6-tetrahydropyridin-4-yl)-2-(2-	128-130	403.2
		methyl-1,3-benzothiazol-6-yl)-4H-pyrido[1,2-	(DR)
		a]pyrimidin-4-one
39	397	7-[(3R)-3,4-dimethylpiperazin-1-yl]-2-(4,6-	247-249	404.5
		dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-
		pyrido[1,2-a]pyrimidin-4-one
56*	398	2-(3,4-dimethoxyphenyl)-7-(1,2,3,6-	195-200	365.3
		tetrahydropyridin-4-yl)-4H-pyrimido[1,2-
		b]pyridazin-4-one
9	399	7-[(1S,4S)-2,5-diazabicyclo[2.2.1]hept-2-yl]-2-(4,6-	218-221	388.3
		dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-
		pyrido[1,2-a]pyrimidin-4-one
39	400	2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-	188-191	402.3
		[(1S,4S)-5-methyl-2,5-diazabicyclo[2.2.1]hept-2-yl]-
		4H-pyrido[1,2-a]pyrimidin-4-one
39	401	2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-	175-177	416.4
		[(1S,4S)-5-ethyl-2,5-diazabicyclo[2.2.1]hept-2-yl]-
		4H-pyrido[1,2-a]pyrimidin-4-one
57*	402	2-(3,4-dimethoxyphenyl)-7-(1,2,3,6-	205-208	365.4
		tetrahydropyridin-4-yl)-4H-pyrazino[1,2-
		a]pyrimidin-4-one
24	403	2-(3-fluoro-4-methoxyphenyl)-7-(piperidin-4-yl)-	122-125	354.3
		4H-pyrido[1,2-a]pyrimidin-4-one
25	404	2-(3,4-dimethoxyphenyl)-7-(1-ethylpiperidin-4-yl)-	155-157	394.4
		4H-pyrido[1,2-a]pyrimidin-4-one
24	405	2-(3,4-dimethoxyphenyl)-7-[cis-4-	156-158	394.4
		(methylamino)cyclohexyl]-4H-pyrido[1,2-
		a]pyrimidin-4-one
24	406	2-(3,4-dimethoxyphenyl)-7-(piperidin-3-yl)-4H-	126-129	366.3
		pyrido[1,2-a]pyrimidin-4-one
53*	407	2-(3,4-dimethoxyphenyl)-9-methyl-7-[4-	178-184	437.5
		(propylamino)piperidin-1-yl]-4H-pyrido[1,2-
		a]pyrimidin-4-one
22	408	2-(3,4-dimethoxyphenyl)-9-ethyl-7-(1,2,3,6-	171-177	392.4
		tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-
		4-one
24	409	7-(2-methylimidazo[1,2-a]pyridin-6-yl)-2-(piperidin-	255-258	360.4
		4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one
24	410	7-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-2-	295-298	378.4
		(piperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one
23	411	7-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-2-	218-222	390.4
		(1-methyl-1,2,3,6-tetrahydropyridin-4-yl)-4H-
		pyrido[1,2-a]pyrimidin-4-one
16	412	7-(4-cyclopropylpiperazin-1-yl)-2-(8-fluoro-2-	254-258	419.4
		methylimidazo[1,2-a]pyridin-6-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
57	413a	2-(1,3-dimethylpyrrolo[1,2-a]pyrazin-7-yl)-7-	NI	NI
		(1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrazino[1,2-
		a]pyrimidin-4-one
2	414	2-(3,4-dimethoxyphenyl)-7-[(8aR)-	ND	421.4
		hexahydropyrrolo[1,2-a]pyrazin-2(1H)-yl]-9-methyl-
		4H-pyrido[1,2-a]pyrimidin-4-one
23	415	2-(3,4-dimethoxyphenyl)-9-ethyl-7-(1-methyl-	177-182	406.4
		1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
53	416	2-(3,4-dimethoxyphenyl)-9-methyl-7-[4-(propan-2-	178-183	437.5
		ylamino)piperidin-1-yl]-4H-pyrido[1,2-a]pyrimidin-
		4-one
2	417	2-(3,4-dimethoxyphenyl)-7-[(8aS)-	183-189	421.4
		hexahydropyrrolo[1,2-a]pyrazin-2(1H)-yl]-9-methyl-
		4H-pyrido[1,2-a]pyrimidin-4-one
23	418	2-(3,4-dimethoxyphenyl)-9-ethyl-7-(1-ethyl-1,2,3,6-	148-153	420.5
		tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-
		4-one
53	419	2-(3,4-dimethoxyphenyl)-9-methyl-7-[4-(morpholin-	219-224	465.5
		4-yl)piperidin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-
		one
9	420	2-(6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-	202-204	362.2
		(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one
57	421	2-(2-methyl-1,3-benzoxazol-6-yl)-7-(1,2,3,6-	ND	360.1
		tetrahydropyridin-4-yl)-4H-pyrazino[1,2-
		a]pyrimidin-4-one hydrochloride (1:1)
23	422	2-(2-methyl-1,3-benzoxazol-6-yl)-7-(1-methyl-	240-242	374.3
		1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrazino[1,2-
		a]pyrimidin-4-one
23	423	7-(1-ethyl-1,2,3,6-tetrahydropyridin-4-yl)-2-(2-	225-227	388.4
		methyl-1,3-benzoxazol-6-yl)-4H-pyrazino[1,2-
		a]pyrimidin-4-one
24	424	2-(2-methyl-1,3-benzothiazol-6-yl)-7-(piperidin-4-	222-224	377.1
		yl)-4H-pyrido[1,2-a]pyrimidin-4-one
9	425	2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[4-	215-218	444.4
		(pyrrolidin-1-yl)piperidin-1-yl]-4H-pyrido[1,2-
		a]pyrimidin-4-one
9	426	7-(1,4′-bipiperidin-1′-yl)-2-(4,6-	236-238	458.4
		dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-
		pyrido[1,2-a]pyrimidin-4-one
9	427	2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[4-(4-	198-200	473.5
		methylpiperazin-1-yl)piperidin-1-yl]-4H-pyrido[1,2-
		a]pyrimidin-4-one
9	428	2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[4-	192-195	460.4
		(morpholin-4-yl)piperidin-1-yl]-4H-pyrido[1,2-
		a]pyrimidin-4-one
37	429	2-(2-methylimidazo[1,2-a]pyridin-6-yl)-7-(1,2,3,6-	206-208	358.4
		tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-
		4-one
23	430	2-(2-methylimidazo[1,2-a]pyridin-6-yl)-7-(1-methyl-	137-140	372.2
		1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
23	431	7-(1-ethyl-1,2,3,6-tetrahydropyridin-4-yl)-2-(2-	220-223	386.4
		methylimidazo[1,2-a]pyridin-6-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
14	432	7-[4-(dimethylamino)piperidin-1-yl]-2-(2-	204-206	403.4
		methylimidazo[1,2-a]pyridin-6-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
53	433	2-(3,4-dimethoxyphenyl)-7-{4-[(2-	185-193	439.4
		hydroxyethyl)amino]piperidin-1-yl}-9-methyl-4H-
		pyrido[1,2-a]pyrimidin-4-one
25	434	2-(3,4-dimethoxyphenyl)-9-ethyl-7-(1-	146 (S),	408.4
		methylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-	166-169
		one
53	435	7-[4-(diethylamino)piperidin-1-yl]-2-(3,4-	149-155	451.5
		dimethoxyphenyl)-9-methyl-4H-pyrido[1,2-
		a]pyrimidin-4-one
25	436	2-(3,4-dimethoxyphenyl)-9-ethyl-7-(1-	157-162	422.4
		ethylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-
		one
14	437	2-(2-methylimidazo[1,2-a]pyridin-6-yl)-7-[4-	230-232	429.4
		(pyrrolidin-1-yl)piperidin-1-yl]-4H-pyrido[1,2-
		a]pyrimidin-4-one
51	438	2-(2-methylimidazo[1,2-a]pyridin-6-yl)-7-(piperidin-	298-300	360.1
		4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one
25	439	2-(2-methyl-1,3-benzothiazol-6-yl)-7-(1-	240-242	391.4
		methylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-
		one
9	440	7-(4-methylpiperazin-1-yl)-2-(6-methylpyrazolo[1,5-	230-240	376.2
		a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one	(DR)
9	441	7-[(3S)-3-methylpiperazin-1-yl]-2-(6-	235-240	376.2
		methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-	(DR)
		a]pyrimidin-4-one
9	442	7-[(3R,5S)-3,5-dimethylpiperazin-1-yl]-2-(6-	258-260	390.3
		methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
37*	443	2-(1-methyl-1H-indazol-5-yl)-7-(1,2,3,6-	200-203	358.2
		tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-
		4-one
37	444	2-[6-(dimethylamino)pyridin-3-yl]-7-(1,2,3,6-	255-257	348.4
		tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-
		4-one
37	445	7-[4-(diethylamino)piperidin-1-yl]-2-(2-	208-210	431.4
		methylimidazo[1,2-a]pyridin-6-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
53	446	2-(3,4-dimethoxyphenyl)-7-{4-[(2-	164-171	453.5
		hydroxyethyl)(methyl)amino]piperidin-1-yl}-9-
		methyl-4H-pyrido[1,2-a]pyrimidin-4-one
2	447	2-(3,4-dimethoxyphenyl)-9-ethyl-7-[(3R)-3-	140-147	409.2
		methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-
		one
25	448	2-(2-methylimidazo[1,2-a]pyridin-6-yl)-7-(1-	218-220	374.3
		methylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-
		one
23	449	2-(1-methyl-1H-indazol-5-yl)-7-(1-methyl-1,2,3,6-	148-150	372.3
		tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-
		4-one
23	450	2-[6-(dimethylamino)pyridin-3-yl]-7-(1-methyl-	214-216	362.4
		1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
9	451	7-[4-(diethylamino)piperidin-1-yl]-2-(4,6-	232-235	446.5
		dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-
		pyrido[1,2-a]pyrimidin-4-one
24	452	2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-	ND	375.4
		(piperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one
25	453	2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-(1-	220-222	389.3
		methylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-
		one
25	454	2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-(1-	170-172	403.3
		ethylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-
		one
2	455	2-(3,4-dimethoxyphenyl)-9-ethyl-7-[(8aR)-	180-184	435.3
		hexahydropyrrolo[1,2-a]pyrazin-2(1H)-yl]-4H-
		pyrido[1,2-a]pyrimidin-4-one
53	456	2-(3,4-dimethoxyphenyl)-7-{4-[(2-	178-182	453.3
		methoxyethyl)amino]piperidin-1-yl}-9-methyl-4H-
		pyrido[1,2-a]pyrimidin-4-one
9	457	2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-9-	262-271	404.2
		methyl-7-(4-methylpiperazin-1-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
2	458	2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-	244-256	430.3
		[(8aR)-hexahydropyrrolo[1,2-a]pyrazin-2(1H)-yl]-9-
		methyl-4H-pyrido[1,2-a]pyrimidin-4-one
2	459	7-[4-(dimethylamino)piperidin-1-yl]-2-(4,6-	231-241	432.4
		dimethylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-4H-
		pyrido[1,2-a]pyrimidin-4-one
25	460	7-(2-methylimidazo[1,2-a]pyridin-6-yl)-2-(1-	227-230	374.3
		methylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-
		one
25	461	7-(2-methylimidazo[1,2-a]pyridin-6-yl)-2-[1-	215-218	402.3
		(propan-2-yl)piperidin-4-yl]-4H-pyrido[1,2-
		a]pyrimidin-4-one
25	462	7-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-2-	235-238	392.3
		(1-methylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-
		4-one
23	463	7-(1-ethyl-1,2,3,6-tetrahydropyridin-4-yl)-2-(1-	172-174	386.3
		methyl-1H-indazol-5-yl)-4H-pyrido[1,2-a]pyrimidin-
		4-one
23	464	2-(1-methyl-1H-indazol-5-yl)-7-(1-propyl-1,2,3,6-	152-154	400.4
		tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-
		4-one
24	465	2-[6-(dimethylamino)pyridin-3-yl]-7-(piperidin-4-	208-210	350.3
		yl)-4H-pyrido[1,2-a]pyrimidin-4-one
9	466	7-(4-ethylpiperazin-1-yl)-2-(6-methylpyrazolo[1,5-	220-230	390.3
		a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one	(DR)
9	467	7-[(8aR)-hexahydropyrrolo[1,2-a]pyrazin-2(1H)-yl]-	240-250	402.3
		2-(6-methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-	(DR)
		pyrido[1,2-a]pyrimidin-4-one
9	468	7-[4-(dimethylamino)piperidin-1-yl]-2-(6-	240-242	404.3
		methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
9	469	7-[4-(2-hydroxyethyl)piperazin-1-yl]-2-(6-	254-256	406.3
		methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
25	470	2-(2-methylimidazo[1,2-a]pyridin-6-yl)-7-(1-	159-161	402.4
		propylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-
		one
23	471	7-[1-(2-hydroxyethyl)-1,2,3,6-tetrahydropyridin-4-	ND	402.3
		yl]-2-(1-methyl-1H-indazol-5-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
9	472	7-[(3R)-3-methylpiperazin-1-yl]-2-(6-	240-244	376.2
		methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
38	473	2-(6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-(1,2,3,6-	260-265	359.2
		tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-	(DR)
		4-one
37	474	2-(2-methyl-2H-indazol-5-yl)-7-(1,2,3,6-	239-241	358.4
		tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-
		4-one
37	475	2-(1-methyl-1H-indazol-5-yl)-7-(1-methylpiperidin-	216-218	374.4
		4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one
25	476	2-(2-methyl-2H-indazol-5-yl)-7-(1-methyl-1,2,3,6-	226-228	372.3
		tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-
		4-one
23	477	7-(1-ethyl-1,2,3,6-tetrahydropyridin-4-yl)-2-(2-	198-200	386.4
		methyl-2H-indazol-5-yl)-4H-pyrido[1,2-a]pyrimidin-
		4-one
23	478	7-(1-ethylpiperidin-4-yl)-2-(2-methylimidazo[1,2-	190-192	388.4
		a]pyridin-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one
23	479	2-(1,3-dimethylpyrrolo[1,2-a]pyrazin-7-yl)-7-[1-	220-222	415.3
		(propan-2-yl)-1,2,3,6-tetrahydropyridin-4-yl]-4H-
		pyrazino[1,2-a]pyrimidin-4-one
22	480	2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-9-	>300	387.4
		methyl-7-(1,2,3,6-tetrahydropyridin-4-yl)-4H-
		pyrido[1,2-a]pyrimidin-4-one
23	481	2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-9-	ND	401.4
		methyl-7-(1-methyl-1,2,3,6-tetrahydropyridin-4-yl)-
		4H-pyrido[1,2-a]pyrimidin-4-one
23	482	2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-(1-	ND	415.5
		ethyl-1,2,3,6-tetrahydropyridin-4-yl)-9-methyl-4H-
		pyrido[1,2-a]pyrimidin-4-one
23	483	7-(1-cyclopropyl-1,2,3,6-tetrahydropyridin-4-yl)-2-	ND	427.4
		(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-
		4H-pyrido[1,2-a]pyrimidin-4-one
23	484	2-(6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-(1-	126-128	373.2
		methyl-1,2,3,6-tetrahydropyridin-4-yl)-4H-	(DR)
		pyrido[1,2-a]pyrimidin-4-one
23	485	7-(1-ethyl-1,2,3,6-tetrahydropyridin-4-yl)-2-(6-	ND	387.3
		methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
50*	486	2-(5,7-dimethylfuro[2,3-c]pyridin-2-yl)-7-(piperazin-	198-200	376.3
		1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one
50	487	2-(5,7-dimethylfuro[2,3-c]pyridin-2-yl)-7-(4-	256-258	390.2
		methylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-
		one
50	488	2-(5,7-dimethylfuro[2,3-c]pyridin-2-yl)-7-[(3S)-3-	202-204	390.3
		methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-
		one
14	489	2-(1-methyl-1H-indazol-5-yl)-7-(4-methylpiperazin-	194-196	375.3
		1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one
14	490	2-(1-methyl-1H-indazol-5-yl)-7-(piperazin-1-yl)-4H-	206-208	361.3
		pyrido[1,2-a]pyrimidin-4-one
14	491	7-[4-(dimethylamino)piperidin-1-yl]-2-(1-methyl-	209-212	403.5
		1H-indazol-5-yl)-4H-pyrido[1,2-a]pyrimidin-4-one
14	492	7-(4-methyl-1,4-diazepan-1-yl)-2-(1-methyl-1H-	ND	389.4
		indazol-5-yl)-4H-pyrido[1,2-a]pyrimidin-4-one
23	493	7-(1-ethyl-1,2,3,6-tetrahydropyridin-4-yl)-2-(2-	205-207	388.4
		methyl-1,3-benzoxazol-6-yl)-4H-pyrimido[1,2-
		b]pyridazin-4-one
16	494	2-(8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-	264-268	423.4
		(4-ethylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-
		4-one
39	495	2-(8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-	239-245	437.5
		[(3R)-4-ethyl-3-methylpiperazin-1-yl]-4H-
		pyrido[1,2-a]pyrimidin-4-one
39	496	2-(8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-	234-245	437.5
		[(3S)-4-ethyl-3-methylpiperazin-1-yl]-4H-
		pyrido[1,2-a]pyrimidin-4-one
39	497	2-(8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-	278-281	451.3
		[(3R)-3-methyl-4-(propan-2-yl)piperazin-1-yl]-4H-
		pyrido[1,2-a]pyrimidin-4-one
39	498	2-(8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-	264-270	451.3
		[(3S)-3-methyl-4-(propan-2-yl)piperazin-1-yl]-4H-
		pyrido[1,2-a]pyrimidin-4-one
58*	499	2-(2-methyl-1,3-benzoxazol-6-yl)-7-(piperidin-4-yl)-	126-128	362.2
		4H-pyrimido[1,2-b]pyridazin-4-one
25	500	2-(2-methyl-1,3-benzoxazol-6-yl)-7-(1-	272-275	376.4
		methylpiperidin-4-yl)-4H-pyrimido[1,2-b]pyridazin-
		4-one
25	501	7-(1-ethylpiperidin-4-yl)-2-(2-methyl-1,3-	284-286	390.4
		benzoxazol-6-yl)-4H-pyrimido[1,2-b]pyridazin-4-
		one
59*	502	2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-	ND	376.4
		(piperidin-4-yl)-4H-pyrazino[1,2-a]pyrimidin-4-one
25	503	2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-(1-	257-259	390.3
		methylpiperidin-4-yl)-4H-pyrazino[1,2-a]pyrimidin-
		4-one
25	504	2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-(1-	ND	404.3
		ethylpiperidin-4-yl)-4H-pyrazino[1,2-a]pyrimidin-4-
		one
57	505	2-(1-methyl-1H-indazol-5-yl)-7-(1,2,3,6-	228-230	359.2
		tetrahydropyridin-4-yl)-4H-pyrazino[1,2-
		a]pyrimidin-4-one
23	506	2-(1-methyl-1H-indazol-5-yl)-7-(1-methyl-1,2,3,6-	234-236	373.3
		tetrahydropyridin-4-yl)-4H-pyrazino[1,2-
		a]pyrimidin-4-one
23	507	7-(1-ethyl-1,2,3,6-tetrahydropyridin-4-yl)-2-(1-	ND	387.4
		methyl-1H-indazol-5-yl)-4H-pyrazino[1,2-
		a]pyrimidin-4-one
2	508	2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-(4-	241-252	418.5
		ethylpiperazin-1-yl)-9-methyl-4H-pyrido[1,2-
		a]pyrimidin-4-one
2	509	2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-9-	213-222	404.5
		methyl-7-[(3R)-3-methylpiperazin-1-yl]-4H-
		pyrido[1,2-a]pyrimidin-4-one
2	510	7-[(3R)-3,4-dimethylpiperazin-1-yl]-2-(4,6-	244-253	418.4
		dimethylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-4H-
		pyrido[1,2-a]pyrimidin-4-one
2	511	2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-	240-245	432.5
		[(3R)-4-ethyl-3-methylpiperazin-1-yl]-9-methyl-4H-
		pyrido[1,2-a]pyrimidin-4-one
60*	512	2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-	ND	376.4
		(piperidin-4-yl)-4H-pyrimido[1,2-b]pyridazin-4-one
25	513	2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-(1-	265-267	390.3
		methylpiperidin-4-yl)-4H-pyrimido[1,2-b]pyridazin-
		4-one
25	514	2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-(1-	283-285	404.4
		ethylpiperidin-4-yl)-4H-pyrimido[1,2-b]pyridazin-4-
		one
2	515	2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-	198-200	416.3
		(octahydro-5H-pyrrolo[3,2-c]pyridin-5-yl)-4H-
		pyrido[1,2-a]pyrimidin-4-one
24	516	2-(8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-	287-293	394.2
		(piperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one
25	517	2-(8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-	292-296	408.3
		(1-methylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-
		4-one
25	518	2-(8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-	240-246	422.3
		(1-ethylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-
		one
25	519	2-(8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-	279-285	436.5
		[1-(propan-2-yl)piperidin-4-yl]-4H-pyrido[1,2-
		a]pyrimidin-4-one
2	520	2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-9-	ND	418.3
		methyl-7-(4-methyl-1,4-diazepan-1-yl)-4H-
		pyrido[1,2-a]pyrimidin-4-one
58	521	2-(2-methyl-2H-indazol-5-yl)-7-(piperidin-4-yl)-4H-	ND	361.4
		pyrimido[1,2-b]pyridazin-4-one
25	522	2-(2-methyl-2H-indazol-5-yl)-7-(1-methylpiperidin-	260-262	375.2
		4-yl)-4H-pyrimido[1,2-b]pyridazin-4-one
25	523	7-(1-ethylpiperidin-4-yl)-2-(2-methyl-2H-indazol-5-	253-255	389.3
		yl)-4H-pyrimido[1,2-b]pyridazin-4-one
25	524	2-(8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-	289-291	409.3
		(1-methylpiperidin-4-yl)-4H-pyrimido[1,2-
		b]pyridazin-4-one
25	525	2-(8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-	284-286	423.2
		(1-ethylpiperidin-4-yl)-4H-pyrimido[1,2-
		b]pyridazin-4-one
25	526	2-(8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-	255-257	439.3
		[1-(2-hydroxyethyl)piperidin-4-yl]-4H-pyrimido[1,2-
		b]pyridazin-4-one
50	527	2-(5,7-dimethylfuro[2,3-c]pyridin-2-yl)-7-[(3R,5S)-	260-262	404.3
		3,5-dimethylpiperazin-1-yl]-4H-pyrido[1,2-
		a]pyrimidin-4-one
50	528	7-[4-(dimethylamino)piperidin-1-yl]-2-(5,7-	200-202	418.3
		dimethylfuro[2,3-c]pyridin-2-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
50	529	2-(5,7-dimethylfuro[2,3-c]pyridin-2-yl)-7-[4-(2-	256-258	420.3
		hydroxyethyl)piperazin-1-yl]-4H-pyrido[1,2-
		a]pyrimidin-4-one
25	530	2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[1-(2-	228-230	419.3
		hydroxyethyl)piperidin-4-yl]-4H-pyrido[1,2-
		a]pyrimidin-4-one
9	531	2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[4-(2-	246-248	420.4
		hydroxyethyl)piperazin-1-yl]-4H-pyrido[1,2-
		a]pyrimidin-4-one
39	532	2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-	238-240	434.3
		[(3R)-4-(2-hydroxyethyl)-3-methylpiperazin-1-yl]-
		4H-pyrido[1,2-a]pyrimidin-4-one
43	533	2-(8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-	179-183	467.3
		[(3S)-4-(2-methoxyethyl)-3-methylpiperazin-1-yl]-
		4H-pyrido[1,2-a]pyrimidin-4-one
43	534	2-(8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-	201-205	497.3
		{(3S)-4-[2-(2-hydroxyethoxy)ethyl]-3-
		methylpiperazin-1-yl}-4H-pyrido[1,2-a]pyrimidin-4-
		one
39	535	2-(8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-	253-257	449.3
		[(3S)-4-cyclopropyl-3-methylpiperazin-1-yl]-4H-
		pyrido[1,2-a]pyrimidin-4-one
39	536	2-(8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-	228-232	463.3
		[(3S)-4-cyclobutyl-3-methylpiperazin-1-yl]-4H-
		pyrido[1,2-a]pyrimidin-4-one
43	537	2-(8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-	228-234	453.3
		[(3S)-4-(2-hydroxyethyl)-3-methylpiperazin-1-yl]-
		4H-pyrido[1,2-a]pyrimidin-4-one
43	538	2-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-	215-219	451.3
		[(3S)-4-(2-methoxyethyl)-3-methylpiperazin-1-yl]-
		4H-pyrido[1,2-a]pyrimidin-4-one
43	539	2-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-	270-274	437.3
		[(3S)-4-(2-hydroxyethyl)-3-methylpiperazin-1-yl]-
		4H-pyrido[1,2-a]pyrimidin-4-one
43	540	2-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-	175-181	481.3
		{(3S)-4-[2-(2-hydroxyethoxy)ethyl]-3-
		methylpiperazin-1-yl}-4H-pyrido[1,2-a]pyrimidin-4-
		one
39	541	2-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-	191-194	435.3
		[(3S)-3-methyl-4-(propan-2-yl)piperazin-1-yl]-4H-
		pyrido[1,2-a]pyrimidin-4-one
39	542	7-[(3S)-4-cyclopropyl-3-methylpiperazin-1-yl]-2-(8-	242-246	433.4
		fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-4H-
		pyrido[1,2-a]pyrimidin-4-one
39	543	7-[(3S)-4-cyclobutyl-3-methylpiperazin-1-yl]-2-(8-	264-267	447.3
		fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-4H-
		pyrido[1,2-a]pyrimidin-4-one
2	544	7-(3,3-dimethylpiperazin-1-yl)-2-(4,6-	ND	418.3
		dimethylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-4H-
		pyrido[1,2-a]pyrimidin-4-one
14	545	2-(1-methyl-1H-indazol-5-yl)-7-[(3R)-3-	190-192	375.3
		methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-
		one
9	546	2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-	230-233	390.5
		(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one
9	547	2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-	250-252	404.5
		(4-methylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-
		4-one
9	548	2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-	250-252	418.5
		(4-ethylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-
		4-one
9	549	2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-	240-242	434.5
		[4-(2-hydroxyethyl)piperazin-1-yl]-4H-pyrido[1,2-
		a]pyrimidin-4-one
9	550	7-[4-(dimethylamino)piperidin-1-yl]-2-(4-ethyl-6-	258-260	432.5
		methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
9	551	7-[4-(diethylamino)piperidin-1-yl]-2-(4-ethyl-6-	232-235	460.6
		methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
14	552	7-[(3R,5S)-3,5-dimethylpiperazin-1-yl]-2-(1-methyl-	240-242	389.5
		1H-indazol-5-yl)-4H-pyrido[1,2-a]pyrimidin-4-one
14	553	2-(1-methyl-1H-indazol-5-yl)-7-[(3S)-3-	206-208	375.4
		methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-
		one
25	554	2-(2-methylimidazo[1,2-a]pyridin-6-yl)-7-[1-	218-220	402.4
		(propan-2-yl)piperidin-4-yl]-4H-pyrido[1,2-
		a]pyrimidin-4-one
16	555	2-(2-methylimidazo[1,2-a]pyridin-7-yl)-7-(piperazin-	272-277	361.3
		1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one
24	556	2-(2-methylimidazo[1,2-a]pyridin-7-yl)-7-(piperidin-	257-260	360.3
		4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one
39	557	2-(2-methylimidazo[1,2-a]pyridin-7-yl)-7-(4-	285-288	375.3
		methylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-
		one
39	558	7-(4-ethylpiperazin-1-yl)-2-(2-methylimidazo[1,2-	219-222	389.3
		a]pyridin-7-yl)-4H-pyrido[1,2-a]pyrimidin-4-one
25	559	2-(2-methylimidazo[1,2-a]pyridin-7-yl)-7-(1-	255-260	374.3
		methylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-
		one
25	560	7-(1-ethylpiperidin-4-yl)-2-(2-methylimidazo[1,2-	229-233	388.4
		a]pyridin-7-yl)-4H-pyrido[1,2-a]pyrimidin-4-one
2	561	2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-9-	210-219	404.4
		methyl-7-[(3S)-3-methylpiperazin-1-yl]-4H-
		pyrido[1,2-a]pyrimidin-4-one
2	562	7-[(3R,5S)-3,5-dimethylpiperazin-1-yl]-2-(4,6-	273-283	418.4
		dimethylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-4H-
		pyrido[1,2-a]pyrimidin-4-one
2	563	7-[(3S)-3,4-dimethylpiperazin-1-yl]-2-(4,6-	244-253	418.4
		dimethylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-4H-
		pyrido[1,2-a]pyrimidin-4-one
2	564	2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-9-	297-310	432.4
		methyl-7-[(3R,5S)-3,4,5-trimethylpiperazin-1-yl]-
		4H-pyrido[1,2-a]pyrimidin-4-one
23	565	2-(2-methylimidazo[1,2-a]pyridin-6-yl)-7-[1-	230-232	400.5
		(propan-2-yl)-1,2,3,6-tetrahydropyridin-4-yl]-4H-
		pyrido[1,2-a]pyrimidin-4-one
58	566	2-(2-methyl-2H-indazol-5-yl)-7-(piperidin-4-yl)-4H-	235-237	361.3
		pyrazino[1,2-a]pyrimidin-4-one
25	567	2-(2-methyl-2H-indazol-5-yl)-7-(1-methylpiperidin-	275-277	375.3
		4-yl)-4H-pyrazino[1,2-a]pyrimidin-4-one
25	568	7-(1-ethylpiperidin-4-yl)-2-(2-methyl-2H-indazol-5-	198-200	389.3
		yl)-4H-pyrazino[1,2-a]pyrimidin-4-one
25	569	7-[1-(2-hydroxyethyl)piperidin-4-yl]-2-(2-methyl-	230-232	405.3
		2H-indazol-5-yl)-4H-pyrazino[1,2-a]pyrimidin-4-one
9	570	7-{4-[(dimethylamino)methyl]piperidin-1-yl}-2-	206-208	432.3
		(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-
		pyrido[1,2-a]pyrimidin-4-one
9	571	2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[4-	177-180	458.5
		(pyrrolidin-1-ylmethyl)piperidin-1-yl]-4H-
		pyrido[1,2-a]pyrimidin-4-one
9	572	2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[4-	192-195	472.6
		(piperidin-1-ylmethyl)piperidin-1-yl]-4H-pyrido[1,2-
		a]pyrimidin-4-one
9	573	2-(3,4-dimethoxyphenyl)-7-{4-	182-184	423.3
		[(dimethylamino)methyl]piperidin-1-yl}-4H-
		pyrido[1,2-a]pyrimidin-4-one
9	574	2-(3,4-dimethoxyphenyl)-7-[4-(pyrrolidin-1-	194-196	449.5
		ylmethyl)piperidin-1-yl]-4H-pyrido[1,2-a]pyrimidin-
		4-one
9	575	2-(3,4-dimethoxyphenyl)-7-[4-(piperidin-1-	184-186	463.5
		ylmethyl)piperidin-1-yl]-4H-pyrido[1,2-a]pyrimidin-
		4-one
25	576	7-[1-(2-hydroxyethyl)piperidin-4-yl]-2-(2-	200-202	404.4
		methylimidazo[1,2-a]pyridin-6-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
23	577	7-[1-(2-hydroxyethyl)-1,2,3,6-tetrahydropyridin-4-	248-250	402.2
		yl]-2-(2-methylimidazo[1,2-a]pyridin-6-yl)-4H-
		pyrido[1,2-a]pyrimidin-4-one
25	578	2-(2-methyl-2H-indazol-5-yl)-7-(1-methylpiperidin-	256-258	374.3
		4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one
25	579	2-(2-methylimidazo[1,2-a]pyridin-6-yl)-7-(1-	277-280	375.3
		methylpiperidin-4-yl)-4H-pyrazino[1,2-a]pyrimidin-
		4-one
25	580	7-(1-ethylpiperidin-4-yl)-2-(2-methylimidazo[1,2-	255-258	389.3
		a]pyridin-6-yl)-4H-pyrazino[1,2-a]pyrimidin-4-one
25	581	7-[1-(2-hydroxyethyl)piperidin-4-yl]-2-(2-	250-252	405.3
		methylimidazo[1,2-a]pyridin-6-yl)-4H-pyrazino[1,2-
		a]pyrimidin-4-one
53	582	2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-{4-	250-259	462.4
		[(2-hydroxyethyl)(methyl)amino]piperidin-1-yl}-9-
		methyl-4H-pyrido[1,2-a]pyrimidin-4-one
53	583	2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-9-	231-241	446.4
		methyl-7-[4-(propylamino)piperidin-1-yl]-4H-
		pyrido[1,2-a]pyrimidin-4-one
2	584	7-(4-amino-4-methylpiperidin-1-yl)-2-(4,6-	200-203	404.5
		dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-
		pyrido[1,2-a]pyrimidin-4-one
58	585	2-(2-methylimidazo[1,2-a]pyridin-6-yl)-7-(piperidin-	ND	361.3
		4-yl)-4H-pyrazino[1,2-a]pyrimidin-4-one
61*	586	2-(2-methyl-2H-indazol-5-yl)-7-(piperazin-1-yl)-4H-	160-162	362.3
		pyrazino[1,2-a]pyrimidin-4-one
58	587	2-(8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-	ND	395.3
		(piperidin-4-yl)-4H-pyrazino[1,2-a]pyrimidin-4-one
58	588	2-(2,8-dimethylimidazo[1,2-a]pyridin-6-yl)-7-	ND	375.4
		(piperidin-4-yl)-4H-pyrazino[1,2-a]pyrimidin-4-one
39	589	2-(2-methyl-2H-indazol-5-yl)-7-(4-methylpiperazin-	ND	376.4
		1-yl)-4H-pyrazino[1,2-a]pyrimidin-4-one
39	590	7-(4-ethylpiperazin-1-yl)-2-(2-methyl-2H-indazol-5-	214-216	390.4
		yl)-4H-pyrazino[1,2-a]pyrimidin-4-one
39	591	7-[4-(2-hydroxyethyl)piperazin-1-yl]-2-(2-methyl-	200-202	406.4
		2H-indazol-5-yl)-4H-pyrazino[1,2-a]pyrimidin-4-one
25	592	2-(2,8-dimethylimidazo[1,2-a]pyridin-6-yl)-7-(1-	249-251	389.3
		methylpiperidin-4-yl)-4H-pyrazino[1,2-a]pyrimidin-
		4-one
25	593	2-(2,8-dimethylimidazo[1,2-a]pyridin-6-yl)-7-(1-	242-244	403.4
		ethylpiperidin-4-yl)-4H-pyrazino[1,2-a]pyrimidin-4-
		one
25	594	2-(2,8-dimethylimidazo[1,2-a]pyridin-6-yl)-7-[1-(2-	242-244	419.4
		hydroxyethyl)piperidin-4-yl]-4H-pyrazino[1,2-
		a]pyrimidin-4-one
25	595	2-(8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-	243-245	437.3
		[1-(propan-2-yl)piperidin-4-yl]-4H-pyrazino[1,2-
		a]pyrimidin-4-one
53	596	2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[4-	228-236	432.4
		(ethylamino)piperidin-1-yl]-9-methyl-4H-pyrido[1,2-
		a]pyrimidin-4-one
53	597	7-{4-[bis(2-hydroxyethyl)amino]piperidin-1-yl}-2-	218-227	492.4
		(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-
		4H-pyrido[1,2-a]pyrimidin-4-one
25	598	7-[1-(2-hydroxyethyl)piperidin-4-yl]-2-(2-methyl-	205-207	406.3
		1,3-benzoxazol-6-yl)-4H-pyrimido[1,2-b]pyridazin-
		4-one
25	599	2-(8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-	266-268	439.3
		[1-(2-hydroxyethyl)piperidin-4-yl]-4H-pyrazino[1,2-
		a]pyrimidin-4-one
25	600	2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[1-	150-152	431.3
		(oxetan-3-yl)piperidin-4-yl]-4H-pyrido[1,2-
		a]pyrimidin-4-one
50	601	2-(5,7-dimethylfuro[2,3-c]pyridin-2-yl)-7-(4-	202-204	404.3
		ethylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-
		one
39	602	2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-(1-	210-212	430.3
		methyloctahydro-5H-pyrrolo[3,2-c]pyridin-5-yl)-4H-
		pyrido[1,2-a]pyrimidin-4-one
51*	603	2-(1-methyl-1H-indazol-5-yl)-7-(piperidin-4-yl)-4H-	268-270	360.4
		pyrido[1,2-a]pyrimidin-4-one
25	604	7-(1-ethylpiperidin-4-yl)-2-(1-methyl-1H-indazol-5-	184-186	388.5
		yl)-4H-pyrido[1,2-a]pyrimidin-4-one
25	605	7-[1-(2-hydroxyethyl)piperidin-4-yl]-2-(1-methyl-	204-206	404.5
		1H-indazol-5-yl)-4H-pyrido[1,2-a]pyrimidin-4-one
24	606	2-(2-methyl-2H-indazol-5-yl)-7-(piperidin-4-yl)-4H-	194-196	360.4
		pyrido[1,2-a]pyrimidin-4-one
24	607	2-(2,8-dimethylimidazo[1,2-a]pyridin-6-yl)-7-	282-284	374.3
		(piperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one
25	608	2-(2-methyl-2H-indazol-5-yl)-7-[1-(propan-2-	ND	402.5
		yl)piperidin-4-yl]-4H-pyrido[1,2-a]pyrimidin-4-one
53	609	2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-{4-	221-232	448.4
		[(2-hydroxyethyl)amino]piperidin-1-yl}-9-methyl-
		4H-pyrido[1,2-a]pyrimidin-4-one
53	610	2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-9-	218-227	418.4
		methyl-7-[4-(methylamino)piperidin-1-yl]-4H-
		pyrido[1,2-a]pyrimidin-4-one
53	611	2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-9-	215-225	446.4
		methyl-7-[4-(propan-2-ylamino)piperidin-1-yl]-4H-
		pyrido[1,2-a]pyrimidin-4-one
25	612	7-(1-ethylpiperidin-4-yl)-2-(2-methyl-2H-indazol-5-	202-204	388.5
		yl)-4H-pyrido[1,2-a]pyrimidin-4-one
25	613	7-[1-(2-hydroxyethyl)piperidin-4-yl]-2-(2-methyl-	170-172	404.5
		2H-indazol-5-yl)-4H-pyrido[1,2-a]pyrimidin-4-one
25	614	2-(2,8-dimethylimidazo[1,2-a]pyridin-6-yl)-7-(1-	200-202	388.5
		methylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-
		one
25	615	2-(2,8-dimethylimidazo[1,2-a]pyridin-6-yl)-7-(1-	202-204	402.5
		ethylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-
		one
25	616	2-(2,8-dimethylimidazo[1,2-a]pyridin-6-yl)-7-[1-	242-244	416.5
		(propan-2-yl)piperidin-4-yl]-4H-pyrido[1,2-
		a]pyrimidin-4-one
25	617	2-(2,8-dimethylimidazo[1,2-a]pyridin-6-yl)-7-[1-(2-	ND	418.5
		hydroxyethyl)piperidin-4-yl]-4H-pyrido[1,2-
		a]pyrimidin-4-one
9	618	2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-	243-245	432.5
		(4-propylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-
		4-one
9	619	2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-	255-258	432.5
		[4-(propan-2-yl)piperazin-1-yl]-4H-pyrido[1,2-
		a]pyrimidin-4-one
9	620	7-(4-cyclopropylpiperazin-1-yl)-2-(4-ethyl-6-	258-260	430.5
		methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
39	621	7-(4-cyclobutylpiperazin-1-yl)-2-(4-ethyl-6-	275-278	444.5
		methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
39	622	2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-	205-208	446.5
		[4-(oxetan-3-yl)piperazin-1-yl]-4H-pyrido[1,2-
		a]pyrimidin-4-one
39	623	2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-(1-	176-178	444.5
		ethyloctahydro-5H-pyrrolo[3,2-c]pyridin-5-yl)-4H-
		pyrido[1,2-a]pyrimidin-4-one
39	624	2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[1-(2-	184-187	460.5
		hydroxyethyl)octahydro-5H-pyrrolo[3,2-c]pyridin-5-
		yl]-4H-pyrido[1,2-a]pyrimidin-4-one
40*	625	2-(4-methoxy-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-	242-244	406.5
		7-(4-methylpiperazin-1-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
40*	626	2-(4-hydroxy-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-	280-283	392.4
		7-(4-methylpiperazin-1-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
25	627	2-(2-methylimidazo[1,2-a]pyridin-6-yl)-7-[1-	229-231	403.3
		(propan-2-yl)piperidin-4-yl]-4H-pyrazino[1,2-
		a]pyrimidin-4-one
25	628	7-(1-cyclobutylpiperidin-4-yl)-2-(2-	249-251	415.2
		methylimidazo[1,2-a]pyridin-6-yl)-4H-pyrazino[1,2-
		a]pyrimidin-4-one
39*	629	7-[(3R)-3,4-dimethylpiperazin-1-yl]-2-(4-ethyl-6-	257-259	418.5
		methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
39	630	7-[(3R)-4-ethyl-3-methylpiperazin-1-yl]-2-(4-ethyl-	256-258	432.5
		6-methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-
		pyrido[1,2-a]pyrimidin-4-one
39	631	2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-	243-245	446.5
		[(3R)-3-methyl-4-propylpiperazin-1-yl]-4H-
		pyrido[1,2-a]pyrimidin-4-one
39	632	2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-	238-241	448.5
		[(3R)-4-(2-hydroxyethyl)-3-methylpiperazin-1-yl]-
		4H-pyrido[1,2-a]pyrimidin-4-one
9	633	7-[(3R,5S)-3,5-dimethylpiperazin-1-yl]-2-(4-ethyl-6-	258-260	418.4
		methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
9	634	2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-	229-232	458.6
		[4-(pyrrolidin-1-yl)piperidin-1-yl]-4H-pyrido[1,2-
		a]pyrimidin-4-one
9	635	2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-	202-204	404.4
		[(3S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-
		a]pyrimidin-4-one
9	636	2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-	175-180	418.4
		(4-methyl-1,4-diazepan-1-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
16	637	2-(8-ethyl-2-methylimidazo[1,2-a]pyridin-6-yl)-7-	264-271	389.4
		(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one
16	638	2-(8-ethyl-2-methylimidazo[1,2-a]pyridin-6-yl)-7-	230-234	403.4
		[(3R)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-
		a]pyrimidin-4-one
16	639	2-(8-ethyl-2-methylimidazo[1,2-a]pyridin-6-yl)-7-	232-236	403.4
		[(3S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-
		a]pyrimidin-4-one
25	640	2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[1-	196-198	417.5
		(propan-2-yl)piperidin-4-yl]-4H-pyrido[1,2-
		a]pyrimidin-4-one
25	641	7-(1-cyclopropylpiperidin-4-yl)-2-(4,6-	180-183	415.5
		dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-
		pyrido[1,2-a]pyrimidin-4-one
25	642	7-(1-cyclobutylpiperidin-4-yl)-2-(4,6-	189-191	429.5
		dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-
		pyrido[1,2-a]pyrimidin-4-one
39	643	2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-	242-244	446.5
		[(3R)-3-methyl-4-(propan-2-yl)piperazin-1-yl]-4H-
		pyrido[1,2-a]pyrimidin-4-one
39	644	7-[(3R)-4-cyclopropyl-3-methylpiperazin-1-yl]-2-(4-	244-247	444.5
		ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-
		pyrido[1,2-a]pyrimidin-4-one
39	645	7-[(3R)-4-cyclobutyl-3-methylpiperazin-1-yl]-2-(4-	261-264	458.6
		ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-
		pyrido[1,2-a]pyrimidin-4-one
39	646	2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-	216-219	460.5
		[(3R)-3-methyl-4-(oxetan-3-yl)piperazin-1-yl]-4H-
		pyrido[1,2-a]pyrimidin-4-one
39	647	2-(8-ethyl-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[4-	248-253	433.3
		(2-hydroxyethyl)piperazin-1-yl]-4H-pyrido[1,2-
		a]pyrimidin-4-one
39	648	7-(4-cyclobutylpiperazin-1-yl)-2-(8-ethyl-2-	274-279	443.5
		methylimidazo[1,2-a]pyridin-6-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
39	649	2-(8-ethyl-2-methylimidazo[1,2-a]pyridin-6-yl)-7-	217-220	447.4
		[(3R)-4-(2-hydroxyethyl)-3-methylpiperazin-1-yl]-
		4H-pyrido[1,2-a]pyrimidin-4-one
39	650	7-[(3R)-4-cyclobutyl-3-methylpiperazin-1-yl]-2-(8-	209-212	457.4
		ethyl-2-methylimidazo[1,2-a]pyridin-6-yl)-4H-
		pyrido[1,2-a]pyrimidin-4-one
39	651	2-(8-ethyl-2-methylimidazo[1,2-a]pyridin-6-yl)-7-	220-223	447.4
		[(3S)-4-(2-hydroxyethyl)-3-methylpiperazin-1-yl]-
		4H-pyrido[1,2-a]pyrimidin-4-one
39	652	7-[(3S)-4-cyclobutyl-3-methylpiperazin-1-yl]-2-(8-	ND	457.5
		ethyl-2-methylimidazo[1,2-a]pyridin-6-yl)-4H-
		pyrido[1,2-a]pyrimidin-4-one
59	653	2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-	ND	390.4
		(piperidin-4-yl)-4H-pyrazino[1,2-a]pyrimidin-4-one
25	654	2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-	261-263	404.5
		(1-methylpiperidin-4-yl)-4H-pyrazino[1,2-
		a]pyrimidin-4-one
25	655	2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-	273-275	418.3
		(1-ethylpiperidin-4-yl)-4H-pyrazino[1,2-a]pyrimidin-
		4-one
24	656	2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-	236-238	389.4
		(piperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one
25	657	2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-	190-192	403.5
		(1-methylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-
		4-one
25	658	2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-	194-196	417.5
		(1-ethylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-
		one
25	659	2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-	207-209	433.5
		[1-(2-hydroxyethyl)piperidin-4-yl]-4H-pyrido[1,2-
		a]pyrimidin-4-one
25	660	2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-	203-204	431.5
		(1-propylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-
		4-one
9	661	2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-	185-188	404.5
		[(3R)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-
		a]pyrimidin-4-one
43*	662	2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[1-(2-	197-199	421.5
		fluoroethyl)piperidin-4-yl]-4H-pyrido[1,2-
		a]pyrimidin-4-one
43	663	2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[1-(3-	186-188	435.5
		fluoropropyl)piperidin-4-yl]-4H-pyrido[1,2-
		a]pyrimidin-4-one
43	664	2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-	245-247	436.5
		[4-(2-fluoroethyl)piperazin-1-yl]-4H-pyrido[1,2-
		a]pyrimidin-4-one
43	665	2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-	240-242	450.6
		[4-(3-fluoropropyl)piperazin-1-yl]-4H-pyrido[1,2-
		a]pyrimidin-4-one
43	666	2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-	255-257	450.6
		[(3R)-4-(2-fluoroethyl)-3-methylpiperazin-1-yl]-4H-
		pyrido[1,2-a]pyrimidin-4-one
43	667	2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-	244-246	464.6
		[(3R)-4-(3-fluoropropyl)-3-methylpiperazin-1-yl]-
		4H-pyrido[1,2-a]pyrimidin-4-one
43	668	2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-	206-208	435.6
		[1-(2-fluoroethyl)piperidin-4-yl]-4H-pyrido[1,2-
		a]pyrimidin-4-one
43	669	2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-	216-218	449.6
		[1-(3-fluoropropyl)piperidin-4-yl]-4H-pyrido[1,2-
		a]pyrimidin-4-one
43	670	2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-	ND	492.4
		{(3R)-4-[2-(2-hydroxyethoxy)ethyl]-3-
		methylpiperazin-1-yl}-9-methyl-4H-pyrido[1,2-
		a]pyrimidin-4-one
24	671	2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-9-	247-255	389.3
		methyl-7-(piperidin-4-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
25	672	2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-9-	237-248	403.4
		methyl-7-(1-methylpiperidin-4-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
39	673	2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-	273-281	448.4
		[(3R)-4-(2-hydroxyethyl)-3-methylpiperazin-1-yl]-9-
		methyl-4H-pyrido[1,2-a]pyrimidin-4-one
48*	674	2-[8-(hydroxymethyl)-2-methylimidazo[1,2-	>320	391.3
		a]pyridin-6-yl]-7-(piperazin-1-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
16	675	7-[(3R,5S)-3,5-dimethylpiperazin-1-yl]-2-(8-ethyl-2-	ND	417.4
		methylimidazo[1,2-a]pyridin-6-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
16	676	2-(8-ethyl-2-methylimidazo[1,2-a]pyridin-6-yl)-7-(4-	ND	417.3
		methyl-1,4-diazepan-1-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
39	677	2-[8-(hydroxymethyl)-2-methylimidazo[1,2-	262-266	405.3
		a]pyridin-6-yl]-7-(4-methylpiperazin-1-yl)-4H-
		pyrido[1,2-a]pyrimidin-4-one
39	678	7-(4-ethylpiperazin-1-yl)-2-[8-(hydroxymethyl)-2-	258-262	419.3
		methylimidazo[1,2-a]pyridin-6-yl]-4H-pyrido[1,2-
		a]pyrimidin-4-one
25	679	2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-	228-230	431.5
		[1-(propan-2-yl)piperidin-4-yl]-4H-pyrido[1,2-
		a]pyrimidin-4-one
25	680	7-(1-cyclopropylpiperidin-4-yl)-2-(4-ethyl-6-	196-199	429.5
		methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
25	681	7-(1-cyclobutylpiperidin-4-yl)-2-(4-ethyl-6-	227-229	443.5
		methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
25	682	2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-	190-192	445.5
		[1-(oxetan-3-yl)piperidin-4-yl]-4H-pyrido[1,2-
		a]pyrimidin-4-one
9	683	2-(4-cyclopropyl-6-methylpyrazolo[1,5-a]pyrazin-2-	226-229	402.4
		yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-
		one
9	684	2-(4-cyclopropyl-6-methylpyrazolo[1,5-a]pyrazin-2-	238-240	416.5
		yl)-7-(4-methylpiperazin-1-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
9	685	2-(4-cyclopropyl-6-methylpyrazolo[1,5-a]pyrazin-2-	236-238	430.5
		yl)-7-(4-ethylpiperazin-1-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
9	686	2-(4-cyclopropyl-6-methylpyrazolo[1,5-a]pyrazin-2-	239-241	446.5
		yl)-7-[4-(2-hydroxyethyl)piperazin-1-yl]-4H-
		pyrido[1,2-a]pyrimidin-4-one
25	687	2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-(1-	185-187	417.4
		propylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-
		one
41*	688	2-[4-(dimethylamino)-6-methylpyrazolo[1,5-	245-248	405.4
		a]pyrazin-2-yl]-7-(piperazin-1-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
14	689	2-(2-methyl-1H-benzimidazol-6-yl)-7-(4-	292-294	375.3
		methylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-
		one
39	690	7-(4-ethylpiperazin-1-yl)-2-(2-methyl-1H-	283-285	389.3
		benzimidazol-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one
58	691	2-(2,8-dimethylimidazo[1,2-a]pyridin-6-yl)-7-	215-217	375.4
		(piperidin-4-yl)-4H-pyrimido[1,2-b]pyridazin-4-one
58	692	2-(2-methylimidazo[1,2-a]pyridin-6-yl)-7-(piperidin-	249-251	361.3
		4-yl)-4H-pyrimido[1,2-b]pyridazin-4-one
25	693	7-[1-(2,2-dimethyl-1,3-dioxan-5-yl)piperidin-4-yl]-	236-238	503.5
		2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-
		pyrido[1,2-a]pyrimidin-4-one
42*	694	7-[1-(1,3-dihydroxypropan-2-yl)piperidin-4-yl]-2-(4-	228-230	463.6
		ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-
		pyrido[1,2-a]pyrimidin-4-one
62*	695	7-[(3R,5S)-3,5-dimethylpiperazin-1-yl]-2-(1,3-	254-256	403.4
		dimethylpyrrolo[1,2-a]pyrazin-7-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
24	696	2-(8-ethyl-2-methylimidazo[1,2-a]pyridin-6-yl)-7-	221-224	388.3
		(piperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one
25	697	2-(8-ethyl-2-methylimidazo[1,2-a]pyridin-6-yl)-7-(1-	214-218	402.4
		methylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-
		one
25	698	2-(8-ethyl-2-methylimidazo[1,2-a]pyridin-6-yl)-7-(1-	196-200	416.5
		ethylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-
		one
25	699	2-(8-ethyl-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[1-	244-247	432.4
		(2-hydroxyethyl)piperidin-4-yl]-4H-pyrido[1,2-
		a]pyrimidin-4-one
39	700	7-[(3R)-3,4-dimethylpiperazin-1-yl]-2-(8-ethyl-2-	217-220	417.4
		methylimidazo[1,2-a]pyridin-6-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
39	701	2-(8-ethyl-2-methylimidazo[1,2-a]pyridin-6-yl)-7-	179-182	431.4
		[(3R)-4-ethyl-3-methylpiperazin-1-yl]-4H-
		pyrido[1,2-a]pyrimidin-4-one
25	702	2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-(1-	231-240	417.4
		ethylpiperidin-4-yl)-9-methyl-4H-pyrido[1,2-
		a]pyrimidin-4-one
25	703	2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[1-(2-	224-233	433.3
		hydroxyethyl)piperidin-4-yl]-9-methyl-4H-
		pyrido[1,2-a]pyrimidin-4-one
25	704	7-(1-cyclobutylpiperidin-4-yl)-2-(4,6-	228-237	443.5
		dimethylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-4H-
		pyrido[1,2-a]pyrimidin-4-one
25	705	9-methyl-2-(2-methyl-2H-indazol-5-yl)-7-(1-	222-227	388.3
		methylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-
		one
2	706	7-[4-(dimethylamino)-4-methylpiperidin-1-yl]-2-	237-239	432.4
		(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-
		pyrido[1,2-a]pyrimidin-4-one
2	707	2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[4-	187-189	432.4
		(ethylamino)-4-methylpiperidin-1-yl]-4H-pyrido[1,2-
		a]pyrimidin-4-one
2	708	2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[4-	181-183	446.4
		methyl-4-(propylamino)piperidin-1-yl]-4H-
		pyrido[1,2-a]pyrimidin-4-one
2	709	2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-{4-	196-198	448.4
		[(2-hydroxyethyl)amino]-4-methylpiperidin-1-yl}-
		4H-pyrido[1,2-a]pyrimidin-4-one
25	710	7-(1-cyclobutylpiperidin-4-yl)-9-methyl-2-(2-	232-235	428.4
		methyl-2H-indazol-5-yl)-4H-pyrido[1,2-a]pyrimidin-
		4-one
25	711	7-[1-(2-hydroxyethyl)piperidin-4-yl]-9-methyl-2-(2-	216-222	418.4
		methyl-2H-indazol-5-yl)-4H-pyrido[1,2-a]pyrimidin-
		4-one
25	712	2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-9-	216-223	431.4
		methyl-7-(1-propylpiperidin-4-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
62	713	2-(1,3-dimethylpyrrolo[1,2-a]pyrazin-7-yl)-7-[(3R)-	ND	389.3
		3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-
		4-one
47*	714	2-(8-cyclopropyl-2-methylimidazo[1,2-a]pyridin-6-	274-277	401.4
		yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-
		one
47	715	2-(8-cyclopropyl-2-methylimidazo[1,2-a]pyridin-6-	246-250	415.4
		yl)-7-[(3R)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-
		a]pyrimidin-4-one
47	716	2-(8-cyclopropyl-2-methylimidazo[1,2-a]pyridin-6-	246-250	415.4
		yl)-7-[(3S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-
		a]pyrimidin-4-one
47	717	2-(8-cyclopropyl-2-methylimidazo[1,2-a]pyridin-6-	205-209	429.5
		yl)-7-[(3R,5S)-3,5-dimethylpiperazin-1-yl]-4H-
		pyrido[1,2-a]pyrimidin-4-one
25	718	7-(1-cyclopropylpiperidin-4-yl)-9-methyl-2-(2-	226-231	414.4
		methyl-2H-indazol-5-yl)-4H-pyrido[1,2-a]pyrimidin-
		4-one
25	719	7-(1-ethylpiperidin-4-yl)-9-methyl-2-(2-methyl-2H-	237-241	402.5
		indazol-5-yl)-4H-pyrido[1,2-a]pyrimidin-4-one
2	720	2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-9-	254-264	390.4
		methyl-7-(piperazin-1-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
24	721	9-methyl-2-(2-methyl-2H-indazol-5-yl)-7-(piperidin-	211 (S),	374.3
		4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one	223-227
27	722	2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[(1-	249-252	405.4
		methylpiperidin-4-yl)oxy]-4H-pyrido[1,2-
		a]pyrimidin-4-one
9	723	2-(6-methyl-4-propylpyrazolo[1,5-a]pyrazin-2-yl)-7-	250-252	404.4
		(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one
9	724	7-(4-methylpiperazin-1-yl)-2-(6-methyl-4-	246-248	418.4
		propylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
9	725	7-(4-ethylpiperazin-1-yl)-2-(6-methyl-4-	231-233	432.5
		propylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
9	726	7-[4-(2-hydroxyethyl)piperazin-1-yl]-2-(6-methyl-4-	225-227	448.4
		propylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
9	727	7-[(3R)-3-methylpiperazin-1-yl]-2-(6-methyl-4-	195-197	418.4
		propylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
9	728	7-[(3S)-3-methylpiperazin-1-yl]-2-(6-methyl-4-	195-197	418.4
		propylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
9	729	7-[(3R,5S)-3,5-dimethylpiperazin-1-yl]-2-(6-methyl-	249-251	432.5
		4-propylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
39	730	2-(1,3-dimethylpyrrolo[1,2-a]pyrazin-7-yl)-7-[(3R)-	249-251	431.3
		3-methyl-4-(propan-2-yl)piperazin-1-yl]-4H-
		pyrido[1,2-a]pyrimidin-4-one
63*	731	7-(4-amino-4-methylpiperidin-1-yl)-2-(1,3-	244-246	403.3
		dimethylpyrrolo[1,2-a]pyrazin-7-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
2	732	2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[(3S)-	243-251	418.5
		3-ethylpiperazin-1-yl]-9-methyl-4H-pyrido[1,2-
		a]pyrimidin-4-one
16	733	2-[2-methyl-8-(trifluoromethyl)imidazo[1,2-	325-328	429.3
		a]pyridin-6-yl]-7-(piperazin-1-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
16	734	7-[(3R)-3-methylpiperazin-1-yl]-2-[2-methyl-8-	303-306	443.2
		(trifluoromethyl)imidazo[1,2-a]pyridin-6-yl]-4H-
		pyrido[1,2-a]pyrimidin-4-one
16	735	7-[(3S)-3-methylpiperazin-1-yl]-2-[2-methyl-8-	>320	443.2
		(trifluoromethyl)imidazo[1,2-a]pyridin-6-yl]-4H-
		pyrido[1,2-a]pyrimidin-4-one
16	736	7-[(3R,5S)-3,5-dimethylpiperazin-1-yl]-2-[2-methyl-	293-296	457.3
		8-(trifluoromethyl)imidazo[1,2-a]pyridin-6-yl]-4H-
		pyrido[1,2-a]pyrimidin-4-one
2	737	7-(4-amino-4-methylpiperidin-1-yl)-2-(4-ethyl-6-	216-218	418.5
		methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
14	738	2-(2,7-dimethyl-2H-indazol-5-yl)-7-(piperazin-1-yl)-	194-196	375.4
		4H-pyrido[1,2-a]pyrimidin-4-one
24	739	2-(2,7-dimethyl-2H-indazol-5-yl)-7-(piperidin-4-yl)-	228-230	374.4
		4H-pyrido[1,2-a]pyrimidin-4-one
52	740	7-(3-aminoprop-1-yn-1-yl)-2-(4,6-	242-244	345.4
		dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-
		pyrido[1,2-a]pyrimidin-4-one
14	741	2-(2,7-dimethyl-2H-indazol-5-yl)-7-[(3R)-3-	170-172	389.4
		methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-
		one
52	742	7-(3-aminopropyl)-2-(4,6-dimethylpyrazolo[1,5-	ND	349.3
		a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one
64*	743	2-(1,3-dimethylpyrrolo[1,2-a]pyrazin-7-yl)-7-	189-191	372.3
		(1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
38	744	2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-	218-221	429.5
		(2,2,6,6-tetramethyl-1,2,3,6-tetrahydropyridin-4-yl)-
		4H-pyrido[1,2-a]pyrimidin-4-one
38	745	2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-	255-258	443.5
		(2,2,6,6-tetramethyl-1,2,3,6-tetrahydropyridin-4-yl)-
		4H-pyrido[1,2-a]pyrimidin-4-one
45	746	2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-	239-242	402.4
		[(3aR,6aS)-hexahydropyrrolo[3,4-c]pyrrol-2(1H)-
		yl]-4H-pyrido[1,2-a]pyrimidin-4-one
2	747	2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-	246-249	416.4
		[(3aR,6aS)-hexahydropyrrolo[3,4-c]pyrrol-2(1H)-
		yl]-4H-pyrido[1,2-a]pyrimidin-4-one
62	748	7-[(3R,5S)-3,5-dimethylpiperazin-1-yl]-2-(1-ethyl-3-	238-241	417.4
		methylpyrrolo[1,2-a]pyrazin-7-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
62	749	7-(1,4-diazepan-1-yl)-2-(1-ethyl-3-	200-202	403.4
		methylpyrrolo[1,2-a]pyrazin-7-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
14	750	2-(2,7-dimethyl-2H-indazol-5-yl)-7-[(3S)-3-	308-310	389.4
		methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-
		one
39	751	2-(2,7-dimethyl-2H-indazol-5-yl)-7-[(3S)-3,4-	202-204	403.4
		dimethylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-
		4-one
25	752	2-(2,7-dimethyl-2H-indazol-5-yl)-7-(1-	208-210	388.3
		methylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-
		one
25	753	2-(2,7-dimethyl-2H-indazol-5-yl)-7-(1-	162-164	402.4
		ethylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-
		one
2	754	9-methyl-2-(2-methyl-2H-indazol-5-yl)-7-(piperazin-	233-243	375.3
		1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one
2	755	9-methyl-2-(2-methyl-2H-indazol-5-yl)-7-[(3R)-3-	ND	389.4
		methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-
		one
2	756	9-methyl-2-(2-methyl-2H-indazol-5-yl)-7-[(3S)-3-	ND	389.3
		methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-
		one
2	757	7-[3-(dimethylamino)azetidin-1-yl]-2-(4,6-	226-228	390.4
		dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-
		pyrido[1,2-a]pyrimidin-4-one
2	758	7-[3-(diethylamino)azetidin-1-yl]-2-(4,6-	231-233	418.5
		dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-
		pyrido[1,2-a]pyrimidin-4-one
2	759	2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[3-	235-237	416.4
		(pyrrolidin-1-yl)azetidin-1-yl]-4H-pyrido[1,2-
		a]pyrimidin-4-one
9	760	7-(1,4-diazepan-1-yl)-2-(4-ethyl-6-	212-214	404.4
		methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
45	761	7-[(3aR,6aS)-hexahydropyrrolo[3,4-c]pyrrol-2(1H)-	212-214	430.4
		yl]-2-(6-methyl-4-propylpyrazolo[1,5-a]pyrazin-2-
		yl)-4H-pyrido[1,2-a]pyrimidin-4-one
38	762	2-(6-methyl-4-propylpyrazolo[1,5-a]pyrazin-2-yl)-7-	257-260	401.4
		(1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
38	763	2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-	287-289	387.4
		(1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
45*	764	7-[(3S)-3-(aminomethyl)pyrrolidin-1-yl]-2-(4,6-	244-246	390.4
		dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-
		pyrido[1,2-a]pyrimidin-4-one
2	765	2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[3-	220-223	430.5
		(piperidin-1-yl)azetidin-1-yl]-4H-pyrido[1,2-
		a]pyrimidin-4-one
24	766	2-(6-methyl-4-propylpyrazolo[1,5-a]pyrazin-2-yl)-7-	228-230	403.4
		(piperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one
2	767	7-(2,7-diazaspiro[4.4]non-2-yl)-2-(4,6-	208-210	416.4
		dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-
		pyrido[1,2-a]pyrimidin-4-one
14	768	2-(2,7-dimethyl-2H-indazol-5-yl)-7-(4-	216-218	389.5
		methylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-
		one
52*	769	7-[3-(dimethylamino)propyl]-2-(4,6-	136-138	377.3
		dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-
		pyrido[1,2-a]pyrimidin-4-one
39	770	7-{(3S)-3-[(dimethylamino)methyl]pyrrolidin-1-yl}-	239-241	418.4
		2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-
		pyrido[1,2-a]pyrimidin-4-one
24	771	2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-9-	241-249	403.4
		methyl-7-(piperidin-4-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
24	772	9-methyl-2-(1-methyl-1H-indazol-5-yl)-7-(piperidin-	212-217	374.3
		4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one
22	773	2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-9-	265 (D)	401.3
		methyl-7-(1,2,3,6-tetrahydropyridin-4-yl)-4H-
		pyrido[1,2-a]pyrimidin-4-one
25	774	2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-9-	220-227	417.3
		methyl-7-(1-methylpiperidin-4-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
51	775	2-(1,7-dimethyl-1H-indazol-5-yl)-7-(piperidin-4-yl)-	220-222	374.2
		4H-pyrido[1,2-a]pyrimidin-4-one
14	776	2-(1,7-dimethyl-1H-indazol-5-yl)-7-(piperazin-1-yl)-	160-163	375.3
		4H-pyrido[1,2-a]pyrimidin-4-one
14	777	2-(1,7-dimethyl-1H-indazol-5-yl)-7-[(3S)-3-	248-250	389.3
		methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-
		one
39	778	7-{(3S)-3-[(diethylamino)methyl]pyrrolidin-1-yl}-2-	194-196	446.4
		(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-
		pyrido[1,2-a]pyrimidin-4-one
39	779	2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-	ND	418.4
		{(3S)-3-[(ethylamino)methyl]pyrrolidin-1-yl}-4H-
		pyrido[1,2-a]pyrimidin-4-one
2	780	7-{3-[(dimethylamino)methyl]azetidin-1-yl}-2-(4,6-	228-230	404.4
		dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-
		pyrido[1,2-a]pyrimidin-4-one
2	781	7-{3-[(diethylamino)methyl]azetidin-1-yl}-2-(4,6-	205-207	432.4
		dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-
		pyrido[1,2-a]pyrimidin-4-one
62	782	2-(1-ethyl-3-methylpyrrolo[1,2-a]pyrazin-7-yl)-7-	220-222	429.3
		[(8aS)-hexahydropyrrolo[1,2-a]pyrazin-2(1H)-yl]-
		4H-pyrido[1,2-a]pyrimidin-4-one
2	783	2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-9-	223-233	418.4
		methyl-7-[(3R)-3-methylpiperazin-1-yl]-4H-
		pyrido[1,2-a]pyrimidin-4-one
25	784	9-methyl-2-(1-methyl-1H-indazol-5-yl)-7-(1-	255-263	388.3
		methylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-
		one
39	785	7-[(3R)-3,4-dimethylpiperazin-1-yl]-2-(4-ethyl-6-	234-240	432.4
		methylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-4H-
		pyrido[1,2-a]pyrimidin-4-one
25	786	7-(1-ethylpiperidin-4-yl)-9-methyl-2-(1-methyl-1H-	236-240	402.4
		indazol-5-yl)-4H-pyrido[1,2-a]pyrimidin-4-one
2	787	2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-9-	227-236	418.4
		methyl-7-[(3S)-3-methylpiperazin-1-yl]-4H-
		pyrido[1,2-a]pyrimidin-4-one
2	788	7-[1-(2-hydroxyethyl)piperidin-4-yl]-9-methyl-2-(1-	225-228	418.4
		methyl-1H-indazol-5-yl)-4H-pyrido[1,2-a]pyrimidin-
		4-one
2	789	7-[(3S)-3,4-dimethylpiperazin-1-yl]-2-(4-ethyl-6-	235-241	432.4
		methylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-4H-
		pyrido[1,2-a]pyrimidin-4-one
25	790	2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-	201-208	431.4
		(1-ethylpiperidin-4-yl)-9-methyl-4H-pyrido[1,2-
		a]pyrimidin-4-one
22	791	9-methyl-2-(2-methyl-2H-indazol-5-yl)-7-(1,2,3,6-	>240	373.3
		tetrahydropyridin-4-yl)-4H-pyrazino[1,2-	(D)
		a]pyrimidin-4-one
25	792	7-(1-cyclobutylpiperidin-4-yl)-2-(4-ethyl-6-	231-237	457.3
		methylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-4H-
		pyrido[1,2-a]pyrimidin-4-one
25	793	2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-	210-216	447.4
		[1-(2-hydroxyethyl)piperidin-4-yl]-9-methyl-4H-
		pyrido[1,2-a]pyrimidin-4-one
16	794	2-(8-ethyl-2-methylimidazo[1,2-a]pyridin-6-yl)-7-	231-235	429.3
		[(8aR)-hexahydropyrrolo[1,2-a]pyrazin-2(1H)-yl]-
		4H-pyrido[1,2-a]pyrimidin-4-one
16	795	2-(8-ethyl-2-methylimidazo[1,2-a]pyridin-6-yl)-7-	229-233	429.3
		[(8aS)-hexahydropyrrolo[1,2-a]pyrazin-2(1H)-yl]-
		4H-pyrido[1,2-a]pyrimidin-4-one
51	796	9-methyl-2-(2-methyl-2H-indazol-5-yl)-7-(piperidin-	229-235	375.3
		4-yl)-4H-pyrazino[1,2-a]pyrimidin-4-one
2	797	7-[(3R)-3-(aminomethyl)pyrrolidin-1-yl]-2-(4,6-	214-217	390.4
		dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-
		pyrido[1,2-a]pyrimidin-4-one
44*	798	2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-	228-231	401.3
		[(2S,6S)-2,6-dimethyl-1,2,3,6-tetrahydropyridin-4-
		yl]-4H-pyrido[1,2-a]pyrimidin-4-one
2	799	7-{(3R)-3-[(dimethylamino)methyl]pyrrolidin-1-yl}-	229-231	418.4
		2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-
		pyrido[1,2-a]pyrimidin-4-one
24	800	7-[(2S,6S)-2,6-dimethylpiperidin-4-yl]-2-(4,6-	248-250	403.3
		dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-
		pyrido[1,2-a]pyrimidin-4-one
16	801	2-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-	ND	423.5
		[4-(2-hydroxyethyl)piperazin-1-yl]-4H-pyrido[1,2-
		a]pyrimidin-4-one
16	802	2-(imidazo[1,2-a]pyridin-6-yl)-7-(4-methylpiperazin-	ND	361.5
		1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one
36	803	2-(4-fluoro-2-methyl-1,3-benzoxazol-6-yl)-7-[(8aS)-	ND	420.6
		hexahydropyrrolo[1,2-a]pyrazin-2(1H)-yl]-4H-
		pyrido[1,2-a]pyrimidin-4-one
65*	804	7-(2,7-diazaspiro[3.5]non-7-yl)-2-(4,6-	ND	416.2
		dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-
		pyrido[1,2-a]pyrimidin-4-one
14	805	7-(4-methylpiperazin-1-yl)-2-(2-	ND	376.1
		methyl[1,2,4]triazolo[1,5-a]pyridin-6-yl)-4H-
		pyrido[1,2-a]pyrimidin-4-one
16	806	7-(4-methylpiperazin-1-yl)-2-[2-methyl-8-	ND	443.6
		(trifluoromethyl)imidazo[1,2-a]pyridin-6-yl]-4H-
		pyrido[1,2-a]pyrimidin-4-one
16	807	2-methyl-6-[7-(4-methylpiperazin-1-yl)-4-oxo-4H-	ND	400.6
		pyrido[1,2-a]pyrimidin-2-yl]imidazo[1,2-a]pyridine-
		8-carbonitrile
16	808	2-(2,8-dimethylimidazo[1,2-a]pyridin-6-yl)-7-(4-	ND	389.5
		methylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-
		one
16	809	7-(4,7-diazaspiro[2.5]oct-7-yl)-2-(2,8-	ND	401.4
		dimethylimidazo[1,2-a]pyridin-6-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
25	810	2-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-	ND	392.4
		(1-methylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-
		4-one
66*	811	2-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-	ND	394.4
		(4-hydroxypiperidin-4-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
9	812	2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-	ND	430.7
		[(8aS)-hexahydropyrrolo[1,2-a]pyrazin-2(1H)-yl]-
		4H-pyrido[1,2-a]pyrimidin-4-one
9	813	2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-	ND	430.6
		[(8aR)-hexahydropyrrolo[1,2-a]pyrazin-2(1H)-yl]-
		4H-pyrido[1,2-a]pyrimidin-4-one
9	814	7-[(3R)-3-(dimethylamino)pyrrolidin-1-yl]-2-(4-	ND	418.7
		ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-
		pyrido[1,2-a]pyrimidin-4-one
9	815	7-[(3S)-3-(dimethylamino)pyrrolidin-1-yl]-2-(4-	ND	418.7
		ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-
		pyrido[1,2-a]pyrimidin-4-one
16	816	2-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-	ND	433.6
		[(8aS)-8a-methylhexahydropyrrolo[1,2-a]pyrazin-
		2(1H)-yl]-4H-pyrido[1,2-a]pyrimidin-4-one
9	817	2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-	ND	432.6
		(4-ethylpiperazin-1-yl)-9-methyl-4H-pyrido[1,2-
		a]pyrimidin-4-one
9	818	2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-	ND	444.6
		[(8aS)-hexahydropyrrolo[1,2-a]pyrazin-2(1H)-yl]-9-
		methyl-4H-pyrido[1,2-a]pyrimidin-4-one
16	819	2-(2,8-dimethylimidazo[1,2-a]pyridin-6-yl)-7-(4-	ND	403.7
		ethylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-
		one
16	820	2-(2,8-dimethylimidazo[1,2-a]pyridin-6-yl)-7-[(8aS)-	ND	415.7
		hexahydropyrrolo[1,2-a]pyrazin-2(1H)-yl]-4H-
		pyrido[1,2-a]pyrimidin-4-one
16	821	2-(2,8-dimethylimidazo[1,2-a]pyridin-6-yl)-7-(8a-	ND	429.7
		methylhexahydropyrrolo[1,2-a]pyrazin-2(1H)-yl)-
		4H-pyrido[1,2-a]pyrimidin-4-one
9	822	7-[(3R)-3-(dimethylamino)pyrrolidin-1-yl]-2-(4-	ND	432.6
		ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-9-
		methyl-4H-pyrido[1,2-a]pyrimidin-4-one
9	823	2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-	ND	434.6
		{[2-(morpholin-4-yl)ethyl]amino}-4H-pyrido[1,2-
		a]pyrimidin-4-one
9	824	7-{[2-(dimethylamino)ethyl]amino}-2-(4-ethyl-6-	ND	392.6
		methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
9	825	7-{[2-(dimethylamino)ethyl](methyl)amino}-2-(4-	ND	406.6
		ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-
		pyrido[1,2-a]pyrimidin-4-one
9	826	2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-	ND	392.6
		{methyl[2-(methylamino)ethyl]amino}-4H-
		pyrido[1,2-a]pyrimidin-4-one
16	827	7-[(3R)-3-(dimethylamino)pyrrolidin-1-yl]-2-(2,8-	ND	403.7
		dimethylimidazo[1,2-a]pyridin-6-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
16	828	7-[(3S)-3-(dimethylamino)pyrrolidin-1-yl]-2-(2,8-	ND	403.7
		dimethylimidazo[1,2-a]pyridin-6-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
27	829	7-[2-(dimethylamino)ethoxy]-2-(4-ethyl-6-	ND	407.6
		methylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-4H-
		pyrido[1,2-a]pyrimidin-4-one
27	830	7-[2-(dimethylamino)ethoxy]-2-(4-ethyl-6-	ND	393.6
		methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
27	831	2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-	ND	419.5
		(piperidin-4-ylmethoxy)-4H-pyrido[1,2-a]pyrimidin-
		4-one
27	832	2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-	ND	433.6
		[2-(piperidin-1-yl)ethoxy]-4H-pyrido[1,2-
		a]pyrimidin-4-one
27	833	2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-	ND	449.6
		[3-(morpholin-4-yl)propoxy]-4H-pyrido[1,2-
		a]pyrimidin-4-one
27	834	7-[3-(dimethylamino)propoxy]-2-(4-ethyl-6-	ND	407.6
		methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one
9	835	2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-	ND	416.5
		[(3aR,6aS)-5-methylhexahydropyrrolo[3,4-c]pyrrol-
		2(1H)-yl]-4H-pyrido[1,2-a]pyrimidin-4-one

TABLE 2 — or a free base, isotopologue, stereoisomer, racemate, enantiomer, diastereomer or tautomer thereof.

Ex	Cpd	Name	M.P.	MS
1	71	2-(3,5-difluoro-4-hydroxyphenyl)-7-	290 (D)	359.2
		(piperazin-1-yl)-4H-pyrido[1,2-
		a]pyrimidin-4-one hydrochloride
33	203	7-[4-(dimethylamino)piperidin-1-yl]-2-(3-	188-192	396.2
		fluoro-4-methoxyphenyl)-4H-quinolizin-
		4-one acetate
55*	380	2-(2-methyl-1,3-benzothiazol-6-yl)-7-	230-235	378.2
		(piperidin-4-yl)-4H-pyrimido[1,2-
		b]pyridazin-4-one trifluoroacetate (1:1)
57	413	2-(1,3-dimethylpyrrolo[1,2-a]pyrazin-7-	>300	373.3
		yl)-7-(1,2,3,6-tetrahydropyridin-4-yl)-4H-
		pyrazino[1,2-a]pyrimidin-4-one
		hydrochloride (1:2)

Material	Source
HEK293H cells	ATCC Catalog No. CRL-1573
Cells-To-Ct lysis	Life Technologies, Inc. (formerly Applied Biosystems)
buffer	Catalog No.: 4399002
DMEM	Life Technologies, Inc. (formerly Invitrogen)
	Catalog No.: 11960-044
96-well flat-	Becton Dickinson Catalog No.: 353072
bottom plates
RT-PCR Enzyme	Life Technologies, Inc. (formerly Applied Biosystems)
Mix	Part No.: 4388520 (also included in AgPath-ID Kit
	Catalog No.: 4387391)
RT-PCR buffer	Life Technologies, Inc. (formerly Applied Biosystems)
	Part No.: 4388519 (also included in AgPath-ID Kit
	Catalog No.: 4387391)
AgPath-ID One-	Life Technologies, Inc. (formerly Applied Biosystems)
Step RT-PCR Kit	Catalog No.: 4387391
Thermocycler	Life Technologies, Inc. (formerly Applied Biosystems)
	7900HT

TABLE 4

Cpd	EC 1.5x
1	***
2	**
3	***
4	**
5	*
6	*****
7	***
8	****
9	**
10	**
11	***
12	***
13	**
14	**
15	**
16	**
17	**
18	***
19	**
20	**
21	*
22	***
23	*
24	**
25	**
26	*
27	*
28	*
29	*
30	*****
31	**
32	**
33	**
34	**
35	*
36	*
37	**
38	*
39	*
40	*
41	***
42	**
43	****
44	**
45	*
46	**
47	**
48	*
49	*
50	*
51	*
52	*
53	**
54	**
55	**
56	**
57	*
58	*
59	**
60	**
61	***
62	****
63	**
64	*
65	*
66	***
67	****
68	****
69	***
70	**
71	**
72	*****
73	*
74	*****
75	*****
76	***
77	***
78	**
79	****
80	**
81	***
82	**
83	***
84	**
85	**
86	****
87	****
88	**
89	**
90	**
91	**
92	**
93	**
94	**
95	**
96	***
97	**
98	**
99	***
100	***
101	***
102	***
103	***
104	***
105	****
106	***
107	***
108	****
109	*****
110	****
111	****
112	***
113	**
114	**
115	*****
116	****
117	*****
118	****
119	****
120	*****
121	*****
122	**
123	**
124	***
125	***
126	****
127	***
128	***
129	***
130	**
131	*****
132	*****
133	*****
134	*****
135	*****
136	*****
137	****
138	****
139	**
140	**
141	*****
142	***
143	*****
144	*****
145	**
146	**
147	**
148	****
149	***
150	***
151	****
152	****
153	***
154	**
155	****
156	***
157	**
158	**
159	**
160	*****
161	***
162	***
163	**
164	***
165	**
166	***
167	*****
168	***
169	*****
170	*****
171	*****
172	*****
173	***
174	**
175	*****
176	***
177	****
178	***
179	***
180	**
181	**
182	***
183	**
184	**
185	*****
186	*****
187	**
188	****
189	***
190	***
191	**
192	**
193	*****
194	*****
195	*****
196	*****
197	****
198	*****
199	***
200	**
201	*****
202	***
203	**
204	*****
205	***
206	**
207	*****
208	*****
209	*****
210	*****
211	*****
212	****
213	****
214	***
215	***
216	***
217	***
218	****
219	*****
220	***
221	*****
222	***
223	***
224	***
225	**
226	***
227	**
228	**
229	***
230	***
231	***
232	**
233	***
234	*****
235	***
236	**
237	**
238	***
239	**
240	*****
241	****
242	*****
243	*****
244	*****
245	***
246	**
247	*****
248	***
249	***
250	*****
251	*****
252	****
253	**
254	****
255	***
256	***
257	*****
258	*****
259	*****
260	****
261	*****
262	****
263	***
264	*****
265	**
266	**
267	*****
268	*****
269	*****
270	*****
271	*****
272	*****
273	*****
274	*****
275	*****
276	***
277	**
278	**
279	****
280	**
281	****
282	***
283	*****
284	***
285	*****
286	***
287	*****
288	*****
289	*****
290	*****
291	*****
292	*****
293	*****
294	*****
295	*****
296	*****
297	*****
298	***
299	*****
300	*****
301	**
302	*****
303	*****
304	*****
305	*****
306	*****
307	*****
308	*****
309	*****
310	*****
311	****
312	*****
313	**
314	*****
315	*****
316	****
317	***
318	*****
319	*****
320	***
321	**
322	*****
323	****
324	***
325	***
326	**
327	*****
328	*****
329	*****
330	****
331	*****
332	***
333	****
334	*****
335	*****
336	****
337	*****
338	*****
339	*****
340	*****
341	***
342	*****
343	*****
344	****
345	*****
346	*****
347	*****
348	****
349	*****
350	*****
351	*****
352	*****
353	****
354	*****
355	*****
356	*****
357	****
358	*****
359	*****
360	**
361	****
362	***
363	***
364	**
365	****
366	*****
367	*****
368	*****
369	*****
370	****
371	****
372	*****
373	*****
374	*****
375	*****
376	*****
377	***
378	*****
379	****
380	****
381	****
382	*****
383	***
384	*****
385	*****
386	***
387	***
388	*****
389	**
390	***
391	**
392	****
393	*****
394	****
395	***
396	****
397	*****
398	***
399	***
400	****
401	****
402	*****
403	*****
404	***
405	****
406	***
407	*****
408	*****
409	*****
410	*****
411	*****
412	*****
413	*****
414	*****
415	*****
416	*****
417	****
418	*****
419	****
420	*****
421	*****
422	*****
423	*****
424	*****
425	*****
426	***
427	**
428	***
429	*****
430	*****
431	*****
432	*****
433	*****
434	***
435	****
436	***
437	****
438	*****
439	****
440	*****
441	*****
442	*****
443	*****
444	***
445	*****
446	*****
447	****
448	*****
449	*****
450	***
451	*****
452	*****
453	*****
454	*****
455	****
456	****
457	*****
458	*****
459	*****
460	****
461	***
462	*****
463	*****
464	****
465	***
466	*****
467	*****
468	*****
469	****
470	*****
471	*****
472	*****
473	*****
474	*****
475	***
476	*****
477	*****
478	*****
479	*****
480	*****
481	*****
482	*****
483	*****
484	*****
485	*****
486	*****
487	****
488	*****
489	****
490	*****
491	***
492	***
493	*****
494	*****
495	*****
496	*****
497	*****
498	*****
499	*****
500	****
501	****
502	*****
503	*****
504	*****
505	*****
506	*****
507	****
508	*****
509	*****
510	*****
511	*****
512	*****
513	****
514	****
515	*****
516	*****
517	*****
518	*****
519	*****
520	****
521	****
522	*****
523	*****
524	****
525	****
526	***
527	*****
528	*****
529	*****
530	*****
531	****
532	*****
533	*****
534	*****
535	*****
536	*****
537	*****
538	*****
539	*****
540	*****
541	****
542	*****
543	*****
544	*****
545	****
546	*****
547	*****
548	*****
549	*****
550	*****
551	****
552	***
553	****
554	****
555	**
556	***
557	**
558	**
559	**
560	**
561	*****
562	***
563	****
564	**
565	*****
566	*****
567	****
568	*****
569	*****
570	***
571	***
572	***
573	***
574	***
575	***
576	*****
577	*****
578	*****
579	****
580	*****
581	****
582	*****
583	*****
584	*****
585	*****
586	****
587	*****
588	*****
589	****
590	***
591	***
592	****
593	*****
594	****
595	*****
596	*****
597	****
598	****
599	*****
600	****
601	*****
602	*****
603	****
604	***
605	***
606	*****
607	*****
608	****
609	*****
610	*****
611	***
612	*****
613	*****
614	*****
615	*****
616	*****
617	*****
618	*****
619	****
620	***
621	***
622	**
623	*****
624	*****
625	**
626	***
627	****
628	***
629	*****
630	*****
631	****
632	*****
633	*****
634	*****
635	*****
636	*****
637	*****
638	*****
639	*****
640	*****
641	*****
642	*****
643	****
644	****
645	*****
646	***
647	*****
648	*****
649	*****
650	*****
651	*****
652	*****
653	*****
654	*****
655	*****
656	*****
657	*****
658	*****
659	*****
660	*****
661	*****
662	*****
663	*****
664	***
665	****
666	****
667	*****
668	*****
669	*****
670	*****
671	*****
672	*****
673	*****
674	*****
675	*****
676	*****
677	*****
678	*****
679	*****
680	*****
681	*****
682	***
683	*****
684	****
685	****
686	***
687	*****
688	**
689	****
690	*****
691	*****
692	****
693	**
694	*****
695	*****
696	*****
697	*****
698	*****
699	*****
700	*****
701	*****
702	*****
703	*****
704	****
705	*****
706	*****
707	*****
708	*****
709	*****
710	*****
711	*****
712	*****
713	*****
714	*****
715	*****
716	*****
717	****
718	*****
719	*****
720	*****
721	*****
722	*****
723	*****
724	***
725	****
726	***
727	*****
728	****
729	****
730	*****
731	*****
732	***
733	*****
734	*****
735	*****
736	*****
737	*****
738	*****
739	*****
740	***
741	*****
742	****
743	*****
744	*****
745	*****
746	*****
747	*****
748	*****
749	*****
750	*****
751	*****
752	*****
753	*****
754	*****
755	*****
756	*****
757	***
758	***
759	****
760	*****
761	*****
762	*****
763	*****
764	**
765	**
766	*****
767	*****
768	*****
769	****
770	*****
771	*****
772	*****
773	*****
774	*****
775	***
776	**
777	**
778	*****
779	*****
780	*****
781	*****
782	*****
783	*****
784	****
785	*****
786	****
787	*****
788	*****
789	*****
790	*****
791	*****
792	*****
793	*****
794	*****
795	*****
796	*****
797	**
798	*****
799	*****
800	*****
801	****
802	**
803	*****
804	*****
805	****
806	*****
807	*****
808	*****
809	*****
810	*****
811	***
812	*****
813	*****
814	*****
815	*****
816	*****
817	*****
818	****
819	*****
820	*****
821	*****
822	****
823	*
824	***
825	***
826	****
827	*****
828	*****
829	****
830	*****
831	****
832	****
833	*****
834	*****
835	*****

Material	Source
SMA Type 1	GM03813 (Coriell Institute)
human cells
Cells-To-Ct lysis	Life Technologies, Inc. (formerly Applied Biosystems)
buffer	Catalog No.: 4399002
DMEM	Life Technologies, Inc. (formerly Invitrogen)
	Catalog No.: 11960-044
96-well flat-	Becton Dickinson Catalog # 353072
bottom plates
RT-PCR Enzyme	Life Technologies, Inc. (formerly Applied Biosystems)
Mix	Part No.: 4388520 (also included in AgPath-ID Kit
	Catalog No.: 4387391)
RT-PCR buffer	Life Technologies, Inc. (formerly Applied Biosystems)
	Part No.: 4388519 (also included in AgPath-ID Kit
	Catalog No.: 4387391)
AgPath-ID One-	Life Technologies, Inc. (formerly Applied Biosystems)
Step RT-PCR Kit	Catalog No.: 4387391
Thermocycler	Life Technologies, Inc. (formerly Applied Biosystems)
	7900HT

TABLE 5 — Primer/ 2 Commercially available from Life Technologies, Inc. (formerly Invitrogen).

Probe	Sequence	Source
SMN FL Forward	SEQ ID NO. 7: GCTCACA	PTC 1
Primer B	TTCCTTAAATTAAGGAGAAA
SMN Δ7 Forward	SEQ ID NO. 8: TGGCTAT	PTC 1
Primer B	CATACTGGCTATTATATGGAA
SMN Reverse	SEQ ID NO. 9: TCCAGAT	PTC 1
Primer B	CTGTCTGATCGTTTCTT
SMN Forward	SEQ ID NO. 10: 6FAM-C	PTC 1
Probe B	TGGCATAGAGCAGCACTAAAT
	GACACCAC-TAMRA
hGAPDH Forward	SEQ ID NO. 4: VIC-CGC	LTI 2
Probe	CTGGTCACCAGGGCTGCT-TA
	MRA
hGAPDH Forward	SEQ ID NO. 5: CAACGGA	LTI 2
Primer	TTTGGTCGTATTGG
hGAPDH Reverse	SEQ ID NO. 6: TGATGGC	LTI 2
Primer	AACAATATCCACTTTACC
1 Primers and probe designed by PTC Therapeutics, Inc.;

Material	Source
SMA Type 1 human cells	GM03813 (Coriell Institute)
Cells-To-Ct lysis buffer	Life Technologies, Inc. (formerly Applied
	Biosystems) Catalog No.: 4399002
DMEM	Life Technologies, Inc. (formerly Invitrogen)
	Catalog No.: 11960-044
96-well flat-bottom plates	Becton Dickinson Catalog No.: 353072
Platinum Taq HiFi DNA	Life Technologies, Inc. (formerly Invitrogen)
Polymerase Super Mix	Catalog No.: 11304-016
iScript RT enzyme Kit	BioRad: Catalog No.: 170-8890
Ethidium bromide 2%	Life Technologies, Inc. (formerly Invitrogen)
agarose E gels 48-Well	Catalog No.: G8008-02
Double Comb
Gel Documentation System	UVP Gel Doc It 310 Imaging system

TABLE 6 — 1 Primers designed by PTC Therapeutics, Inc.

Primer	Sequence	Source
SMN Forward C	SEQ ID NO. 11: GATGC	PTC 1
	TGATGCTTTGGGAAGT
SMN Reverse C	SEQ ID NO. 12: CGCTT	PTC 1
	CACATTCCAGATCTGTC

Material	Source
Tissues from C/C-allele	The Jackson Laboratory, strain No.: 008714 (B6.129-
SMA mice	Smn1 tm5(Smn1/SMN2)Mrph /J)
Tissues from Δ7 SMA mice	The Jackson Laboratory, strain No.: 005025 (FVB.Cg-
	Tg(SMN2*delta7)4299Ahmb Tg(SMN2)89Ahmb Smn1 tm1Msd /J)
RT-PCR Enzyme Mix	Life Technologies, Inc. (formerly Applied Biosystems) Part
	No.: 4388520 (also included in AgPath-ID Kit Catalog No.:
	4387391)
RT-PCR buffer	Life Technologies, Inc. (formerly Applied Biosystems) Part
	No.: 4388519 (also included in AgPath-ID Kit Catalog No.:
	4387391)
AgPath-ID One-Step RT-	Life Technologies, Inc. (formerly Applied Biosystems) Catalog
PCR Kit	No.: 4387391
Mouse GAPDH primers and	Life Technologies, Inc. (formerly Applied Biosystems) Catalog
probes	No.: 4352339E
QIAzol Lysis Reagent	Qiagen Catalog No.: 79306
RNeasy Lipid Tissue Mini	Qiagen Catalog No.: 74804
Kit
5 mm Stainless Steel Bead	Qiagen Catalog No.: 69989
TissueLyzer II	Qiagen Catalog No.: 85300
Thermocycler	Life Technologies, Inc. (formerly Applied Biosystems) 7900HT

TABLE 7 — 1 Primers and probe designed by PTC Therapeutics, Inc.

Primer/Probe	Sequence	Source
SMN FL Forward	SEQ ID NO. 7: GCTCACA	PTC 1
Primer B	TTCCTTAAATTAAGGAGAAA
SMN Δ7 Forward	SEQ ID NO. 8: TGGCTAT	PTC 1
Primer B	CATACTGGCTATTATATGGAA
SMN Reverse	SEQ ID NO. 9: TCCAGAT	PTC 1
Primer B	CTGTCTGATCGTTTCTT
SMN Forward	SEQ ID NO. 10: 6FAM-C	PTC 1
Probe B	TGGCATAGAGCAGCACTAAAT
	GACACCAC-TAMRA

Material	Source
Tissues from C/C-allele	The Jackson Laboratory, strain No.: 008714
SMA mice	(B6.129-Smn1 tm5(Smn1/SMN2)Mrph /J)
Tissues from ΔExon7 SMA	The Jackson Laboratory, strain No.: 005025
mice	(FVB.Cg-Tg(SMN2*delta7)4299Ahmb
	Tg(SMN2)89Ahmb Smn1 tm1Msd /J)
Qiagen RNeasy lipid Kit	Qiagen Catalog No.: 74804
Platinum Taq HiFi DNA	Life Technologies, Inc. (formerly Invitrogen)
Polymerase Super Mix	Catalog No.: 11304-016
iScript RT enzyme Kit	BioRad Catalog No.: 170-8890
Twin.tec 96-Well	Eppendorf Catalog No.: 951020389
Semiskirted PCR Plate
Ethidium bromide 2%	Life Technologies, Inc. (formerly Invitrogen)
agarose E gels 48-Well	Catalog No.: G8008-02
Double Comb
Gel Documentation System	UVP Gel Doc It 310 Imaging system

TABLE 8 — 1 Primers designed by PTC Therapeutics, Inc.

Primer	Sequence	Source
SMN Forward D	SEQ ID NO. 13: ATATGT	PTC 1
	CCAGATTCTCTTGATGATG
SMN Reverse C	SEQ ID NO. 12: CGCTTC	PTC 1
	ACATTCCAGATCTGTC

Material	Source
SMA Type 1 human cells	GM03813 (Coriell Institute)
Protease inhibitor	Roche Applied Science Catalog No.:
cocktail	11836145001
Anti-SMN d2	Blue cap Cisbio Catalog No.: 63IDC002-SMN
Anti-SMN kryptate	Red cap Cisbio Catalog No.: 63IDC002-SMN
SMN reconstitution	Cisbio Catalog No.: 63IDC002-SMN-Buffer
buffer
DMEM	Life Technologies, Inc. (formerly Invitrogen)
	Catalog No.: 11960-044
RIPA Lysis Buffer	20 mM Tris-HCl pH 7.5, 150 mM NaCl,
	1 mM EDTA, 1% NP-40, 1%
	Sodium deoxycholate
Diluent Buffer	20 mM Tris-HCl pH 7.5, 150 mM NaCl
Envision Plate Reader	Perkin Elmer Model No.: 2103

TABLE 9

Cpd	EC 1.5x
3	**
6	***
8	**
18	**
20	**
22	**
24	*
30	**
43	**
61	***
62	***
66	*
67	***
69	***
71	*
72	***
74	***
75	****
79	***
82	**
84	**
85	*
86	****
87	***
90	*
95	**
96	***
99	***
100	***
102	***
105	***
106	**
109	****
115	****
116	*
117	****
118	***
119	***
120	****
121	****
127	*
129	*
130	*
131	**
132	****
133	****
134	****
135	****
136	****
137	***
138	***
141	****
143	****
144	****
148	**
150	**
152	****
160	***
161	**
162	**
164	**
167	**
169	****
170	****
171	****
172	****
175	***
176	*
179	***
180	**
182	***
186	***
188	***
189	***
190	**
191	**
192	**
193	****
194	****
195	***
196	****
197	****
198	****
199	**
201	***
204	****
208	***
209	****
210	****
211	****
212	****
213	****
214	**
218	**
219	****
221	****
224	***
229	*
230	**
231	**
234	****
235	**
236	*
240	****
241	****
242	****
243	****
244	****
247	****
248	***
250	****
251	****
252	***
254	**
256	**
257	**
258	***
259	***
260	**
261	****
262	***
263	***
264	****
267	****
268	****
269	****
270	****
271	****
272	****
273	****
274	****
275	****
283	****
284	***
285	****
286	***
287	****
288	****
289	****
290	****
291	****
292	****
293	****
294	*
295	****
296	****
297	****
299	****
300	****
302	****
303	****
304	****
305	****
306	****
307	****
308	****
309	****
310	***
312	****
314	***
316	**
317	**
318	****
319	****
320	**
322	***
323	**
326	**
327	****
329	**
331	****
333	**
334	****
335	****
336	****
337	****
338	****
339	****
340	****
341	***
342	****
343	****
344	***
346	****
349	**
350	****
351	****
352	****
354	***
355	***
356	***
357	***
358	**
359	**
366	****
367	*
368	***
369	**
370	***
371	***
372	****
373	****
374	****
375	****
376	***
377	**
378	**
380	***
381	*
382	***
384	****
385	***
393	***
396	***
397	****
398	**
399	***
400	***
401	***
402	**
403	**
404	**
405	***
406	*
409	****
410	****
412	****
413	****
414	***
416	**
417	**
420	****
422	**
423	***
424	****
425	****
426	***
427	*
428	**
429	****
430	****
431	****
432	****
437	***
438	****
439	**
440	****
441	****
442	****
443	****
444	**
445	***
446	**
448	****
449	****
451	***
452	****
453	****
454	****
457	****
458	***
460	***
461	**
462	****
463	***
464	**
466	***
467	****
468	***
469	***
470	****
471	****
472	****
473	****
474	****
475	**
476	****
477	****
478	****
480	****
481	****
482	*
484	****
485	****
486	****
487	****
488	****
489	**
490	***
491	**
492	**
493	***
494	****
495	****
496	****
497	***
498	****
499	****
500	***
501	***
502	****
503	****
504	****
505	****
506	****
507	***
508	***
509	***
510	****
511	**
512	****
513	****
514	**
515	****
516	****
517	****
518	****
519	****
520	****
521	****
522	***
523	****
524	***
525	***
526	**
527	****
528	****
529	***
530	****
531	***
532	****
533	***
534	****
535	***
536	****
537	****
538	***
539	****
541	***
542	***
543	****
544	***
545	****
546	****
547	****
548	****
549	****
550	****
551	****
552	***
553	****
554	****
555	**
556	**
561	****
563	****
565	***
566	****
567	***
568	****
569	****
570	**
571	**
572	**
573	**
576	****
577	****
578	****
579	***
580	***
581	***
582	****
583	****
584	****
585	****
586	****
587	****
588	****
589	***
590	**
591	**
592	***
593	****
594	***
595	****
596	****
597	***
598	***
599	****
600	**
601	***
602	****
603	***
604	****
605	***
606	**
607	****
608	**
609	****
610	****
612	****
613	****
614	****
615	****
616	****
617	****
618	****
619	***
620	**
621	****
622	**
623	****
624	****
626	**
627	**
628	*
629	****
630	****
631	***
632	****
633	****
634	****
635	****
636	****
637	****
638	****
639	****
640	****
641	****
642	****
643	***
644	***
645	****
646	**
647	****
648	****
649	****
650	****
651	****
652	****
653	****
654	****
655	****
656	****
657	****
658	****
659	****
660	****
661	****
662	****
663	****
664	***
665	****
666	***
667	****
668	****
669	****
670	****
671	****
672	****
673	****
674	****
675	****
676	***
677	***
678	****
679	****
680	****
681	****
682	**
683	***
684	***
685	**
686	**
687	****
688	**
689	***
690	***
691	****
692	***
693	**
694	****
695	****
696	****
697	****
698	****
699	****
700	****
701	****
702	****
703	****
704	****
705	****
706	****
707	****
708	****
709	****
710	****
711	****
712	****
713	****
714	****
715	****
716	***
717	***
718	***
719	****
720	****
721	****
722	****
723	****
724	***
725	***
726	**
727	****
728	****
729	***
730	****
731	****
732	***
733	****
734	****
735	****
736	****
737	****
738	****
739	****
740	***
741	****
742	***
743	****
744	***
745	****
746	****
747	****
748	****
749	****
750	****
751	****
752	****
753	****
754	****
755	****
756	****
757	***
759	***
760	****
761	****
762	****
763	****
764	*
765	**
766	****
767	****
768	****
769	***
770	***
771	****
772	****
773	****
774	****
777	**
778	***
779	****
780	****
781	****
782	****
783	****
784	***
785	****
786	***
787	****
788	****
789	****
790	****
791	****
792	***
793	****
794	****
795	****
796	****
797	*
798	****
799	****
800	****
801	***
802	*
803	****
804	****
805	***
806	****
807	****
808	****
809	****
810	****
811	***
812	****
813	****
814	****
815	****
816	****
817	****
818	***
819	****
820	****
821	****
822	***
824	*
825	**
826	**
827	***
828	****
829	**
830	***
831	**
832	***
833	**
834	****
835	****

TABLE 10

Cpd	Fold
1	**
2	**
3	***
4	*
5	*
6	****
7	***
8	****
9	***
10	**
11	***
12	***
13	**
14	***
15	***
16	*
17	*
18	****
19	**
20	****
21	*
22	***
23	***
24	***
25	*
26	**
27	*
28	**
29	***
30	****
31	*
32	*
33	*
34	**
35	*
36	*
37	*
38	*
39	*
40	*
41	***
42	*
43	***
44	*
45	**
46	***
47	***
48	*
49	*
50	**
51	**
52	*
53	*
54	*
55	*
56	*
57	*
58	*
59	*
60	*
61	****
62	*****
63	**
64	**
65	**
66	***
67	***
68	**
69	****
70	*
71	****
72	***
73	**
74	*****
75	*****
76	**
77	**
78	*
79	****
80	*
81	**
82	*****
83	*
84	*****
85	***
86	****
87	****
88	**
89	***
90	***
91	**
92	**
93	**
94	***
95	****
96	****
97	**
98	***
99	****
100	*****
101	***
102	*****
103	***
104	***
105	****
106	****
107	**
108	***
109	****
110	***
111	***
112	***
113	***
114	***
115	****
116	***
117	****
118	*****
119	*****
120	*****
121	*****
122	***
123	*
124	**
125	***
126	**
127	***
128	***
129	***
130	***
131	***
132	*****
133	****
134	*****
135	****
136	*****
137	*****
138	*****
139	***
140	***
141	*****
142	***
143	*****
144	****
145	*
146	*
147	*
148	***
149	**
150	****
151	***
152	*****
153	**
154	*
155	**
156	***
157	**
158	*
159	***
160	***
161	***
162	****
163	***
164	****
165	**
166	**
167	***
168	*
169	****
170	*****
171	*****
172	*****
173	**
174	**
175	****
176	***
177	***
178	**
179	*****
180	****
181	*
182	****
183	**
184	**
185	***
186	****
187	**
188	*****
189	****
190	****
191	****
192	*****
193	*****
194	*****
195	****
196	****
197	*****
198	****
199	****
200	*
201	***
202	**
203	*
204	****
205	**
206	**
207	***
208	***
209	****
210	****
211	****
212	****
213	***
214	****
215	***
216	***
217	***
218	***
219	****
220	**
221	*****
222	***
223	***
224	****
225	*
226	*
227	***
228	**
229	***
230	****
231	****
232	*
233	*
234	*****
235	****
236	***
237	***
238	**
239	*
240	****
241	*****
242	****
243	****
244	****
245	**
246	*
247	*****
248	****
249	*
250	*****
251	*****
252	****
253	*
254	***
255	**
256	****
257	****
258	****
259	****
260	***
261	****
262	*****
263	****
264	*****
265	***
266	**
267	*****
268	*****
269	*****
270	****
271	*****
272	*****
273	*****
274	*****
275	*****
276	*
277	***
278	**
279	**
280	*
281	**
282	**
283	****
284	****
285	*****
286	****
287	*****
288	*****
289	****
290	*****
291	*****
292	****
293	*****
294	***
295	****
296	*****
297	*****
298	***
299	*****
300	*****
301	*
302	*****
303	****
304	*****
305	*****
306	*****
307	****
308	*****
309	****
310	***
311	**
312	****
313	*
314	****
315	***
316	*****
317	****
318	*****
319	****
320	****
321	***
322	****
323	***
324	***
325	***
326	***
327	****
328	***
329	****
330	**
331	*****
332	*
333	****
334	*****
335	*****
336	*****
337	*****
338	*****
339	*****
340	*****
341	*****
342	*****
343	*****
344	*****
345	***
346	****
347	***
348	**
349	***
350	*****
351	*****
352	****
353	**
354	****
355	****
356	****
357	****
358	***
359	***
360	*
361	***
362	***
363	**
364	*
365	***
366	****
367	***
368	****
369	***
370	*****
371	****
372	*****
373	****
374	*****
375	****
376	***
377	****
378	****
379	***
380	****
381	***
382	****
383	**
384	*****
385	*****
386	*
387	**
388	***
389	**
390	*
391	*
392	***
393	***
394	**
395	**
396	****
397	*****
398	*****
399	****
400	****
401	*****
402	****
403	****
404	****
405	****
406	***
407	***
408	**
409	*****
410	*****
411	***
412	*****
413	****
414	*****
415	***
416	***
417	****
418	***
419	**
420	****
421	***
422	***
423	****
424	*****
425	*****
426	*****
427	***
428	***
429	****
430	****
431	*****
432	*****
433	***
434	**
435	***
436	**
437	****
438	*****
439	***
440	****
441	*****
442	*****
443	*****
444	***
445	***
446	***
447	*
448	*****
449	****
450	**
451	*****
452	*****
453	*****
454	*****
455	**
456	***
457	*****
458	****
459	***
460	****
461	****
462	*****
463	*****
464	****
465	***
466	*****
467	*****
468	****
469	*****
470	****
471	*****
472	*****
473	*****
474	****
475	***
476	*****
477	****
478	*****
479	**
480	*****
481	****
482	***
483	**
484	*****
485	*****
486	****
487	****
488	****
489	****
490	*****
491	****
492	****
493	****
494	****
495	*****
496	*****
497	****
498	*****
499	*****
500	*****
501	*****
502	*****
503	*****
504	*****
505	****
506	****
507	****
508	****
509	****
510	*****
511	****
512	*****
513	*****
514	*****
515	*****
516	****
517	*****
518	****
519	*****
520	****
521	*****
522	*****
523	*****
524	*****
525	*****
526	*****
527	*****
528	****
529	*****
530	*****
531	*****
532	*****
533	*****
534	*****
535	*****
536	****
537	****
538	****
539	****
540	***
541	*****
542	*****
543	*****
544	****
545	*****
546	*****
547	*****
548	*****
549	*****
550	*****
551	*****
552	****
553	*****
554	*****
555	***
556	***
557	*
558	**
559	*
560	*
561	****
562	**
563	*****
564	*
565	****
566	*****
567	****
568	*****
569	*****
570	****
571	****
572	****
573	****
574	**
575	***
576	*****
577	*****
578	*****
579	*****
580	*****
581	*****
582	*****
583	*****
584	*****
585	*****
586	*****
587	****
588	*****
589	****
590	****
591	****
592	*****
593	*****
594	****
595	****
596	****
597	****
598	*****
599	*****
600	****
601	****
602	****
603	*****
604	*****
605	*****
606	****
607	*****
608	****
609	*****
610	*****
611	***
612	*****
613	*****
614	*****
615	****
616	*****
617	*****
618	*****
619	*****
620	***
621	*****
622	****
623	*****
624	*****
625	**
626	*****
627	****
628	****
629	*****
630	*****
631	*****
632	*****
633	*****
634	*****
635	*****
636	*****
637	*****
638	*****
639	*****
640	****
641	*****
642	*****
643	*****
644	*****
645	*****
646	*****
647	*****
648	*****
649	*****
650	*****
651	*****
652	*****
653	*****
654	*****
655	****
656	****
657	*****
658	*****
659	*****
660	****
661	*****
662	*****
663	*****
664	*****
665	*****
666	*****
667	*****
668	*****
669	*****
670	*****
671	*****
672	*****
673	****
674	*****
675	*****
676	*****
677	*****
678	*****
679	*****
680	*****
681	*****
682	*****
683	*****
684	*****
685	****
686	*****
687	****
688	***
689	****
690	****
691	*****
692	*****
693	****
694	*****
695	*****
696	*****
697	*****
698	*****
699	*****
700	*****
701	*****
702	*****
703	*****
704	****
705	*****
706	*****
707	*****
708	*****
709	*****
710	*****
711	*****
712	*****
713	*****
714	*****
715	*****
716	*****
717	*****
718	****
719	****
720	*****
721	*****
722	*****
723	*****
724	*****
725	*****
726	****
727	*****
728	*****
729	*****
730	*****
731	*****
732	****
733	*****
734	*****
735	****
736	*****
737	*****
738	*****
739	*****
740	*****
741	*****
742	*****
743	*****
744	***
745	*****
746	*****
747	*****
748	*****
749	*****
750	*****
751	*****
752	*****
753	*****
754	*****
755	*****
756	*****
757	****
758	***
759	*****
760	*****
761	*****
762	*****
763	*****
764	***
765	****
766	*****
767	*****
768	*****
769	*****
770	****
771	*****
772	*****
773	*****
774	*****
775	***
776	**
777	***
778	*****
779	*****
780	*****
781	*****
782	*****
783	*****
784	****
785	*****
786	****
787	*****
788	*****
789	*****
790	*****
791	*****
792	*****
793	*****
794	*****
795	*****
796	*****
797	***
798	*****
799	*****
800	*****
801	*****
802	*****
803	*****
804	*****
805	*****
806	*****
807	*****
808	*****
809	*****
810	*****
811	*****
812	*****
813	*****
814	*****
815	*****
816	****
817	*****
818	*****
819	*****
820	*****
821	*****
822	****
823	**
824	****
825	*****
826	*****
827	*****
828	*****
829	*****
830	*****
831	****
832	*****
833	*****
834	*****
835	*****

Material	Source
SMA Type 1 human cells	GM03813 (Coriell Institute)
Primary Antibody-mouse anti-	Sigma Catalog No.: S2944
SMN clone 2B1
Secondary Antibody-anti-mouse	Life Technologies, Inc. (formerly Invitrogen) Catalog
Alexa Fluor 555	No.: A21422
Bovine Serum Albumin (BSA)	Sigma Catalog No.: A3294
4% Paraformaldehyde	Electron Microscopy Sciences Catalog No.: 15710
Bortezomib	LC Labs, Catalog No.: B-1408
0.05% Triton X-100	Sigma Catalog No.: 93443-100 mL
Mounting medium-ProLong Gold	Life Technologies, Inc. (formerly Invitrogen) Catalog
Antifade Reagent with DAPI	Nos.: P7481 and P36935
22 × 22 #1 sterile Cover slips	Fisher Catalog No.: 12-548-B
DMEM	Life Technologies, Inc. (formerly Invitrogen) Catalog
	No.: 11960-044
PBS	Life Technologies, Inc. (formerly Invitrogen) Catalog
	No.: 10010-031
Clear-coat nail polish	Revlon brand Catalog No.: 1271-76
Zeiss Axovert 135 Fluorescence	Zeiss
microscope

Material	Source
Tissues from C/C-allele	The Jackson Laboratory, strain No.: 008714 (B6.129-
SMA mice	Smn1 tm5(Smn1/SMN2)Mrph /J)
Tissues from Δ7 SMA	The Jackson Laboratory, strain No.: 005025 (FVB.Cg-
mice	Tg(SMN2*delta7)4299Ahmb Tg(SMN2)89Ahmb Smn1 tm1Msd /J)
Protease inhibitor cocktail	Roche Applied Science Catalog No.: 11836145001
Anti-SMN d2	Blue cap Cisbio Catalog No.: 63IDC002-SMN
Anti-SMN kryptate	Red cap Cisbio Catalog No.: 63IDC002-SMN
SMN reconstitution buffer	Cisbio Catalog No.: 63IDC002-SMN-Buffer
RIPA Lysis Buffer	20 mM Tris-HCl pH 7.5, 150 mM NaCl, 1 mM EDTA, 1%
	NP-40, 1% Sodium deoxycholate
Diluent Buffer	20 mM Tris-HCl pH 7.5, 150 mM NaCl
BCA protein assay Kit	Pierce Catalog No.: 23225
White 384 well plate	Nunc Catalog No.: 351190
Polypropylene V-bottom	Falcon Catalog No.: 165195
plate
Clear 96 well polystyrene	Nunc Catalog No.: 442404
plate
5 mm Stainless Steel	Qiagen Catalog No.: 69989
Beads
Safe-Lock Tubes 2.0 mL	Eppendorf Catalog No.: 022363352
Twin.tec 96-Well	Eppendorf Catalog No.: 951020389
Semiskirted PCR Plate
TissueLyzer II	Qiagen Catalog No.: 85300
Envision Plate Reader	Perkin Elmer Model No.: 2103

Material	Source
Tissues from C/C-allele	The Jackson Laboratory, strain No.: 008714
SMA mice	(B6.129-Smn1 tm5(Smn1/SMN2)Mrph /J)

Material	Source
Tissues from Δ7	The Jackson Laboratory, strain No.: 005025 (FVB.Cg-
SMA mice	Tg(SMN2*delta7)4299Ahmb Tg(SMN2)89Ahmb
	Smn1 tm1Msd /J)

Material	Source
Tissues from	The Jackson Laboratory, strain No.: 005025 (FVB.Cg-
ΔExon7 SMA	Tg(SMN2*delta7)4299Ahmb Tg(SMN2)89Ahmb
mice	Smn1 tm1Msd /J)

Material	Source
Tissues from	The Jackson Laboratory, strain No.: 005025 (FVB.Cg-
ΔExon7 SMA	Tg(SMN2*delta7)4299Ahmb Tg(SMN2)89Ahmb
mice	Smn1 tm1Msd /J)

Material	Source
Tissues from Δ7	The Jackson Laboratory, strain No.: 005025 (FVB.Cg-
SMA mice	Tg(SMN2*delta7)4299Ahmb Tg(SMN2)89Ahmb
	Smn1 tm1Msd /J)

Material	Source
HEK293H cells	ATCC Catalog No.: CRL-1573
Cells-To-Ct lysis buffer	Life Technologies, Inc. (formerly Applied Biosystems)
	Catalog No.: 4399002
FuGENE-6 lipid transfection	Roche Applied Science, Catalog No.: 11 814 443 001
reagent
DMEM	Life Technologies, Inc. (formerly Invitrogen) Catalog No.:
	11960-044
96-well flat-bottom plates	Becton Dickinson Catalog No.: 353072
Platinum Taq HiFi DNA	Life Technologies, Inc. (formerly Invitrogen) Catalog No.:
Polymerase Super Mix	11304-016
iScript RT enzyme Kit	BioRad Catalog No.: 170-8890
Ethidium bromide 2% agarose	Life Technologies, Inc. (formerly Invitrogen) Catalog No.:
E gels 48-Well Double Comb	G8008-02
Gel Documentation System	UVP Gel Doc It 310 Imaging system

TABLE 11 — 1 Primers designed by PTC Therapeutics, Inc.

Primer	Sequence	Source
SMN Forward C	SEQ ID NO. 11: GATGCT	PTC 1
	GATGCTTTGGGAAGT
SMN Reverse A	SEQ ID NO. 2: CGCTTCA	PTC 1
	CATTCCAGATCTGTC

description truncated at 500,000 characters

Stored text is truncated at the source; the tail of the description is not held.

Claims as granted

21 claims

Classifications

5 codes

LexDana classificationderived from the 10 nearest patents by meaning — ours, not an office code

Medicinal preparations containing organic active ingredients50%
Heterocyclic compounds containing more than one system of two or more50%
Heterocyclic compounds containing nitrogen atoms as the only ring40%
Heterocyclic compounds containing nitrogen atoms as the only ring30%

IPC · International Patent Classification

Section A — Human necessities

A01N43/90
A61K31/519

Section C — Chemistry; metallurgy

C07D471/04
C07D519/00
C07D487/04

As published → as granted

15 → 21 claims

The claims as they stood in the application’s own pre-grant publication (US-2015005289-A1), 2015, beside the claims that issued in 2017. Both are the same application. Claims are matched on their text, not their number.

3 amended16 added10 not granted2 unchanged

removedadded

›Claim by claim — 29 of 31

amendedclaim 1independent

A compound of Formula ~~(I):~~ (IIa1): or a form thereof, wherein: w 1 and w 5 are independently C—R a or N; W 2 is C—R b or N; w 3 , w 4 and w 7 are independently C—R 1 , C—R 2 , C—R a or N; w 6 is C—R 1 , C—R 2 , C—R c or N; wherein one of w 3 , w 4 , w 6 and w 7 is C—R 1 and one other of w 3 , w 4 , w 6 and w 7 is C—R 2 , provided that, when w 3 is C—R 1 , then w 6 is C—R 2 and w 4 and w 7 are independently C—R a or N; or, when w 3 is C—R 2 , then w 6 is C—R 1 and w 4 and w 7 are independently C—R a or N; or, when w 4 is C—R 1 , then w 7 is C—R 2 and w 3 is C—R a or N and w 6 is C—R c or N; or, when w 4 is C—R 2 , then w 7 is C—R 1 and w 3 is C—R a or N and w 6 is C—R c or N; and, wherein any one, two or three of w 1 , w 2 , w 3 , w 4 , w s , w 6 and w 7 may optionally be N; R 1 is C 1-8 alkyl, amino, C 1-8 alkyl-amino, (C 1-8 alkyl) 2 -amino, C 1-8 alkoxy-C 1-8 alkyl-amino, (C 1-8 alkoxy-C 1-8 alkyl) 2 -amino, (C 1-8 alkoxy-C 1-8 alkyl)(C 1-8 alkyl)amino, amino-C 1-8 alkyl, C 1-8 alkyl-amino-C 1-8 alkyl, (C 1-8 alkyl) 2 -amino-C 1-8 alkyl, C 1-8 alkoxy-C 1-8 alkyl-amino-C 1-8 alkyl, (C 1-8 alkoxy-C 1-8 alkyl) 2 -amino-C 1-8 alkyl, (C 1-8 alkoxy-C 1-8 alkyl)(C 1-8 alkyl)amino-C 1-8 alkyl, amino-C 1-8 alkyl-amino, (amino-C 1-8 alkyl) 2 -amino, (amino-C 1-8 alkyl)(C 1-8 alkyl)amino, C 1-8 alkyl-amino-C 1-8 alkyl-amino, (C 1-8 alkyl-amino-C 1-8 alkyl) 2 -amino, (C 1-8 alkyl-amino-C 1-8 alkyl)(C 1-8 alkyl)amino, (C 1-8 alkyl) 2 -amino-C 1-8 alkyl-amino, [(C 1-8 alkyl) 2 -amino-C 1-8 alkyl](C 1-8 alkyl)amino, amino-C 1-8 alkoxy, C 1-8 alkyl-amino-C 1-8 alkoxy, (C 1-8 alkyl) 2 -amino-C 1-8 alkoxy, C 1-8 alkoxy-C 1-8 alkyl-amino-C 1-8 alkoxy, C 1-8 alkoxy-C 1-8 alkyl-amino-C 1-8 alkoxy, (C 1-8 alkoxy-C 1-8 alkyl)(C 1-8 alkyl)amino-C 1-8 alkoxy, amino-C 2-8 alkenyl, C 1-8 alkyl-amino-C 2-8 alkenyl, (C 1-8 alkyl) 2 -amino-C 2-8 alkenyl, amino-C 2-8 alkynyl, C 1-8 alkyl-amino-C 1-2-8 alkynyl, (C 1-8 alkyl) 2 -amino-C 2-8 alkynyl, halo-C 1-8 alkyl-amino, (halo-C 1-8 alkyl) 2 -amino, (halo-C 1-8 alkyl)(C 1-8 alkyl)amino, hydroxy-C 1-8 alkyl, hydroxy-C 1-8 alkoxy-C 1-8 alkyl, hydroxy-C 1-8 alkyl-amino, (hydroxy-C 1-8 alkyl) 2 -amino, (hydroxy-C 1-8 alkyl)(C 1-8 alkyl)amino, hydroxy-C 1-8 alkyl-amino-C 1-8 alkyl, (hydroxy-C 1-8 alkyl) 2 -amino-C 1-8 alkyl, (hydroxy-C 1-8 alkyl)(C 1-8 alkyl)amino-C 1-8 alkyl, hydroxy-C 1-8 alkyl-amino-C 1-8 alkoxy, (hydroxy-C 1-8 alkyl) 2 -amino-C 1-8 alkoxy, (hydroxy-C 1-8 alkyl)(C 1-8 alkyl)amino-C 1-8 alkoxy, hydroxy-C 1-8 alkyl-amino-C 1-8 alkyl-amino, (hydroxy-C 1-8 alkyl-amino-C 1-8 alkyl) 2 -amino, (hydroxy-C 1-8 alkyl) 2 -amino-C 1-8 alkyl-amino, (hydroxy-C 1-8 alkyl-amino-C 1-8 alkyl)(C 1-8 alkyl)amino, (hydroxy-C 1-8 alkyl)(C 1-8 alkyl)amino-C 1-8 alkyl-amino, [(hydroxy-C 1-8 alkyl) 2 -amino-C 1-8 alkyl](C 1-8 alkyl)amino, [(hydroxy-C 1-8 alkyl)(C 1-8 alkyl)amino-C 1-8 alkyl](C 1-8 alkyl)amino, heterocyclyl, heterocyclyl-C 1-8 alkyl, heterocyclyl-C 1-8 alkoxy, heterocyclyl-amino, (heterocyclyl)(C 1-8 alkyl)amino, heterocyclyl-amino-C 1-8 alkyl, heterocyclyl-C 1-8 alkyl-amino, (heterocyclyl-C 1-8 alkyl) 2 -amino, (heterocyclyl-C 1-8 alkyl)(C 1-8 alkyl)amino, heterocyclyl-C 1-8 alkyl-amino-C 1-8 alkyl, (heterocyclyl-C 1-8 alkyl) 2 -amino-C 1-8 alkyl, (heterocyclyl-C 1-8 alkyl)(C 1-8 alkyl)amino-C 1-8 alkyl, heterocyclyl-oxy, heterocyclyl-carbonyl, heterocyclyl-carbonyl-oxy, C 3-14 cycloalkyl, aryl-C 1-8 alkyl-amino, (aryl-C 1-8 alkyl) 2 -amino, (aryl-C 1-8 alkyl)(C 1-8 alkyl)amino, aryl-C 1-8 alkyl-amino-C 1-8 alkyl, (aryl-C 1-8 alkyl) 2 -amino-C 1-8 alkyl, (aryl-C 1-8 alkyl)(C 1-8 alkyl)amino-C 1-8 alkyl, heteroaryl, heteroaryl-C 1-8 alkyl, heteroaryl-C 1-8 alkoxy, heteroaryl-amino, heteroaryl-C 1-8 alkyl-amino, (heteroaryl-C 1-8 alkyl) 2 -amino, (heteroaryl-C 1-8 alkyl)(C 1-8 alkyl)amino, heteroaryl-C 1-8 alkyl-amino-C 1-8 alkyl, (heteroaryl-C 1-8 alkyl) 2 -amino-C 1-8 alkyl or (heteroaryl-C 1-8 alkyl)(C 1-8 alkyl)amino-C 1-8 alkyl; heterocyclyl; wherein, ~~each instance of heterocyclyl, C 3-14 cycloalkyl, aryl and heteroaryl~~ heterocyclyl is optionally substituted with one, two or three R 3 substituents and optionally, with one additional R 4 substituent; or, wherein, ~~each instance of heterocyclyl, C 3-14 cycloalkyl, aryl and heteroaryl~~ heterocyclyl is optionally substituted with one, two, three or four R 3 substituents; R 2 is ~~aryl, aryl-amino, aryl-amino-carbonyl, heterocyclyl, heteroaryl or heteroaryl-amino;~~ heteroaryl; wherein, ~~each instance of aryl, heterocyclyl and~~ heteroaryl is optionally substituted with one, two or three R 6 substituents and optionally, with one additional R 7 substituent; R a is, in each instance, independently selected from hydrogen, halogen or C 1-8 alkyl; R b is hydrogen, halogen, C 1-8 alkyl or C 1-8 alkoxy; R c is hydrogen, halogen or C 1-8 alkyl; R 3 is, in each instance, independently selected from cyano, halogen, hydroxy, oxo, C 1-8 alkyl, halo-C 1-8 alkyl, C 1-8 alkyl-carbonyl, C 1-8 alkoxy, halo-C 1-8 alkoxy, C 1-8 alkoxy-C 1-8 alkyl, C 1-8 alkoxy-carbonyl, amino, C 1-8 alkyl-amino, (C 1-8 alkyl) 2 -amino, amino-C 1-8 alkyl, C 1-8 alkyl-amino-C 1-8 alkyl, (C 1-8 alkyl) 2 -amino-C 1-8 alkyl, amino-C 1-8 alkyl-amino, C 1-8 alkyl-amino-C 1-8 alkyl-amino, (C 1-8 alkyl-amino-C 1-8 alkyl) 2 -amino, (C 1-8 alkyl) 2 -amino-C 1-8 alkyl-amino, [(C 1-8 alkyl) 2 -amino-C 1-8 alkyl] 2 z -amino, (C 1-8 alkyl-amino-C 1-8 alkyl)(C 1-8 alkyl)amino, [(C 1-8 alkyl) 2 -amino-C 1-8 alkyl](C 1-8 alkyl)amino, C 1-8 alkoxy-C 1-8 alkyl-amino, (C 1-8 alkoxy-C 1-8 alkyl) 2 -amino, (C 1-8 alkoxy-C 1-8 alkyl)(C 1-8 alkyl)amino, C 1-8 alkyl-carbonyl-amino, C 1-8 alkoxy-carbonyl-amino, hydroxy-C 1-8 alkyl, hydroxy-C 1-8 alkoxy-C 1-8 alkyl, hydroxy-C 1-8 alkyl-amino, (hydroxy-C 1-8 alkyl) 2 -amino or (hydroxy-C 1-8 alkyl)(C 1-8 alkyl)amino; R 4 is C 3-14 cycloalkyl, C 3-14 cycloalkyl-C 1-8 alkyl, C 3-14 cycloalkyl-amino, aryl-C 1-8 alkyl, aryl-C 1-8 alkoxy-carbonyl, aryl-sulfonyloxy-C 1-8 alkyl, heterocyclyl or heterocyclyl-C 1-8 alkyl; wherein, each instance of C 3-14 cycloalkyl, aryl and heterocyclyl is optionally substituted with one, two or three R 5 substituents; R 5 is, in each instance, independently selected from halogen, hydroxy, cyano, nitro, C 1-8 alkyl, halo-C 1-8 alkyl, C 1-8 alkoxy, halo-C 1-8 alkoxy, amino, C 1-8 alkyl-amino, (C 1-8 alkyl) 2 -amino or C 1-8 alkyl-thio; R 6 is, in each instance, independently selected from halogen, hydroxy, cyano, nitro, C 1-8 alkyl, C 2-8 alkenyl, halo-C 1-8 alkyl, hydroxy-C 1-8 alkyl, C 1-8 alkoxy, halo-C 1-8 alkoxy, C 1-8 alkoxy-C 1-8 alkyl, amino, C 1-8 alkyl-amino, (C 1-8 alkyl) 2 -amino or C 1-8 alkyl-thio; and, R 7 is C 3-14 cycloalkyl, C 3-14 cycloalkyl-oxy, aryl, heterocyclyl or heteroaryl.

not grantedpublished claim 2no counterpart in the grant

The compound of claim 1 , wherein the compound is selected from Formula (II), Formula (III), Formula (IV), Formula (V), Formula (VI), Formula (VII), Formula (VIII), Formula (IX), Formula (X), Formula (XI), Formula (XII), Formula (XIII) or Formula (XIV): or a form thereof.

not grantedpublished claim 3no counterpart in the grant

The compound of claim 2 , wherein the compound of Formula (I), Formula (II), Formula (III), Formula (IV), Formula (V), Formula (VI), Formula (VII), Formula (VIII), Formula (IX), Formula (X), Formula (XI), Formula (XII), Formula (XIII) or Formula (XIV) is a compound selected from Formula (Ia), Formula (IIa), Formula (IIIa), Formula (IVa), Formula (Va), Formula (VIa), Formula (VIIa), Formula (VIIIa), Formula (IXa), Formula (Xa), Formula (XIa), Formula (XIIa), Formula (XIIIa) or Formula (XIVa), respectively: or a form thereof.

not grantedpublished claim 4no counterpart in the grant

The compound of claim 3 , wherein the compound of Formula (I), Formula (II), Formula (III), Formula (IX), Formula (XI) or Formula (XII) is a compound selected from Formula (Ia), Formula (IIa), Formula (IIIa), Formula (IXa), Formula (XIa) or Formula (XIIa), respectively: or a form thereof.

addedgranted claim 2no counterpart in the publication

The compound of claim 1 , wherein R 3 is C 1-8 alkyl selected from methyl, ethyl, propyl, isopropyl and tert-butyl.

addedgranted claim 3no counterpart in the publication

The compound of claim 1 , wherein R 6 is C 1-8 alkyl selected from methyl, ethyl, propyl, isopropyl and tert-butyl.

addedgranted claim 4no counterpart in the publication

The compound of claim 1 , wherein R a is, in each instance, hydrogen.

addedgranted claim 5no counterpart in the publication

The compound of claim 1 , wherein R b is C 1-8 alkyl.

addedgranted claim 6no counterpart in the publication

The compound of claim 1 , wherein R c is hydrogen or C 1-8 alkyl.

amendedclaim 6 → 8

The compound of claim 5 7 , wherein the salt form is a chloride, hydrobromide, hydrochloride, dihydrochloride, acetate, trifluoroacetate or trifluoroacetic acid salt.

amendedclaim 7 → 9

The compound of claim 1 , wherein the compound is selected from the group consisting of: 2-(4-methoxyphenyl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4-methoxyphenyl)-7-(4-methylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4-methoxyphenyl)-7-[(3R)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 7-[(3R,5S)-3,5-dimethylpiperazin-1-yl]-2-(4-methoxyphenyl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-(1,4-diazepan-1-yl)-2-(4-methoxyphenyl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-7-(3,3-dimethylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-7-[(3R)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-7-(4-ethylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-(1,4-diazepan-1-yl)-2-(3,4-dimethoxyphenyl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-7-(4-methyl-1,4-diazepan-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4-methoxyphenyl)-7-[(3S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-7-(4-methylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-7-[(3R,5S)-3,5-dimethylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-7-(4-propylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4-methoxyphenyl)-7-(4-methyl-1,4-diazepan-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-(3,3-dimethylpiperazin-1-yl)-2-(4-methoxyphenyl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(1,3-benzodioxol-5-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(1,3-benzodioxol-5-yl)-7-(4-methylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(1,3-benzodioxol-5-yl)-7-[(3R)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(1,3-benzodioxol-5-yl)-7-[(3R,5S)-3,5-dimethylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3-methoxyphenyl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3-methoxyphenyl)-7-(4-methylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3-methoxyphenyl)-7-[(3R)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 7-[(3R,5S)-3,5-dimethylpiperazin-1-yl]-2-(3-methoxyphenyl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-(4-ethylpiperazin-1-yl)-2-(3-methoxyphenyl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-(1,4-diazepan-1-yl)-2-(3-methoxyphenyl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3-methoxyphenyl)-7-(4-methyl-1,4-diazepan-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(6-methylimidazo[1,2-a]pyridin-2-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-7-[(3S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2,3-dihydro-1,4-benzodioxin-6-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2,3-dihydro-1,4-benzodioxin-6-yl)-7-[(3S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-phenyl-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-[(3S)-3-methylpiperazin-1-yl]-2-phenyl-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2,3-dihydro-1,4-benzodioxin-6-yl)-7-[(3R)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2,3-dihydro-1,4-benzodioxin-6-yl)-7-(3,3-dimethylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2,3-dihydro-1,4-benzodioxin-6-yl)-7-[(3R,5S)-3,5-dimethylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 7-(1,4-diazepan-1-yl)-2-(2,3-dihydro-1,4-benzodioxin-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2,3-dihydro-1,4-benzodioxin-6-yl)-7-(4-methyl-1,4-diazepan-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-9-fluoro-7-(4-methylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3-chlorophenyl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4-chlorophenyl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-(piperazin-1-yl)-2-[3-(trifluoromethyl)phenyl]-4H-pyrido[1,2-a]pyrimidin-4-one 7-(piperazin-1-yl)-2-[4-(trifluoromethyl)phenyl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3-methylphenyl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4-fluorophenyl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4-nitrophenyl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-9-fluoro-7-(piperidin-4-ylamino)-4H-pyrido[1,2-a]pyrimidin-4-one 2-[4-(dimethylamino)phenyl]-9-fluoro-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-[4-(dimethylamino)phenyl]-9-fluoro-7-[(3R)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2-fluorophenyl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 3-(3,4-dimethoxyphenyl)-8-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-[4-(dimethylamino)phenyl]-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-[4-(dimethylamino)phenyl]-7-[(3S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethylphenyl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethylphenyl)-7-[(3S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-[3-(dimethylamino)phenyl]-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-[3-(dimethylamino)phenyl]-7-[(3S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-[4-(difluoromethoxy)phenyl]-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-[4-(difluoromethoxy)phenyl]-7-[(3S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3-fluorophenyl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3-nitrophenyl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4-methylphenyl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2-fluoro-4,5-dimethoxyphenyl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2-fluoro-4,5-dimethoxyphenyl)-7-[(3S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 7-(3,8-diazabicyclo [3.2.1]oct-3-yl)-2-(3,4-dimethoxyphenyl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-[4-methoxy-3-(trifluoromethyl)phenyl]-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-[4-methoxy-3-(trifluoromethyl)phenyl]-7-[(3R)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-[4-methoxy-3-(trifluoromethyl)phenyl]-7-[(3S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-9-methoxy-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,5-difluoro-4-hydroxyphenyl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3-fluoro-4-methoxyphenyl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 4-[4-oxo-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-2-yl]benzonitrile 2-(6-methylimidazo[1,2-a]pyrazin-2-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(6-methylimidazo[1,2-a]pyrazin-2-yl)-7-[(3S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-[3-fluoro-5-(trifluoromethyl)phenyl]-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-[4-fluoro-3-(trifluoromethyl)phenyl]-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-[2-methoxy-3-(trifluoromethyl)phenyl]-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,5-difluorophenyl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-(piperazin-1-yl)-2-[3-(trifluoromethoxy)phenyl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-[4-methoxy-3-(trifluoromethoxy)phenyl]-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-[4-hydroxy-3-(trifluoromethoxy)phenyl]-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-[4-methoxy-3-(trifluoromethoxy)phenyl]-7-[(3S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-[4-hydroxy-3-(trifluoromethoxy)phenyl]-7-[(3S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-4-oxo-7-(piperazin-1-yl)-4H-quinolizine-1-carbonitrile 2-(3-fluoro-4-methoxyphenyl)-7-[(3R)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3-fluoro-4-methoxyphenyl)-7-[(3S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(6-methoxypyridin-3-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2,4-dimethoxyphenyl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2,4-dimethoxyphenyl)-7-[(3S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-7-[(3S)-3-methylpiperazin-1-yl]-4H-quinolizin-4-one 2-(5-fluoropyridin-3-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(5-fluoropyridin-3-yl)-7-[(3S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(5-chloropyridin-3-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(5-chloropyridin-3-yl)-7-[(3S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(5-chloro-6-methoxypyridin-3-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(1H-indol-6-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(1H-indol-5-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-[3-(difluoromethoxy)-4-methoxyphenyl]-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-[3-(difluoromethoxy)-4-hydroxyphenyl]-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-[3-(difluoromethoxy)-4-methoxyphenyl]-7-[(3S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-[3-(difluoromethoxy)-4-hydroxyphenyl]-7-[(3S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3-fluoro-4-methoxyphenyl)-7-(piperazin-1-yl)-4H-quinolizin-4-one 2-(3-fluoro-4-methoxyphenyl)-7-[(3S)-3-methylpiperazin-1-yl]-4H-quinolizin-4-one 2-(3,5-difluorophenyl)-7-[(3S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-7-(piperazin-1-yl)-4H-quinolizin-4-one 2-(imidazo[1,2-a]pyridin-7-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(imidazo[1,2-a]pyridin-6-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2-methylimidazo[1,2-a]pyridin-6-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3-chloro-4-methoxyphenyl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3-chloro-4-methoxyphenyl)-7-[(3S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3-ethoxy-4-methoxyphenyl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3-ethoxy-4-methoxyphenyl)-7-[(3S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2-methylimidazo[1,2-a]pyridin-6-yl)-7-(4-methylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2-methylimidazo[1,2-a]pyridin-6-yl)-7-[(3S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 7-(1,4-diazepan-1-yl)-2-(2-methylimidazo[1,2-a]pyridin-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-[(3R,5S)-3,5-dimethylpiperazin-1-yl]-2-(2-methylimidazo[1,2-a]pyridin-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(6,8-dimethylimidazo[1,2-a]pyrazin-2-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(6,8-dimethylimidazo[1,2-a]pyrazin-2-yl)-7-[(3S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[(3S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-7-(2-methylpyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-(piperazin-1-yl)-2-[2-(trifluoromethyl)imidazo[1,2-a]pyridin-6-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2-ethylimidazo[1,2-a]pyridin-6-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2,3-dimethylimidazo[1,2-a]pyridin-6-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-7-[(3aR,6aS)-hexahydropyrrolo[3,4-c]pyrrol-2(1H)-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 7-(4-aminopiperidin-1-yl)-2-(3,4-dimethoxyphenyl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-(piperazin-1-yl)-2-(1H-pyrrolo[2,3-b]pyridin-5-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(1-methyl-1H-pyrrolo[2,3-b]pyridin-5-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-[(3R,5S)-3,5-dimethylpiperazin-1-yl]-2-(1-methyl-1H-pyrrolo[2,3-b]pyridin-5-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-[(3R,5S)-3,5-dimethylpiperazin-1-yl]-2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-(1,4-diazepan-1-yl)-2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2-methyl-1,3-benzoxazol-6-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2-methyl-1,3-benzoxazol-6-yl)-7-[(3S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2-methyl-1,3-benzothiazol-5-yl)-7-[(3S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2-methyl-1,3-benzothiazol-5-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2-methyl-2H-indazol-5-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2-methyl-2H-indazol-5-yl)-7-[(3S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3-fluoro-5-methoxyphenyl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3-fluoro-5-methoxyphenyl)-7-[(3S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2,8-dimethylimidazo[1,2-a]pyridin-6-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-9-methyl-7-[(3S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-7-(1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-7-(piperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3-fluoro-4,5-dimethoxyphenyl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-7-(4-hydroxypiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-7-[(3S)-3-(dimethylamino)pyrrolidin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-7-[4-(dimethylamino)piperidin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4-methoxy-3-methylphenyl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 3-[4-oxo-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-2-yl]benzonitrile 2-methoxy-5-[4-oxo-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-2-yl]benzonitrile 2-(3-fluoro-4-hydroxyphenyl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4-ethoxy-3-fluorophenyl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-[3-fluoro-4-(2,2,2-trifluoroethoxy)phenyl]-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2-methyl-1,3-benzoxazol-5-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2-methyl-1,3-benzoxazol-5-yl)-7-[(3S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3-fluoro-4-methylphenyl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3-fluoro-4-methylphenyl)-7-[(3S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 7-[(3S)-3-aminopyrrolidin-1-yl]-2-(3,4-dimethoxyphenyl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-9-methyl-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-(1,4-diazepan-1-yl)-2-(2-methyl-1,3-benzothiazol-5-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-[(3S)-3-methylpiperazin-1-yl]-2-(4-methyl-1,3-thiazol-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4-methyl-1,3-thiazol-2-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-7-(1-methylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-7-[(3S)-3-(propan-2-ylamino)pyrrolidin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3-fluoro-4-methoxyphenyl)-7-(4-methyl-1,4-diazepan-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4-methoxy-3-nitrophenyl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-[3-fluoro-4-(methylsulfanyl)phenyl]-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-(4-methyl-1,4-diazepan-1-yl)-2-(2-methylimidazo[1,2-a]pyridin-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-(4-methylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2-methyl-1,3-benzoxazol-6-yl)-7-(4-methylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-[(3R,5S)-3,5-dimethylpiperazin-1-yl]-2-(2-methyl-1,3-benzoxazol-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(5-fluoro-6-methoxypyridin-3-yl)-7-[(3S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 7-[(3R,5S)-3,5-dimethylpiperazin-1-yl]-2-(5-fluoro-6-methoxypyridin-3-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-[(3R,5S)-3,5-dimethylpiperazin-1-yl]-2-(2-methyl-1,3-benzothiazol-5-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2-methyl-1,3-benzothiazol-5-yl)-7-(4-methylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2-methyl-1,3-benzothiazol-5-yl)-7-(4-methyl-1,4-diazepan-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-[(8aS)-hexahydropyrrolo[1,2-a]pyrazin-2(1H)-yl]-2-(2-methyl-1,3-benzothiazol-5-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4-methyl-1H-imidazol-1-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4-methyl-1H-imidazol-1-yl)-'7-[(3S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-7-{[2-(methylamino)ethyl]amino}-4H-pyrido[1,2-a]pyrimidin-4-one 2-(5-fluoro-6-methoxypyridin-3-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,5-difluoro-4-methoxyphenyl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,5-difluoro-4-methoxyphenyl)-7-[(3S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 7-[4-(dimethylamino)piperidin-1-yl]-2-(3-fluoro-4-methoxyphenyl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3-fluoro-4-methoxyphenyl)-7-(1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-7-(piperidin-4-ylamino)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-7-(1-methyl-1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3-chloro-5-fluorophenyl)-7-[(3S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3-chloro-5-fluorophenyl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-[(3S)-3-methylpiperazin-1-yl]-2-(1-methyl-1H-pyrazol-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(1-methyl-1H-pyrazol-4-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2-methyl-1,3-benzoxazol-6-yl)-7-[(3R)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 7-(3,3-dimethylpiperazin-1-yl)-2-(2-methyl-1,3-benzoxazol-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-(1,4-diazepan-1-yl)-2-(2-methyl-1,3-benzoxazol-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2-methyl-1,3-benzoxazol-6-yl)-7-(4-methyl-1,4-diazepan-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-[(8aS)-hexahydropyrrolo[1,2-a]pyrazin-2(1H)-yl]-2-(2-methyl-1,3-benzoxazol-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-[(8aR)-hexahydropyrrolo[1,2-a]pyrazin-2(1H)-yl]-2-(2-methyl-1,3-benzoxazol-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4,5-dimethoxypyridin-2-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-[3-(dimethylamino)pyrrolidin-1-yl]-2-(3-fluoro-4-methoxyphenyl)-4H-quinolizin-4-one 7-(4-aminopiperidin-1-yl)-2-(3-fluoro-4-methoxyphenyl)-4H-quinolizin-4-one 7-(4-ethylpiperazin-1-yl)-2-(2-methyl-1,3-benzoxazol-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-[4-(dimethylamino)piperidin-1-yl]-2-(3-fluoro-4-methoxyphenyl)-4H-quinolizin-4-one 2-(3-fluoro-4-methoxyphenyl)-7-(1-methyl-1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-[(3S)-3-(dimethylamino)pyrrolidin-1-yl]-2-(3-fluoro-4-methoxyphenyl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-[(3R,4R)-3-(dimethylamino)-4-hydroxypyrrolidin-1-yl]-2-(3-fluoro-4-methoxyphenyl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-(4-aminopiperidin-1-yl)-2-(3-fluoro-4-methoxyphenyl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3-fluoro-4-methoxyphenyl)-7-[4-(methylamino)piperidin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-[(3R,5S)-3,5-dimethylpiperazin-1-yl]-2-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-(4-methyl-1,4-diazepan-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3-fluoro-4-methoxyphenyl)-7-[(3aR,6aS)-hexahydropyrrolo[3,4-c]pyrrol-2(1H)-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3-fluoro-4-methoxyphenyl)-7-[(3aR,6aS)-5-methylhexahydropyrrolo[3,4-c]pyrrol-2(1H)-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-7-[1-(2-hydroxyethyl)piperidin-4-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4-fluoro-3-methoxyphenyl)-7-[(3S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4-fluoro-3-methoxyphenyl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-difluoro-5-methoxyphenyl)-7-[(3S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-difluoro-5-methoxyphenyl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2-methyl-1,3-benzothiazol-6-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-(3-fluoro-4-methoxyphenyl)-2-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2-methyl-1,3-benzothiazol-6-yl)-7-[(3S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3-fluoro-4-methoxyphenyl)-7-[(3S)-3-(methylamino)pyrrolidin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3-fluoro-4-methoxyphenyl)-7-{4-[(methylamino)methyl]piperidin-1-yl}-4H-pyrido[1,2-a]pyrimidin-4-one 7-[(3S)-3-aminopyrrolidin-1-yl]-2-(3-fluoro-4-methoxyphenyl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3-fluoro-4-methoxyphenyl)-7-{[(3R)-1-methylpyrrolidin-3-yl]amino}-4H-pyrido[1,2-a]pyrimidin-4-one 7-{4-[(dimethylamino)methyl]piperidin-1-yl}-2-(3-fluoro-4-methoxyphenyl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(6-methoxypyridin-2-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-(piperazin-1-yl)-2-(pyridin-3-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(5-methoxypyridin-3-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 3-fluoro-5-{7-[(3S)-3-methylpiperazin-1-yl]-4-oxo-4H-pyrido[1,2-a]pyrimidin-2-yl}benzonitrile 3-fluoro-5-[4-oxo-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-2-yl]benzonitrile 2-(3-fluoro-4-methoxyphenyl)-7-[(3′S,4′S)-4′-hydroxy-1,3′-bipyrrolidin-1′-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3-fluoro-4-methoxyphenyl)-7-{methyl[(3R)-pyrrolidin-3-yl]amino}-4H-pyrido[1,2-a]pyrimidin-4-one 7-[(3S)-3,4-dimethylpiperazin-1-yl]-2-(2-methyl-1,3-benzoxazol-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-7-[(1-methylpiperidin-4-yl)oxy]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-7-[(3S)-pyrrolidin-3-yloxy]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-7-(piperidin-4-yloxy)-4H-pyrido[1,2-a]pyrimidin-4-one 7-(1,4-diazepan-1-yl)-2-(3,4-dimethoxyphenyl)-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3-fluoro-4-methoxyphenyl)-7-{methyl[(3R)-1-methylpyrrolidin-3-yl]amino}-4H-pyrido[1,2-a]pyrimidin-4-one 7-[4-(dimethylamino)piperidin-1-yl]-2-(2-methyl-1,3-benzoxazol-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-[(3S)-3-(dimethylamino)pyrrolidin-1-yl]-2-(2-methyl-1,3-benzoxazol-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-(4-aminopiperidin-1-yl)-2-(2-methyl-1,3-benzoxazol-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-[(3aR,6aS)-hexahydropyrrolo[3,4-c]pyrrol-2(1H)-yl]-2-(2-methyl-1,3-benzoxazol-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-[(3R)-3,4-dimethylpiperazin-1-yl]-2-(2-methyl-1,3-benzoxazol-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-7-(1,2,3,6-tetrahydropyridin-4-yl)-4H-quinolizin-4-one 2-(3-fluoro-4-methoxyphenyl)-7-[(3aR,6aR)-1-methylhexahydropyrrolo[3,4-b]pyrrol-5(1H)-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-9-methyl-7-(1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-7-[1-(2-hydroxyethyl)-1,2,3,6-tetrahydropyridin-4-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-7-(1-methyl-1,2,3,6-tetrahydropyridin-4-yl)-4H-quinolizin-4-one 2-(3,4-dimethoxyphenyl)-9-methyl-7-(piperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-9-methyl-7-(1-methyl-1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-9-methyl-7-(1-methylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-(1,4-diazepan-1-yl)-2-(2-methyl-1,3-benzothiazol-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2-methyl-1,3-benzothiazol-6-yl)-7-(4-methyl-1,4-diazepan-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-[(8aS)-hexahydropyrrolo[1,2-a]pyrazin-2(1H)-yl]-2-(2-methyl-1,3-benzothiazol-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2-methyl-1,3-benzothiazol-6-yl)-7-(4-methylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-7-[(3aR,6aS)-hexahydropyrrolo[3,4-c]pyrrol-2(1H)-yl]-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one 7-[(3S)-3,4-dimethylpiperazin-1-yl]-2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[(3R,5S)-3,4,5-trimethylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-9-methyl-7-[(3aR,6aS)-5-methylhexahydropyrrolo[3,4-c]pyrrol-2(1H)-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-7-[4-(dimethylamino)piperidin-1-yl]-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one 7-[(1R,5S)-8-azabicyclo [3.2.1]oct-2-en-3-yl]-2-(3,4-dimethoxyphenyl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-7-(1,2,5,6-tetrahydropyridin-3-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-[(3R)-3-(dimethylamino)pyrrolidin-1-yl]-2-(2-methyl-1,3-benzoxazol-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2-ethyl-1,3-benzoxazol-6-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2-ethyl-1,3-benzoxazol-6-yl)-7-[(3S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2-methyl-1,3-benzoxazol-6-yl)-7-[(3aR,6aS)-5-methylhexahydropyrrolo[3,4-c]pyrrol-2(1H)-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 7-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-2-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-(4-methylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[(3R)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[(8aS)-hexahydropyrrolo[1,2-a]pyrazin-2(1H)-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[(8aR)-hexahydropyrrolo[1,2-a]pyrazin-2(1H)-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 7-(4-aminopiperidin-1-yl)-2-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-[(3R)-3-(dimethylamino)pyrrolidin-1-yl]-2-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-[(3S)-3-(dimethylamino)pyrrolidin-1-yl]-2-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4-aminopiperidin-1-yl)-7-(3-fluoro-4-methoxyphenyl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-[(3R)-3-(dimethylamino)pyrrolidin-1-yl]-7-(3-fluoro-4-methoxyphenyl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-[(3S)-3-(dimethylamino)pyrrolidin-1-yl]-7-(3-fluoro-4-methoxyphenyl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3-fluoro-4-methoxyphenyl)-7-[(3aR,6aS)-5-(2-hydroxyethyl)hexahydropyrrolo[3,4-c]pyrrol-2(1H)-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3-fluoro-4-methoxyphenyl)-7-[(3aS,6aS)-1-methylhexahydropyrrolo[3,4-b]pyrrol-5(1H)-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3-fluoro-4-methoxyphenyl)-7-[(3aR,6aS)-5-(propan-2-yl)hexahydropyrrolo[3,4-c]pyrrol-2(1H)-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 7-[(3R)-3-(dimethylamino)pyrrolidin-1-yl]-2-(3-fluoro-4-methoxyphenyl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-(3,3-dimethylpiperazin-1-yl)-2-(2-methyl-1,3-benzothiazol-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-[(8aR)-hexahydropyrrolo[1,2-a]pyrazin-2(1H)-yl]-2-(2-methyl-1,3-benzothiazol-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-[4-(dimethylamino)piperidin-1-yl]-2-(2-methyl-1,3-benzothiazol-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2-methyl-1,3-benzothiazol-6-yl)-7-(piperidin-4-yloxy)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[(3R,5S)-3,5-dimethylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-(4-methyl-1,4-diazepan-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[(3R)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[(3S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[(8aR)-hexahydropyrrolo[1,2-a]pyrazin-2(1H)-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[(8aS)-hexahydropyrrolo[1,2-a]pyrazin-2(1H)-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 7-(3-fluoro-4-methoxyphenyl)-2-(1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-[(3S)-3,4-dimethylpiperazin-1-yl]-2-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-[(3R)-3,4-dimethylpiperazin-1-yl]-2-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-[4-(dimethylamino)piperidin-1-yl]-2-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-[4-(dimethylamino)piperidin-1-yl]-7-(3-fluoro-4-methoxyphenyl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4-fluoro-2-methyl-1,3-benzoxazol-6-yl)-7-(1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4-fluoro-2-methyl-1,3-benzoxazol-6-yl)-7-(1-methyl-1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3-fluoro-4-methoxyphenyl)-7-[(4aR,7aR)-octahydro-6H-pyrrolo[3,4-b]pyridin-6-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2-methyl-1,3-benzoxazol-6-yl)-7-(1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2-methyl-1,3-benzoxazol-6-yl)-7-(1-methyl-1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-(1-ethyl-1,2,3,6-tetrahydropyridin-4-yl)-2-(2-methyl-1,3-benzoxazol-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4-fluoro-2-methyl-1,3-benzoxazol-6-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4-fluoro-2-methyl-1,3-benzoxazol-6-yl)-7-[(3S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 7-[(3S)-3,4-dimethylpiperazin-1-yl]-2-(4-fluoro-2-methyl-1,3-benzoxazol-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4-fluoro-2-methyl-1,3-benzoxazol-6-yl)-7-(4-methylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-(4-ethylpiperazin-1-yl)-2-(4-fluoro-2-methyl-1,3-benzoxazol-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4-fluoro-2-methyl-1,3-benzoxazol-6-yl)-7-(4-propylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-[(3aR,6aS)-5-ethylhexahydropyrrolo[3,4-c]pyrrol-2(1H)-yl]-2-(3-fluoro-4-methoxyphenyl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3-fluoro-4-methoxyphenyl)-9-methyl-7-(1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3-fluoro-4-methoxyphenyl)-7-[(4aR,7aR)-1-methyloctahydro-6H-pyrrolo[3,4-b]pyridin-6-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-9-methyl-7-[(3R)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3-fluoro-4-methoxyphenyl)-9-methyl-7-(1-methyl-1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-(3-fluoro-4-methoxyphenyl)-2-(piperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-(3-fluoro-4-methoxyphenyl)-2-(1-methylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-(1-ethyl-1,2,3,6-tetrahydropyridin-4-yl)-2-(4-fluoro-2-methyl-1,3-benzoxazol-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4-fluoro-2-methyl-1,3-benzoxazol-6-yl)-7-(1-propyl-1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-7-[(1R,5S)-8-methyl-8-azabicyclo [3.2.1]oct-3-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-7-[(2R)-2-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2-methyl-1,3-benzoxazol-6-yl)-7-[(3S)-3-methylpiperazin-1-yl]-4H-quinolizin-4-one 2-(2-methyl-1,3-benzoxazol-6-yl)-7-(4-methylpiperazin-1-yl)-4H-quinolizin-4-one 7-[(3S)-4-ethyl-3-methylpiperazin-1-yl]-2-(2-methyl-1,3-benzoxazol-6-yl)-4H-quinolizin-4-one 7-[(3S)-3,4-dimethylpiperazin-1-yl]-2-(2-methyl-1,3-benzoxazol-6-yl)-4H-quinolizin-4-one 7-(4-aminopiperidin-1-yl)-2-(2-methyl-1,3-benzoxazol-6-yl)-4H-quinolizin-4-one 2-(3-fluoro-4-methoxyphenyl)-9-methyl-7-[(3S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 7-[4-(dimethylamino)piperidin-1-yl]-2-(3-fluoro-4-methoxyphenyl)-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3-fluoro-4-methoxyphenyl)-9-methyl-7-(1-methylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-[4-(cyclopropylamino)piperidin-1-yl]-2-(3,4-dimethoxyphenyl)-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one 2-(8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[(3S)-3,4-dimethylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-7-[(3R,5S)-3,5-dimethylpiperazin-1-yl]-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-7-[(3R)-3,4-dimethylpiperazin-1-yl]-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-(4-methyl-1,4-diazepan-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[(3R)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[(8aS)-hexahydropyrrolo[1,2-a]pyrazin-2(1H)-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[(8aR)-hexahydropyrrolo[1,2-a]pyrazin-2(1H)-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-(4-ethylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-[4-(dimethylamino)piperidin-1-yl]-2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-(3,3-dimethylpiperazin-1-yl)-2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-(4-cyclopropylpiperazin-1-yl)-2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-(1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[(3R)-4-ethyl-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-9-methyl-7-(4-methylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-7-[4-(dimethylamino)piperidin-1-yl]-9-ethyl-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-7-[1-(2-hydroxyethyl)-1,2,3,6-tetrahydropyridin-4-yl]-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one 7-[4-(dimethylamino)piperidin-1-yl]-2-(2-methyl-1,3-benzothiazol-5-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-(4-aminopiperidin-1-yl)-2-(2-methyl-1,3-benzothiazol-5-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-[(3aR,6aS)-hexahydropyrrolo[3,4-c]pyrrol-2(1H)-yl]-2-(2-methyl-1,3-benzothiazol-5-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-(1-methyl-1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-(1-ethyl-1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-(1-propyl-1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-7-(1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrimido[1,2-a]pyrimidin-4-one 7-(1-cyclopropyl-1,2,3,6-tetrahydropyridin-4-yl)-2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[1-(propan-2-yl)-1,2,3,6-tetrahydropyridin-4-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 7-(1-cyclobutyl-1,2,3,6-tetrahydropyridin-4-yl)-2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[1-(oxetan-3-yl)-1,2,3,6-tetrahydropyridin-4-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-9-methyl-7-[4-(methylamino)piperidin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-7-[4-(ethylamino)piperidin-1-yl]-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-8-methyl-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-7-[4-(propan-2-ylamino)piperidin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 7-(1-cyclobutyl-1,2,3,6-tetrahydropyridin-4-yl)-2-(3,4-dimethoxyphenyl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-7-[1-(propan-2-yl)-1,2,3,6-tetrahydropyridin-4-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-7-[1-(oxetan-3-yl)-1,2,3,6-tetrahydropyridin-4-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-7-(1-propyl-1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-7-[4-(methylamino)cyclohex-1-en-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-7-[4-(dimethylamino)cyclohex-1-en-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-7-{4-[ethyl(methyl)amino]cyclohex-1-en-1-yl}-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-7-{4-[methyl(propyl)amino]cyclohex-1-en-1-yl}-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-7-(1-ethyl-1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-(3,4-dimethoxyphenyl)-2-(1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-2-(1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[4-(propan-2-yl)piperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[4-(propan-2-yl)piperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 7-(2-methylimidazo[1,2-a]pyridin-6-yl)-2-(1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-(2-methylimidazo[1,2-a]pyridin-6-yl)-2-(1-methyl-1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-(3,4-dimethoxyphenyl)-2-(1-methyl-1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-9-methyl-7-(1-propyl-1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-(1-cyclobutyl-1,2,3,6-tetrahydropyridin-4-yl)-2-(3,4-dimethoxyphenyl)-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2-methyl-1,3-benzothiazol-6-yl)-7-(piperidin-4-yl)-4H-pyrimido[1,2-b]pyridazin-4-one 7-(4-aminopiperidin-1-yl)-2-(2-methyl-1,3-benzothiazol-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-(3-aminopyrrolidin-1-yl)-2-(2-methyl-1,3-benzothiazol-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-[(3R)-3-(dimethylamino)pyrrolidin-1-yl]-2-(2-methyl-1,3-benzothiazol-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2-methyl-1,3-benzothiazol-6-yl)-7-(1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[4-(2-methoxyethyl)piperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-9-methyl-7-[1-(oxetan-3-yl)-1,2,3,6-tetrahydropyridin-4-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-9-methyl-7-[1-(propan-2-yl)-1,2,3,6-tetrahydropyridin-4-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-7-(1-ethyl-1,2,3,6-tetrahydropyridin-4-yl)-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-8-methyl-7-(1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-(1-cyclopropyl-1,2,3,6-tetrahydropyridin-4-yl)-2-(3,4-dimethoxyphenyl)-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-8-methyl-7-(1-methyl-1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2-methyl-1,3-benzothiazol-6-yl)-7-(1-methyl-1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-[1-(2-hydroxyethyl)-1,2,3,6-tetrahydropyridin-4-yl]-2-(2-methyl-1,3-benzothiazol-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2-methyl-1,3-benzothiazol-6-yl)-7-[1-(propan-2-yl)-1,2,3,6-tetrahydropyridin-4-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 7-(1-cyclopropyl-1,2,3,6-tetrahydropyridin-4-yl)-2-(2-methyl-1,3-benzothiazol-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-(1-ethyl-1,2,3,6-tetrahydropyridin-4-yl)-2-(2-methyl-1,3-benzothiazol-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-[(3R)-3,4-dimethylpiperazin-1-yl]-2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-7-(1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrimido[1,2-b]pyridazin-4-one 7-[(1S,4S)-2,5-diazabicyclo [2.2.1]hept-2-yl]-2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[(1S,4S)-5-methyl-2,5-diazabicyclo[2.2.1]hept-2-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[(1S,4S)-5-ethyl-2,5-diazabicyclo[2.2.1]hept-2-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-7-(1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrazino [1,2-a]pyrimidin-4-one 2-(3-fluoro-4-methoxyphenyl)-7-(piperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-7-(1-ethylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-7-[cis-4-(methylamino)cyclohexyl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-7-(piperidin-3-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-9-methyl-7-[4-(propylamino)piperidin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-9-ethyl-7-(1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-(2-methylimidazo[1,2-a]pyridin-6-yl)-2-(piperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-2-(piperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-2-(1-methyl-1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-(4-cyclopropylpiperazin-1-yl)-2-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(1,3-dimethylpyrrolo[1,2-a]pyrazin-7-yl)-7-(1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrazino[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-7-[(8aR)-hexahydropyrrolo[1,2-a]pyrazin-2(1H)-yl]-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-9-ethyl-7-(1-methyl-1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-9-methyl-7-[4-(propan-2-ylamino)piperidin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-7-[(8aS)-hexahydropyrrolo[1,2-a]pyrazin-2(1H)-yl]-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-9-ethyl-7-(1-ethyl-1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-9-methyl-7-[4-(morpholin-4-yl)piperidin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2-methyl-1,3-benzoxazol-6-yl)-7-(1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrazino [1,2-a]pyrimidin-4-one hydrochloride (1:1) 2-(2-methyl-1,3-benzoxazol-6-yl)-7-(1-methyl-1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrazino[1,2-a]pyrimidin-4-one 7-(1-ethyl-1,2,3,6-tetrahydropyridin-4-yl)-2-(2-methyl-1,3-benzoxazol-6-yl)-4H-pyrazino[1,2-a]pyrimidin-4-one 2-(2-methyl-1,3-benzothiazol-6-yl)-7-(piperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[4-(pyrrolidin-1-yl)piperidin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 7-(1,4′-bipiperidin-1′-yl)-2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[4-(4-methylpiperazin-1-yl)piperidin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[4-(morpholin-4-yl)piperidin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2-methylimidazo[1,2-a]pyridin-6-yl)-7-(1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2-methylimidazo[1,2-a]pyridin-6-yl)-7-(1-methyl-1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-(1-ethyl-1,2,3,6-tetrahydropyridin-4-yl)-2-(2-methylimidazo[1,2-a]pyridin-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-[4-(dimethylamino)piperidin-1-yl]-2-(2-methylimidazo[1,2-a]pyridin-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-7-{4-[(2-hydroxyethyl)amino]piperidin-1-yl}-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-9-ethyl-7-(1-methylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-[4-(diethylamino)piperidin-1-yl]-2-(3,4-dimethoxyphenyl)-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-9-ethyl-7-(1-ethylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2-methylimidazo[1,2-a]pyridin-6-yl)-7-[4-(pyrrolidin-1-yl)piperidin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2-methylimidazo[1,2-a]pyridin-6-yl)-7-(piperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2-methyl-1,3-benzothiazol-6-yl)-7-(1-methylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-(4-methylpiperazin-1-yl)-2-(6-methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-[(3S)-3-methylpiperazin-1-yl]-2-(6-methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-[(3R,5S)-3,5-dimethylpiperazin-1-yl]-2-(6-methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(1-methyl-1H-indazol-5-yl)-7-(1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-[6-(dimethylamino)pyridin-3-yl]-7-(1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-[4-(diethylamino)piperidin-1-yl]-2-(2-methylimidazo[1,2-a]pyridin-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-7-{4-[(2-hydroxyethyl)(methyl)amino]piperidin-1-yl}-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-9-ethyl-7-[(3R)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2-methylimidazo[1,2-a]pyridin-6-yl)-7-(1-methylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(1-methyl-1H-indazol-5-yl)-7-(1-methyl-1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-[6-(dimethylamino)pyridin-3-yl]-7-(1-methyl-1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-[4-(diethylamino)piperidin-1-yl]-2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-(piperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-(1-methylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-(1-ethylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-9-ethyl-7-[(8aR)-hexahydropyrrolo[1,2-a]pyrazin-2(1H)-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-7-{4-[(2-methoxyethyl)amino]piperidin-1-yl}-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-7-(4-methylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[(8aR)-hexahydropyrrolo[1,2-a]pyrazin-2(1H)-yl]-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one 7-[4-(dimethylamino)piperidin-1-yl]-2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one 7-(2-methylimidazo[1,2-a]pyridin-6-yl)-2-(1-methylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-(2-methylimidazo[1,2-a]pyridin-6-yl)-2-[1-(propan-2-yl)piperidin-4-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 7-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-2-(1-methylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-(1-ethyl-1,2,3,6-tetrahydropyridin-4-yl)-2-(1-methyl-1H-indazol-5-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(1-methyl-1H-indazol-5-yl)-7-(1-propyl-1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-[6-(dimethylamino)pyridin-3-yl]-7-(piperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-(4-ethylpiperazin-1-yl)-2-(6-methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-[(8aR)-hexahydropyrrolo[1,2-a]pyrazin-2(1H)-yl]-2-(6-methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-[4-(dimethylamino)piperidin-1-yl]-2-(6-methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-[4-(2-hydroxyethyl)piperazin-1-yl]-2-(6-methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2-methylimidazo[1,2-a]pyridin-6-yl)-7-(1-propylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-[1-(2-hydroxyethyl)-1,2,3,6-tetrahydropyridin-4-yl]-2-(1-methyl-1H-indazol-5-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-[(3R)-3-methylpiperazin-1-yl]-2-(6-methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-(1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2-methyl-2H-indazol-5-yl)-7-(1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(1-methyl-1H-indazol-5-yl)-7-(1-methylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2-methyl-2H-indazol-5-yl)-7-(1-methyl-1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-(1-ethyl-1,2,3,6-tetrahydropyridin-4-yl)-2-(2-methyl-2H-indazol-5-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-(1-ethylpiperidin-4-yl)-2-(2-methylimidazo[1,2-a]pyridin-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(1,3-dimethylpyrrolo[1,2-a]pyrazin-7-yl)-7-[1-(propan-2-yl)-1,2,3,6-tetrahydropyridin-4-yl]-4H-pyrazino[1,2-a]pyrimidin-4-one 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-7-(1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-7-(1-methyl-1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-(1-ethyl-1,2,3,6-tetrahydropyridin-4-yl)-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one 7-(1-cyclopropyl-1,2,3,6-tetrahydropyridin-4-yl)-2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one 2-(6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-(1-methyl-1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-(1-ethyl-1,2,3,6-tetrahydropyridin-4-yl)-2-(6-methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(5,7-dimethylfuro [2,3-c]pyridin-2-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(5,7-dimethylfuro [2,3-c]pyridin-2-yl)-7-(4-methylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(5,7-dimethylfuro [2,3-c]pyridin-2-yl)-7-[(3S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(1-methyl-1H-indazol-5-yl)-7-(4-methylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(1-methyl-1H-indazol-5-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-[4-(dimethylamino)piperidin-1-yl]-2-(1-methyl-1H-indazol-5-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-(4-methyl-1,4-diazepan-1-yl)-2-(1-methyl-1H-indazol-5-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-(1-ethyl-1,2,3,6-tetrahydropyridin-4-yl)-2-(2-methyl-1,3-benzoxazol-6-yl)-4H-pyrimido[1,2-b]pyridazin-4-one 2-(8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-(4-ethylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[(3R)-4-ethyl-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[(3S)-4-ethyl-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[(3R)-3-methyl-4-(propan-2-yl)piperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[(3S)-3-methyl-4-(propan-2-yl)piperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2-methyl-1,3-benzoxazol-6-yl)-7-(piperidin-4-yl)-4H-pyrimido[1,2-b]pyridazin-4-one 2-(2-methyl-1,3-benzoxazol-6-yl)-7-(1-methylpiperidin-4-yl)-4H-pyrimido[1,2-b]pyridazin-4-one 7-(1-ethylpiperidin-4-yl)-2-(2-methyl-1,3-benzoxazol-6-yl)-4H-pyrimido[1,2-b]pyridazin-4-one 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-(piperidin-4-yl)-4H-pyrazino[1,2-a]pyrimidin-4-one 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-(1-methylpiperidin-4-yl)-4H-pyrazino[1,2-a]pyrimidin-4-one 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-(1-ethylpiperidin-4-yl)-4H-pyrazino [1,2-a]pyrimidin-4-one 2-(1-methyl-1H-indazol-5-yl)-7-(1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrazino [1,2-a]pyrimidin-4-one 2-(1-methyl-1H-indazol-5-yl)-7-(1-methyl-1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrazino[1,2-a]pyrimidin-4-one 7-(1-ethyl-1,2,3,6-tetrahydropyridin-4-yl)-2-(1-methyl-1H-indazol-5-yl)-4H-pyrazino[1,2-a]pyrimidin-4-one 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-(4-ethylpiperazin-1-yl)-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-7-[(3R)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 7-[(3R)-3,4-dimethylpiperazin-1-yl]-2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[(3R)-4-ethyl-3-methylpiperazin-1-yl]-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-(piperidin-4-yl)-4H-pyrimido[1,2-b]pyridazin-4-one 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-(1-methylpiperidin-4-yl)-4H-pyrimido[1,2-b]pyridazin-4-one 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-(1-ethylpiperidin-4-yl)-4H-pyrimido[1,2-b]pyridazin-4-one 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-(octahydro-5H-pyrrolo[3,2-c]pyridin-5-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-(piperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-(1-methylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-(1-ethylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[1-(propan-2-yl)piperidin-4-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-7-(4-methyl-1,4-diazepan-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2-methyl-2H-indazol-5-yl)-7-(piperidin-4-yl)-4H-pyrimido[1,2-b]pyridazin-4-one 2-(2-methyl-2H-indazol-5-yl)-7-(1-methylpiperidin-4-yl)-4H-pyrimido[1,2-b]pyridazin-4-one 7-(1-ethylpiperidin-4-yl)-2-(2-methyl-2H-indazol-5-yl)-4H-pyrimido[1,2-b]pyridazin-4-one 2-(8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-(1-methylpiperidin-4-yl)-4H-pyrimido[1,2-b]pyridazin-4-one 2-(8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-(1-ethylpiperidin-4-yl)-4H-pyrimido[1,2-b]pyridazin-4-one 2-(8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[1-(2-hydroxyethyl)piperidin-4-yl]-4H-pyrimido[1,2-b]pyridazin-4-one 2-(5,7-dimethylfuro [2,3-c]pyridin-2-yl)-7-[(3R,5S)-3,5-dimethylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 7-[4-(dimethylamino)piperidin-1-yl]-2-(5,7-dimethylfuro [2,3-c]pyridin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(5,7-dimethylfuro [2,3-c]pyridin-2-yl)-7-[4-(2-hydroxyethyl)piperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[1-(2-hydroxyethyl)piperidin-4-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[4-(2-hydroxyethyl)piperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[(3R)-4-(2-hydroxyethyl)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[(3S)-4-(2-methoxyethyl)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-{(3S)-4-[2-(2-hydroxyethoxy)ethyl]-3-methylpiperazin-1-yl}-4H-pyrido[1,2-a]pyrimidin-4-one 2-(8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[(3S)-4-cyclopropyl-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[(3S)-4-cyclobutyl-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[(3S)-4-(2-hydroxyethyl)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[(3S)-4-(2-methoxyethyl)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[(3S)-4-(2-hydroxyethyl)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-{(3S)-4-[2-(2-hydroxyethoxy)ethyl]-3-methylpiperazin-1-yl}-4H-pyrido[1,2-a]pyrimidin-4-one 2-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[(3S)-3-methyl-4-(propan-2-yl)piperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 7-[(3S)-4-cyclopropyl-3-methylpiperazin-1-yl]-2-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-[(3S)-4-cyclobutyl-3-methylpiperazin-1-yl]-2-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-(3,3-dimethylpiperazin-1-yl)-2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one 2-(1-methyl-1H-indazol-5-yl)-7-[(3R)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-(4-methylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-(4-ethylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-[4-(2-hydroxyethyl)piperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 7-[4-(dimethylamino)piperidin-1-yl]-2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-[4-(diethylamino)piperidin-1-yl]-2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-[(3R,5S)-3,5-dimethylpiperazin-1-yl]-2-(1-methyl-1H-indazol-5-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(1-methyl-1H-indazol-5-yl)-7-[(3S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2-methylimidazo[1,2-a]pyridin-6-yl)-7-[1-(propan-2-yl)piperidin-4-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2-methylimidazo[1,2-a]pyridin-7-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2-methylimidazo[1,2-a]pyridin-7-yl)-7-(piperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2-methylimidazo[1,2-a]pyridin-7-yl)-7-(4-methylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-(4-ethylpiperazin-1-yl)-2-(2-methylimidazo[1,2-a]pyridin-7-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2-methylimidazo[1,2-a]pyridin-7-yl)-7-(1-methylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-(1-ethylpiperidin-4-yl)-2-(2-methylimidazo[1,2-a]pyridin-7-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-7-[(3S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 7-[(3R,5S)-3,5-dimethylpiperazin-1-yl]-2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one 7-[(3S)-3,4-dimethylpiperazin-1-yl]-2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-7-[(3R,5S)-3,4,5-trimethylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2-methylimidazo[1,2-a]pyridin-6-yl)-7-[1-(propan-2-yl)-1,2,3,6-tetrahydropyridin-4-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2-methyl-2H-indazol-5-yl)-7-(piperidin-4-yl)-4H-pyrazino[1,2-a]pyrimidin-4-one 2-(2-methyl-2H-indazol-5-yl)-7-(1-methylpiperidin-4-yl)-4H-pyrazino [1,2-a]pyrimidin-4-one 7-(1-ethylpiperidin-4-yl)-2-(2-methyl-2H-indazol-5-yl)-4H-pyrazino [1,2-a]pyrimidin-4-one 7-[1-(2-hydroxyethyl)piperidin-4-yl]-2-(2-methyl-2H-indazol-5-yl)-4H-pyrazino [1,2-a]pyrimidin-4-one 7-{4-[(dimethylamino)methyl]piperidin-1-yl}-2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[4-(pyrrolidin-1-ylmethyl)piperidin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[4-(piperidin-1-ylmethyl)piperidin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-7-{4-[(dimethylamino)methyl]piperidin-1-yl}-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-7-[4-(pyrrolidin-1-ylmethyl)piperidin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(3,4-dimethoxyphenyl)-7-[4-(piperidin-1-ylmethyl)piperidin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 7-[1-(2-hydroxyethyl)piperidin-4-yl]-2-(2-methylimidazo[1,2-a]pyridin-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-[1-(2-hydroxyethyl)-1,2,3,6-tetrahydropyridin-4-yl]-2-(2-methylimidazo[1,2-a]pyridin-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2-methyl-2H-indazol-5-yl)-7-(1-methylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2-methylimidazo[1,2-a]pyridin-6-yl)-7-(1-methylpiperidin-4-yl)-4H-pyrazino [1,2-a]pyrimidin-4-one 7-(1-ethylpiperidin-4-yl)-2-(2-methylimidazo[1,2-a]pyridin-6-yl)-4H-pyrazino [1,2-a]pyrimidin-4-one 7-[1-(2-hydroxyethyl)piperidin-4-yl]-2-(2-methylimidazo[1,2-a]pyridin-6-yl)-4H-pyrazino [1,2-a]pyrimidin-4-one 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-{4-[(2-hydroxyethyl)(methyl)amino]piperidin-1-yl}-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-7-[4-(propylamino)piperidin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 7-(4-amino-4-methylpiperidin-1-yl)-2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2-methylimidazo[1,2-a]pyridin-6-yl)-7-(piperidin-4-yl)-4H-pyrazino [1,2-a]pyrimidin-4-one 2-(2-methyl-2H-indazol-5-yl)-7-(piperazin-1-yl)-4H-pyrazino[1,2-a]pyrimidin-4-one 2-(8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-(piperidin-4-yl)-4H-pyrazino [1,2-a]pyrimidin-4-one 2-(2,8-dimethylimidazo[1,2-a]pyridin-6-yl)-7-(piperidin-4-yl)-4H-pyrazino [1,2-a]pyrimidin-4-one 2-(2-methyl-2H-indazol-5-yl)-7-(4-methylpiperazin-1-yl)-4H-pyrazino [1,2-a]pyrimidin-4-one 7-(4-ethylpiperazin-1-yl)-2-(2-methyl-2H-indazol-5-yl)-4H-pyrazino [1,2-a]pyrimidin-4-one 7-[4-(2-hydroxyethyl)piperazin-1-yl]-2-(2-methyl-2H-indazol-5-yl)-4H-pyrazino [1,2-a]pyrimidin-4-one 2-(2,8-dimethylimidazo[1,2-a]pyridin-6-yl)-7-(1-methylpiperidin-4-yl)-4H-pyrazino[1,2-a]pyrimidin-4-one 2-(2,8-dimethylimidazo[1,2-a]pyridin-6-yl)-7-(1-ethylpiperidin-4-yl)-4H-pyrazino [1,2-a]pyrimidin-4-one 2-(2,8-dimethylimidazo[1,2-a]pyridin-6-yl)-7-[1-(2-hydroxyethyl)piperidin-4-yl]-4H-pyrazino [1,2-a]pyrimidin-4-one 2-(8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[1-(propan-2-yl)piperidin-4-yl]-4H-pyrazino[1,2-a]pyrimidin-4-one 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[4-(ethylamino)piperidin-1-yl]-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one 7-{4-[bis(2-hydroxyethyl)amino]piperidin-1-yl}-2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one 7-[1-(2-hydroxyethyl)piperidin-4-yl]-2-(2-methyl-1,3-benzoxazol-6-yl)-4H-pyrimido[1,2-b]pyridazin-4-one 2-(8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[1-(2-hydroxyethyl)piperidin-4-yl]-4H-pyrazino[1,2-a]pyrimidin-4-one 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[1-(oxetan-3-yl)piperidin-4-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(5,7-dimethylfuro [2,3-c]pyridin-2-yl)-7-(4-ethylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-(1-methyloctahydro-5H-pyrrolo[3,2-c]pyridin-5-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(1-methyl-1H-indazol-5-yl)-7-(piperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-(1-ethylpiperidin-4-yl)-2-(1-methyl-1H-indazol-5-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-[1-(2-hydroxyethyl)piperidin-4-yl]-2-(1-methyl-1H-indazol-5-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2-methyl-2H-indazol-5-yl)-7-(piperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2,8-dimethylimidazo[1,2-a]pyridin-6-yl)-7-(piperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2-methyl-2H-indazol-5-yl)-7-[1-(propan-2-yl)piperidin-4-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-{4-[(2-hydroxyethyl)amino]piperidin-1-yl}-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-7-[4-(methylamino)piperidin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-7-[4-(propan-2-ylamino)piperidin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 7-(1-ethylpiperidin-4-yl)-2-(2-methyl-2H-indazol-5-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-[1-(2-hydroxyethyl)piperidin-4-yl]-2-(2-methyl-2H-indazol-5-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2,8-dimethylimidazo[1,2-a]pyridin-6-yl)-7-(1-methylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2,8-dimethylimidazo[1,2-a]pyridin-6-yl)-7-(1-ethylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2,8-dimethylimidazo[1,2-a]pyridin-6-yl)-7-[1-(propan-2-yl)piperidin-4-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2,8-dimethylimidazo[1,2-a]pyridin-6-yl)-7-[1-(2-hydroxyethyl)piperidin-4-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-(4-propylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-[4-(propan-2-yl)piperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 7-(4-cyclopropylpiperazin-1-yl)-2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-(4-cyclobutylpiperazin-1-yl)-2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-[4-(oxetan-3-yl)piperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-(1-ethyloctahydro-5H-pyrrolo[3,2-c]pyridin-5-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[1-(2-hydroxyethyl)octahydro-5H-pyrrolo[3,2-c]pyridin-5-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4-methoxy-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-(4-methylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4-hydroxy-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-(4-methylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2-methylimidazo[1,2-a]pyridin-6-yl)-7-[1-(propan-2-yl)piperidin-4-yl]-4H-pyrazino[1,2-a]pyrimidin-4-one 7-(1-cyclobutylpiperidin-4-yl)-2-(2-methylimidazo[1,2-a]pyridin-6-yl)-4H-pyrazino[1,2-a]pyrimidin-4-one 7-[(3R)-3,4-dimethylpiperazin-1-yl]-2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-[(3R)-4-ethyl-3-methylpiperazin-1-yl]-2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-[(3R)-3-methyl-4-propylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-[(3R)-4-(2-hydroxyethyl)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 7-[(3R,5S)-3,5-dimethylpiperazin-1-yl]-2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-[4-(pyrrolidin-1-yl)piperidin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-[(3S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-(4-methyl-1,4-diazepan-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(8-ethyl-2-methylimidazo[1,2-a]pyridin-6-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(8-ethyl-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[(3R)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(8-ethyl-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[(3S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[1-(propan-2-yl)piperidin-4-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 7-(1-cyclopropylpiperidin-4-yl)-2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-(1-cyclobutylpiperidin-4-yl)-2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-[(3R)-3-methyl-4-(propan-2-yl)piperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 7-[(3R)-4-cyclopropyl-3-methylpiperazin-1-yl]-2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-[(3R)-4-cyclobutyl-3-methylpiperazin-1-yl]-2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-[(3R)-3-methyl-4-(oxetan-3-yl)piperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(8-ethyl-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[4-(2-hydroxyethyl)piperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 7-(4-cyclobutylpiperazin-1-yl)-2-(8-ethyl-2-methylimidazo[1,2-a]pyridin-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(8-ethyl-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[(3R)-4-(2-hydroxyethyl)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 7-[(3R)-4-cyclobutyl-3-methylpiperazin-1-yl]-2-(8-ethyl-2-methylimidazo[1,2-a]pyridin-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(8-ethyl-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[(3S)-4-(2-hydroxyethyl)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 7-[(3S)-4-cyclobutyl-3-methylpiperazin-1-yl]-2-(8-ethyl-2-methylimidazo[1,2-a]pyridin-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-(piperidin-4-yl)-4H-pyrazino [1,2-a]pyrimidin-4-one 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-(1-methylpiperidin-4-yl)-4H-pyrazino[1,2-a]pyrimidin-4-one 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-(1-ethylpiperidin-4-yl)-4H-pyrazino[1,2-a]pyrimidin-4-one 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-(piperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-(1-methylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-(1-ethylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-[1-(2-hydroxyethyl)piperidin-4-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-(1-propylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-[(3R)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[1-(2-fluoroethyl)piperidin-4-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[1-(3-fluoropropyl)piperidin-4-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-[4-(2-fluoroethyl)piperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-[4-(3-fluoropropyl)piperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-[(3R)-4-(2-fluoroethyl)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-[(3R)-4-(3-fluoropropyl)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-[1-(2-fluoroethyl)piperidin-4-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-[1-(3-fluoropropyl)piperidin-4-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-{(3R)-4-[2-(2-hydroxyethoxy)ethyl]-3-methylpiperazin-1-yl}-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-7-(piperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-7-(1-methylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[(3R)-4-(2-hydroxyethyl)-3-methylpiperazin-1-yl]-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one 2-[8-(hydroxymethyl)-2-methylimidazo[1,2-a]pyridin-6-yl]-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-[(3R,5S)-3,5-dimethylpiperazin-1-yl]-2-(8-ethyl-2-methylimidazo[1,2-a]pyridin-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(8-ethyl-2-methylimidazo[1,2-a]pyridin-6-yl)-7-(4-methyl-1,4-diazepan-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-[8-(hydroxymethyl)-2-methylimidazo[1,2-a]pyridin-6-yl]-7-(4-methylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-(4-ethylpiperazin-1-yl)-2-[8-(hydroxymethyl)-2-methylimidazo[1,2-a]pyridin-6-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-[1-(propan-2-yl)piperidin-4-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 7-(1-cyclopropylpiperidin-4-yl)-2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-(1-cyclobutylpiperidin-4-yl)-2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-[1-(oxetan-3-yl)piperidin-4-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4-cyclopropyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4-cyclopropyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-(4-methylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4-cyclopropyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-(4-ethylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4-cyclopropyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-[4-(2-hydroxyethyl)piperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-(1-propylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-[4-(dimethylamino)-6-methylpyrazolo[1,5-a]pyrazin-2-yl]-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2-methyl-1H-benzimidazol-6-yl)-7-(4-methylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-(4-ethylpiperazin-1-yl)-2-(2-methyl-1H-benzimidazol-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2,8-dimethylimidazo[1,2-a]pyridin-6-yl)-7-(piperidin-4-yl)-4H-pyrimido[1,2-b]pyridazin-4-one 2-(2-methylimidazo[1,2-a]pyridin-6-yl)-7-(piperidin-4-yl)-4H-pyrimido[1,2-b]pyridazin-4-one 7-[1-(2,2-dimethyl-1,3-dioxan-5-yl)piperidin-4-yl]-2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-[1-(1,3-dihydroxypropan-2-yl)piperidin-4-yl]-2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-[(3R,5S)-3,5-dimethylpiperazin-1-yl]-2-(1,3-dimethylpyrrolo[1,2-a]pyrazin-7-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(8-ethyl-2-methylimidazo[1,2-a]pyridin-6-yl)-7-(piperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(8-ethyl-2-methylimidazo[1,2-a]pyridin-6-yl)-7-(1-methylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(8-ethyl-2-methylimidazo[1,2-a]pyridin-6-yl)-7-(1-ethylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(8-ethyl-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[1-(2-hydroxyethyl)piperidin-4-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 7-[(3R)-3,4-dimethylpiperazin-1-yl]-2-(8-ethyl-2-methylimidazo[1,2-a]pyridin-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(8-ethyl-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[(3R)-4-ethyl-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-(1-ethylpiperidin-4-yl)-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[1-(2-hydroxyethyl)piperidin-4-yl]-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one 7-(1-cyclobutylpiperidin-4-yl)-2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one 9-methyl-2-(2-methyl-2H-indazol-5-yl)-7-(1-methylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-[4-(dimethylamino)-4-methylpiperidin-1-yl]-2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[4-(ethylamino)-4-methylpiperidin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[4-methyl-4-(propylamino)piperidin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-{4-[(2-hydroxyethyl)amino]-4-methylpiperidin-1-yl}-4H-pyrido[1,2-a]pyrimidin-4-one 7-(1-cyclobutylpiperidin-4-yl)-9-methyl-2-(2-methyl-2H-indazol-5-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-[1-(2-hydroxyethyl)piperidin-4-yl]-9-methyl-2-(2-methyl-2H-indazol-5-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-7-(1-propylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(1,3-dimethylpyrrolo[1,2-a]pyrazin-7-yl)-7-[(3R)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(8-cyclopropyl-2-methylimidazo[1,2-a]pyridin-6-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(8-cyclopropyl-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[(3R)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(8-cyclopropyl-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[(3S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(8-cyclopropyl-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[(3R,5S)-3,5-dimethylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 7-(1-cyclopropylpiperidin-4-yl)-9-methyl-2-(2-methyl-2H-indazol-5-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-(1-ethylpiperidin-4-yl)-9-methyl-2-(2-methyl-2H-indazol-5-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 9-methyl-2-(2-methyl-2H-indazol-5-yl)-7-(piperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[(1-methylpiperidin-4-yl)oxy]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(6-methyl-4-propylpyrazolo[1,5-a]pyrazin-2-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-(4-methylpiperazin-1-yl)-2-(6-methyl-4-propylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-(4-ethylpiperazin-1-yl)-2-(6-methyl-4-propylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-[4-(2-hydroxyethyl)piperazin-1-yl]-2-(6-methyl-4-propylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-[(3R)-3-methylpiperazin-1-yl]-2-(6-methyl-4-propylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-[(3S)-3-methylpiperazin-1-yl]-2-(6-methyl-4-propylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-[(3R,5S)-3,5-dimethylpiperazin-1-yl]-2-(6-methyl-4-propylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(1,3-dimethylpyrrolo[1,2-a]pyrazin-7-yl)-7-[(3R)-3-methyl-4-(propan-2-yl)piperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 7-(4-amino-4-methylpiperidin-1-yl)-2-(1,3-dimethylpyrrolo[1,2-a]pyrazin-7-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[(3S)-3-ethylpiperazin-1-yl]-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one 2-[2-methyl-8-(trifluoromethyl)imidazo[1,2-a]pyridin-6-yl]-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-[(3R)-3-methylpiperazin-1-yl]-2-[2-methyl-8-(trifluoromethyl)imidazo[1,2-a]pyridin-6-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 7-[(3S)-3-methylpiperazin-1-yl]-2-[2-methyl-8-(trifluoromethyl)imidazo[1,2-a]pyridin-6-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 7-[(3R,5S)-3,5-dimethylpiperazin-1-yl]-2-[2-methyl-8-(trifluoromethyl)imidazo[1,2-a]pyridin-6-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 7-(4-amino-4-methylpiperidin-1-yl)-2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2,7-dimethyl-2H-indazol-5-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2,7-dimethyl-2H-indazol-5-yl)-7-(piperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-(3-aminoprop-1-yn-1-yl)-2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2,7-dimethyl-2H-indazol-5-yl)-7-[(3R)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 7-(3-aminopropyl)-2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(1,3-dimethylpyrrolo[1,2-a]pyrazin-7-yl)-7-(1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-(2,2,6,6-tetramethyl-1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-(2,2,6,6-tetramethyl-1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[(3aR,6aS)-hexahydropyrrolo[3,4-c]pyrrol-2(1H)-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-[(3aR,6aS)-hexahydropyrrolo[3,4-c]pyrrol-2(1H)-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 7-[(3R,5S)-3,5-dimethylpiperazin-1-yl]-2-(1-ethyl-3-methylpyrrolo[1,2-a]pyrazin-7-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-(1,4-diazepan-1-yl)-2-(1-ethyl-3-methylpyrrolo[1,2-a]pyrazin-7-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2,7-dimethyl-2H-indazol-5-yl)-7-[(3S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2,7-dimethyl-2H-indazol-5-yl)-7-[(3S)-3,4-dimethylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2,7-dimethyl-2H-indazol-5-yl)-7-(1-methylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2,7-dimethyl-2H-indazol-5-yl)-7-(1-ethylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 9-methyl-2-(2-methyl-2H-indazol-5-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 9-methyl-2-(2-methyl-2H-indazol-5-yl)-7-[(3R)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 9-methyl-2-(2-methyl-2H-indazol-5-yl)-7-[(3S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 7-[3-(dimethylamino)azetidin-1-yl]-2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-[3-(diethylamino)azetidin-1-yl]-2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[3-(pyrrolidin-1-yl)azetidin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 7-(1,4-diazepan-1-yl)-2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-[(3aR,6aS)-hexahydropyrrolo[3,4-c]pyrrol-2(1H)-yl]-2-(6-methyl-4-propylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(6-methyl-4-propylpyrazolo[1,5-a]pyrazin-2-yl)-7-(1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-(1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-[(3S)-3-(aminomethyl)pyrrolidin-1-yl]-2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[3-(piperidin-1-yl)azetidin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(6-methyl-4-propylpyrazolo[1,5-a]pyrazin-2-yl)-7-(piperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-(2,7-diazaspiro[4.4]non-2-yl)-2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2,7-dimethyl-2H-indazol-5-yl)-7-(4-methylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-[3-(dimethylamino)propyl]-2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-{(3S)-3-[(dimethylamino)methyl]pyrrolidin-1-yl}-2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-7-(piperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 9-methyl-2-(1-methyl-1H-indazol-5-yl)-7-(piperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-7-(1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-7-(1-methylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(1,7-dimethyl-1H-indazol-5-yl)-7-(piperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(1,7-dimethyl-1H-indazol-5-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(1,7-dimethyl-1H-indazol-5-yl)-7-[(3S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 7-{(3S)-3-[(diethylamino)methyl]pyrrolidin-1-yl}-2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-{(3S)-3-[(ethylamino)methyl]pyrrolidin-1-yl}-4H-pyrido[1,2-a]pyrimidin-4-one 7-{3-[(dimethylamino)methyl]azetidin-1-yl}-2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-{3-[(diethylamino)methyl]azetidin-1-yl}-2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(1-ethyl-3-methylpyrrolo[1,2-a]pyrazin-7-yl)-7-[(8aS)-hexahydropyrrolo[1,2-a]pyrazin-2(1H)-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-7-[(3R)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 9-methyl-2-(1-methyl-1H-indazol-5-yl)-7-(1-methylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-[(3R)-3,4-dimethylpiperazin-1-yl]-2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one 7-(1-ethylpiperidin-4-yl)-9-methyl-2-(1-methyl-1H-indazol-5-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-7-[(3S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 7-[1-(2-hydroxyethyl)piperidin-4-yl]-9-methyl-2-(1-methyl-1H-indazol-5-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-[(3S)-3,4-dimethylpiperazin-1-yl]-2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-(1-ethylpiperidin-4-yl)-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one 9-methyl-2-(2-methyl-2H-indazol-5-yl)-7-(1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrazino[1,2-a]pyrimidin-4-one 7-(1-cyclobutylpiperidin-4-yl)-2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-[1-(2-hydroxyethyl)piperidin-4-yl]-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one 2-(8-ethyl-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[(8aR)-hexahydropyrrolo[1,2-a]pyrazin-2(1H)-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(8-ethyl-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[(8aS)-hexahydropyrrolo[1,2-a]pyrazin-2(1H)-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 9-methyl-2-(2-methyl-2H-indazol-5-yl)-7-(piperidin-4-yl)-4H-pyrazino [1,2-a]pyrimidin-4-one 7-[(3R)-3-(aminomethyl)pyrrolidin-1-yl]-2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[(2S,6S)-2,6-dimethyl-1,2,3,6-tetrahydropyridin-4-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 7-{(3R)-3-[(dimethylamino)methyl]pyrrolidin-1-yl}-2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-[(2S,6S)-2,6-dimethylpiperidin-4-yl]-2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[4-(2-hydroxyethyl)piperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(imidazo[1,2-a]pyridin-6-yl)-7-(4-methylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4-fluoro-2-methyl-1,3-benzoxazol-6-yl)-7-[(8aS)-hexahydropyrrolo[1,2-a]pyrazin-2(1H)-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 7-(2,7-diazaspiro[3.5]non-7-yl)-2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-(4-methylpiperazin-1-yl)-2-(2-methyl[1,2,4]triazolo[1,5-a]pyridin-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-(4-methylpiperazin-1-yl)-2-[2-methyl-8-(trifluoromethyl)imidazo[1,2-a]pyridin-6-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(6-methylimidazo[1,2-a]pyridin-2-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(6-methylimidazo[1,2-a]pyrazin-2-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(6-methylimidazo[1,2-a]pyrazin-2-yl)-7-[(3 S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(6-methoxypyridin-3-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(5-fluoropyridin-3-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(5-fluoropyridin-3-yl)-7-[(3 S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(5-chloropyridin-3-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(5-chloropyridin-3-yl)-7-[(3 S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(5-chloro-6-methoxypyridin-3-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(1H-indol-6-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(1H-indol-5-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(imidazo[1,2-a]pyridin-7-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(imidazo[1,2-a]pyridin-6-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2-methylimidazo[1,2-a]pyridin-6-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2-methylimidazo[1,2-a]pyridin-6-yl)-7-(4-methylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2-methylimidazo[1,2-a]pyridin-6-yl)-7-[(3 S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 7-(1,4-diazepan-1-yl)-2-(2-methylimidazo[1,2-a]pyridin-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(3R,5 S)-3,5-dimethylpiperazin-1-yl]-2-(2-methylimidazo[1,2-a]pyridin-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(6, 8-dimethylimidazo[1,2-a]pyrazin-2-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(6,8-dimethylimidazo[1,2-a]pyrazin-2-yl)-7-[(3 S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4, 6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4, 6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[(3 S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 7-(piperazin-1-yl)-2-[2-(trifluoromethyl)imidazo[1,2-a]pyridin-6-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2-ethylimidazo[1,2-a]pyridin-6-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2,3-dimethylimidazo[1,2-a]pyridin-6-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-(piperazin-1-yl)-2-(1H-pyrrolo[2,3-b]pyridin-5-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(1-methyl-1H-pyrrolo[2,3-b]pyridin-5-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(3R,5 S)-3,5-dimethylpiperazin-1-yl]-2-(1-methyl-1H-pyrrolo[2,3-b]pyridin-5-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(3R,5 S)-3,5-dimethylpiperazin-1-yl]-2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-(1,4-diazepan-1-yl)-2-(4,6-dimethylpyrazolo[1, 5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2-methyl-1,3-benzoxazol-6-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2-methyl-1,3-benzoxazol-6-yl)-7-[(3 S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2-methyl-1,3-benzothiazol-5-yl)-7-[(3 S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2-methyl-1,3-benzothiazol-5-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2-methyl-2H-indazol-5-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2-methyl-2H-indazol-5-yl)-7-[(3 S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2, 8-dimethylimidazo[1,2-a]pyridin-6-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2-methyl-1,3-benzoxazol-5-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2-methyl-1,3-benzoxazol-5-yl)-7-[(3 S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 7-(1,4-diazepan-1-yl)-2-(2-methyl-1,3-benzothiazol-5-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(3 S)-3-methylpiperazin-1-yl]-2-(4-methyl-1,3-thiazol-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4-methyl-1,3-thiazol-2-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-(4-methyl-1,4-diazepan-1-yl)-2-(2-methylimidazo[1,2-a]pyridin-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-(4-methylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2-methyl-1,3-benzoxazol-6-yl)-7-(4-methylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(3R,5 S)-3,5-dimethylpiperazin-1-yl]-2-(2-methyl-1,3-benzoxazol-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(5-fluoro-6-methoxypyridin-3-yl)-7-[(3 S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(3R,5 S)-3,5-dimethylpiperazin-1-yl]-2-(5-fluoro-6-methoxypyridin-3-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(3R,5 S)-3,5-dimethylpiperazin-1-yl]-2-(2-methyl-1,3-benzothiazol-5-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2-methyl-1,3-benzothiazol-5-yl)-7-(4-methylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2-methyl-1,3-benzothiazol-5-yl)-7-(4-methyl-1,4-diazepan-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(8aS)-hexahydropyrrolo[1,2-a]pyrazin-2(1H)-yl]-2-(2-methyl-1,3-benzothiazol-5-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4-methyl-1H-imidazol-1-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4-methyl-1H-imidazol-1-yl)-7-[(3 S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(5-fluoro-6-methoxypyridin-3-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(3 S)-3-methylpiperazin-1-yl]-2-(1-methyl-1H-pyrazol-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(1-methyl-1H-pyrazol-4-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2-methyl-1,3-benzoxazol-6-yl)-7-[(3R)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 7-(3,3-dimethylpiperazin-1-yl)-2-(2-methyl-1,3-benzoxazol-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-(1,4-diazepan-1-yl)-2-(2-methyl-1,3-benzoxazol-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2-methyl-1,3-benzoxazol-6-yl)-7-(4-methyl-1,4-diazepan-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(8aS)-hexahydropyrrolo[1,2-a]pyrazin-2(1H)-yl]-2-(2-methyl-1,3-benzoxazol-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(8aR)-hexahydropyrrolo[1,2-a]pyrazin-2(1H)-yl]-2-(2-methyl-1,3-benzoxazol-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,5-dimethoxypyridin-2-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-(4-ethylpiperazin-1-yl)-2-(2-methyl-1,3-benzoxazol-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(3R,5 S)-3,5-dimethylpiperazin-1-yl]-2-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-(4-methyl-1,4-diazepan-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2-methyl-1,3-benzothiazol-6-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2-methyl-1,3-benzothiazol-6-yl)-7-[(3 S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(6-methoxypyridin-2-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-(piperazin-1-yl)-2-(pyridin-3-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(5-methoxypyridin-3-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(3 S)-3,4-dimethylpiperazin-1-yl]-2-(2-methyl-1,3-benzoxazol-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[4-(dimethylamino)piperidin-1-yl]-2-(2-methyl-1,3-benzoxazol-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(3 S)-3-(dimethylamino)pyrrolidin-1-yl]-2-(2-methyl-1,3-benzoxazol-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-(4-aminopiperidin-1-yl)-2-(2-methyl-1,3-benzoxazol-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(3 aR,6aS)-hexahydropyrrolo[3,4-c]pyrrol-2(1H)-yl]-2-(2-methyl-1,3-benzoxazol-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(3R)-3,4-dimethylpiperazin-1-yl]-2-(2-methyl-1,3-benzoxazol-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-(1,4-diazepan-1-yl)-2-(2-methyl-1,3-benzothiazol-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2-methyl-1,3-benzothiazol-6-yl)-7-(4-methyl-1,4-diazepan-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(8aS)-hexahydropyrrolo[1,2-a]pyrazin-2(1H)-yl]-2-(2-methyl-1,3-benzothiazol-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2-methyl-1,3-benzothiazol-6-yl)-7-(4-methylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(3 S)-3,4-dimethylpiperazin-1-yl]-2-(4,6-dimethylpyrazolo[1, 5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[(3R,5 S)-3,4,5-trimethylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(3R)-3-(dimethylamino)pyrrolidin-1-yl]-2-(2-methyl-1,3-benzoxazol-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2-ethyl-1,3-benzoxazol-6-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2-ethyl-1,3-benzoxazol-6-yl)-7-[(3 S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2-methyl-1,3-benzoxazol-6-yl)-7-[(3 aR,6aS)-5-methylhexahydropyrrolo[3,4-c]pyrrol-2(1H)-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-(4-methylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[(3R)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[(8aS)-hexahydropyrrolo[1,2-a]pyrazin-2(1H)-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[(8aR)-hexahydropyrrolo[1,2-a]pyrazin-2(1H)-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 7-(4-aminopiperidin-1-yl)-2-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(3R)-3-(dimethylamino)pyrrolidin-1-yl]-2-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(3 S)-3-(dimethylamino)pyrrolidin-1-yl]-2-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-(3,3-dimethylpiperazin-1-yl)-2-(2-methyl-1,3-benzothiazol-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(8aR)-hexahydropyrrolo[1,2-a]pyrazin-2(1H)-yl]-2-(2-methyl-1,3-benzothiazol-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[4-(dimethylamino)piperidin-1-yl]-2-(2-methyl-1,3-benzothiazol-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2-methyl-1,3-benzothiazol-6-yl)-7-(piperidin-4-yloxy)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[(3R,5 S)-3,5-dimethylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-(4-methyl-1,4-diazepan-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[(3R)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[(3 S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[(8aR)-hexahydropyrrolo[1,2-a]pyrazin-2(1H)-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[(8aS)-hexahydropyrrolo[1,2-a]pyrazin-2(1H)-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(3 S)-3,4-dimethylpiperazin-1-yl]-2-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(3R)-3,4-dimethylpiperazin-1-yl]-2-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[4-(dimethylamino)piperidin-1-yl]-2-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4-fluoro-2-methyl-1,3-benzoxazol-6-yl)-7-(1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4-fluoro-2-methyl-1,3-benzoxazol-6-yl)-7-(1-methyl-1,2, 3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2-methyl-1,3-benzoxazol-6-yl)-7-(1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2-methyl-1,3-benzoxazol-6-yl)-7-(1-methyl-1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-(1-ethyl-1,2,3,6-tetrahydropyridin-4-yl)-2-(2-methyl-1,3-benzoxazol-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4-fluoro-2-methyl-1,3-benzoxazol-6-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4-fluoro-2-methyl-1,3-benzoxazol-6-yl)-7-[(3 S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(3 S)-3,4-dimethylpiperazin-1-yl]-2-(4-fluoro-2-methyl-1,3-benzoxazol-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4-fluoro-2-methyl-1,3-benzoxazol-6-yl)-7-(4-methylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-(4-ethylpiperazin-1-yl)-2-(4-fluoro-2-methyl-1,3-benzoxazol-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4-fluoro-2-methyl-1,3-benzoxazol-6-yl)-7-(4-propylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-(1-ethyl-1,2,3,6-tetrahydropyridin-4-yl)-2-(4-fluoro-2-methyl-1,3-benzoxazol-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4-fluoro-2-methyl-1,3-benzoxazol-6-yl)-7-(1-propyl-1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[(3 S)-3,4-dimethylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1, 5-a]pyrazin-2-yl)-7-(4-methyl-1,4-diazepan-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[(3R)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[(8aS)-hexahydropyrrolo[1,2-a]pyrazin-2(1H)-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[(8aR)-hexahydropyrrolo[1,2-a]pyrazin-2(1H)-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-(4-ethylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[4-(dimethylamino)piperidin-1-yl]-2-(4,6-dimethylpyrazolo[1, 5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-(3,3-dimethylpiperazin-1-yl)-2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-(4-cyclopropylpiperazin-1-yl)-2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-(1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[(3R)-4-ethyl-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[4-(dimethylamino)piperidin-1-yl]-2-(2-methyl-1,3-benzothiazol-5-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-(4-aminopiperidin-1-yl)-2-(2-methyl-1,3-benzothiazol-5-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(3 aR,6aS)-hexahydropyrrolo[3,4-c]pyrrol-2(1H)-yl]-2-(2-methyl-1,3-benzothiazol-5-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-(1-methyl-1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-(1-ethyl-1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-(1-propyl-1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-(1-cyclopropyl-1,2,3,6-tetrahydropyridin-4-yl)-2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[1-(propan-2-yl)-1,2,3,6-tetrahydropyridin-4-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 7-(1-cyclobutyl-1,2,3,6-tetrahydropyridin-4-yl)-2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[1-(oxetan-3-yl)-1,2,3,6-tetrahydropyridin-4-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[4-(propan-2-yl)piperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[4-(propan-2-yl)piperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 7-(4-aminopiperidin-1-yl)-2-(2-methyl-1,3-benzothiazol-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-(3-aminopyrrolidin-1-yl)-2-(2-methyl-1,3-benzothiazol-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(3R)-3-(dimethylamino)pyrrolidin-1-yl]-2-(2-methyl-1,3-benzothiazol-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2-methyl-1,3-benzothiazol-6-yl)-7-(1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[4-(2-methoxyethyl)piperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2-methyl-1,3-benzothiazol-6-yl)-7-(1-methyl-1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[1-(2-hydroxyethyl)-1,2,3,6-tetrahydropyridin-4-yl]-2-(2-methyl-1,3-benzothiazol-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2-methyl-1,3-benzothiazol-6-yl)-7-[1-(propan-2-yl)-1,2,3,6-tetrahydropyridin-4-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 7-(1-cyclopropyl-1,2,3,6-tetrahydropyridin-4-yl)-2-(2-methyl-1,3-benzothiazol-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-(1-ethyl-1,2,3,6-tetrahydropyridin-4-yl)-2-(2-methyl-1,3-benzothiazol-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(3R)-3,4-dimethylpiperazin-1-yl]-2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(1 S,4S)-2,5-diazabicyclo[2.2.1]hept-2-yl]-2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[(1 S,4S)-5-methyl-2,5-diazabicyclo[2.2.1]hept-2-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[(1 S,4S)-5-ethyl-2,5-diazabicyclo[2.2.1]hept-2-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 7-(4-cyclopropylpiperazin-1-yl)-2-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2-methyl-1,3-benzothiazol-6-yl)-7-(piperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[4-(pyrrolidin-1-yl)piperidin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 7-(1,4′-bipiperidin-1′-yl)-2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[4-(4-methylpiperazin-1-yl)piperidin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[4-(morpholin-4-yl)piperidin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2-methylimidazo[1,2-a]pyridin-6-yl)-7-(1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2-methylimidazo[1,2-a]pyridin-6-yl)-7-(1-methyl-1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-(1-ethyl-1,2,3,6-tetrahydropyridin-4-yl)-2-(2-methylimidazo[1,2-a]pyridin-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[4-(dimethylamino)piperidin-1-yl]-2-(2-methylimidazo[1,2-a]pyridin-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2-methylimidazo[1,2-a]pyridin-6-yl)-7-[4-(pyrrolidin-1-yl)piperidin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2-methylimidazo[1,2-a]pyridin-6-yl)-7-(piperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2-methyl-1,3-benzothiazol-6-yl)-7-(1-methylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-(4-methylpiperazin-1-yl)-2-(6-methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(3 S)-3-methylpiperazin-1-yl]-2-(6-methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(3R,5 S)-3,5-dimethylpiperazin-1-yl]-2-(6-methylpyrazolo[1, 5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(1-methyl-1H-indazol-5-yl)-7-(1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-[6-(dimethylamino)pyridin-3-yl]-7-(1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[4-(diethylamino)piperidin-1-yl]-2-(2-methylimidazo[1,2-a]pyridin-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2-methylimidazo[1,2-a]pyridin-6-yl)-7-(1-methylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(1-methyl-1H-indazol-5-yl)-7-(1-methyl-1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-[6-(dimethylamino)pyridin-3-yl]-7-(1-methyl-1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[4-(diethylamino)piperidin-1-yl]-2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-(piperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-(1-methylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-(1-ethylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-7-(4-methylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[(8aR)-hexahydropyrrolo[1,2-a]pyrazin-2(1H)-yl]-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[4-(dimethylamino)piperidin-1-yl]-2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one, 7-(1-ethyl-1,2,3,6-tetrahydropyridin-4-yl)-2-(1-methyl-1H-indazol-5-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(1-methyl-1H-indazol-5-yl)-7-(1-propyl-1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-[6-(dimethylamino)pyridin-3-yl]-7-(piperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-(4-ethylpiperazin-1-yl)-2-(6-methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(8aR)-hexahydropyrrolo[1,2-a]pyrazin-2(1H)-yl]-2-(6-methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[4-(dimethylamino)piperidin-1-yl]-2-(6-methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[4-(2-hydroxyethyl)piperazin-1-yl]-2-(6-methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2-methylimidazo[1,2-a]pyridin-6-yl)-7-(1-propylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[1-(2-hydroxyethyl)-1,2,3,6-tetrahydropyridin-4-yl]-2-(1-methyl-1H-indazol-5-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(3R)-3-methylpiperazin-1-yl]-2-(6-methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-(1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2-methyl-2H-indazol-5-yl)-7-(1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(1-methyl-1H-indazol-5-yl)-7-(1-methylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2-methyl-2H-indazol-5-yl)-7-(1-methyl-1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-(1-ethyl-1,2,3,6-tetrahydropyridin-4-yl)-2-(2-methyl-2H-indazol-5-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-(1-ethylpiperidin-4-yl)-2-(2-methylimidazo[1,2-a]pyridin-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(1,3-dimethylpyrrolo[1,2-a]pyrazin-7-yl)-7-[1-(propan-2-yl)-1,2,3,6-tetrahydropyridin-4-yl]-4H-pyrazino[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-7-(1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1, 5-a]pyrazin-2-yl)-9-methyl-7-(1-methyl-1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-(1-ethyl-1,2,3,6-tetrahydropyridin-4-yl)-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one, 7-(1-cyclopropyl-1,2,3,6-tetrahydropyridin-4-yl)-2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-(1-methyl-1,2, 3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-(1-ethyl-1,2,3,6-tetrahydropyridin-4-yl)-2-(6-methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(5,7-dimethylfuro[2,3-c]pyridin-2-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(5,7-dimethylfuro[2,3-c]pyridin-2-yl)-7-(4-methylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(5,7-dimethylfuro[2,3-c]pyridin-2-yl)-7-[(3 S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(1-methyl-1H-indazol-5-yl)-7-(4-methylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(1-methyl-1H-indazol-5-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[4-(dimethylamino)piperidin-1-yl]-2-(1-methyl-1H-indazol-5-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-(4-methyl-1,4-diazepan-1-yl)-2-(1-methyl-1H-indazol-5-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-(1-ethyl-1,2,3,6-tetrahydropyridin-4-yl)-2-(2-methyl-1,3-benzoxazol-6-yl)-4H-pyrimido[1,2-b]pyridazin-4-one, 2-(8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-(4-ethylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[(3R)-4-ethyl-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[(3 S)-4-ethyl-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[(3R)-3-methyl-4-(propan-2-yl)piperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[(3 S)-3-methyl-4-(propan-2-yl)piperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-(4-ethylpiperazin-1-yl)-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-7-[(3R)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(3R)-3,4-dimethylpiperazin-1-yl]-2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[(3R)-4-ethyl-3-methylpiperazin-1-yl]-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-(octahydro-5H-pyrrolo[3,2-c]pyridin-5-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-(piperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-(1-methylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-(1-ethylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[1-(propan-2-yl)piperidin-4-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1, 5-a]pyrazin-2-yl)-9-methyl-7-(4-methyl-1,4-diazepan-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(5,7-dimethylfuro[2,3-c]pyridin-2-yl)-7-[(3R,5 S)-3,5-dimethylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[4-(dimethylamino)piperidin-1-yl]-2-(5,7-dimethylfuro[2,3-c]pyridin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(5,7-dimethylfuro[2,3-c]pyridin-2-yl)-7-[4-(2-hydroxyethyl)piperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[1-(2-hydroxyethyl)piperidin-4-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[4-(2-hydroxyethyl)piperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[(3R)-4-(2-hydroxyethyl)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[(3 S)-4-(2-methoxyethyl)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-{(3 S)-4-[2-(2-hydroxyethoxy)ethyl]-3-methylpiperazin-1-yl}-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[(3 S)-4-cyclopropyl-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[(3 S)-4-cyclobutyl-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[(3 S)-4-(2-hydroxyethyl)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[(3 S)-4-(2-methoxyethyl)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[(3 S)-4-(2-hydroxyethyl)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-{(3 S)-4-[2-(2-hydroxyethoxy)ethyl]-3-methylpiperazin-1-yl}-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[(3 S)-3-methyl-4-(propan-2-yl)piperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(3 S)-4-cyclopropyl-3-methylpiperazin-1-yl]-2-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(3 S)-4-cyclobutyl-3-methylpiperazin-1-yl]-2-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-(3,3-dimethylpiperazin-1-yl)-2-(4,6-dimethylpyrazolo[1, 5-a]pyrazin-2-yl)-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(1-methyl-1H-indazol-5-yl)-7-[(3R)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-(4-methylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-(4-ethylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-[4-(2-hydroxyethyl)piperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[4-(dimethylamino)piperidin-1-yl]-2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[4-(diethylamino)piperidin-1-yl]-2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(3R,5 S)-3,5-dimethylpiperazin-1-yl]-2-(1-methyl-1H-indazol-5-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(1-methyl-1H-indazol-5-yl)-7-[(3 S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2-methylimidazo[1,2-a]pyridin-6-yl)-7-[1-(propan-2-yl)piperidin-4-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2-methylimidazo[1,2-a]pyridin-7-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2-methylimidazo[1,2-a]pyridin-7-yl)-7-(piperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2-methylimidazo[1,2-a]pyridin-7-yl)-7-(4-methylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-(4-ethylpiperazin-1-yl)-2-(2-methylimidazo[1,2-a]pyridin-7-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2-methylimidazo[1,2-a]pyridin-7-yl)-7-(1-methylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-(1-ethylpiperidin-4-yl)-2-(2-methylimidazo[1,2-a]pyridin-7-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-7-[(3 S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(3R,5 S)-3,5-dimethylpiperazin-1-yl]-2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(3 S)-3,4-dimethylpiperazin-1-yl]-2-(4,6-dimethylpyrazolo[1, 5-a]pyrazin-2-yl)-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-7-[(3R,5 S)-3,4,5-trimethylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2-methylimidazo[1,2-a]pyridin-6-yl)-7-[1-(propan-2-yl)-1,2,3,6-tetrahydropyridin-4-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 7-{4-[(dimethylamino)methyl]piperidin-1-yl}-2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[4-(pyrrolidin-1-ylmethyl)piperidin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[4-(piperidin-1-ylmethyl)piperidin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[1-(2-hydroxyethyl)piperidin-4-yl]-2-(2-methylimidazo[1,2-a]pyridin-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[1-(2-hydroxyethyl)-1,2,3,6-tetrahydropyridin-4-yl]-2-(2-methylimidazo[1,2-a]pyridin-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2-methyl-2H-indazol-5-yl)-7-(1-methylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-{4-[(2-hydroxyethyl)(methyl)amino]piperidin-1-yl}-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-7-[4-(propylamino)piperidin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 7-(4-amino-4-methylpiperidin-1-yl)-2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[4-(ethylamino)piperidin-1-yl]-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one, 7-{4-[bis(2-hydroxyethyl)amino]piperidin-1-yl}-2-(4,6-dimethylpyrazolo[1, 5-a]pyrazin-2-yl)-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[1-(oxetan-3-yl)piperidin-4-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(5,7-dimethylfuro[2,3-c]pyridin-2-yl)-7-(4-ethylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-(1-methyloctahydro-5H-pyrrolo[3,2-c]pyridin-5-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(1-methyl-1H-indazol-5-yl)-7-(piperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-(1-ethylpiperidin-4-yl)-2-(1-methyl-1H-indazol-5-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[1-(2-hydroxyethyl)piperidin-4-yl]-2-(1-methyl-1H-indazol-5-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2-methyl-2H-indazol-5-yl)-7-(piperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2, 8-dimethylimidazo[1,2-a]pyridin-6-yl)-7-(piperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2-methyl-2H-indazol-5-yl)-7-[1-(propan-2-yl)piperidin-4-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-{4-[(2-hydroxyethyl)amino]piperidin-1-yl}-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-7-[4-(methylamino)piperidin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-7-[4-(propan-2-ylamino)piperidin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 7-(1-ethylpiperidin-4-yl)-2-(2-methyl-2H-indazol-5-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[1-(2-hydroxyethyl)piperidin-4-yl]-2-(2-methyl-2H-indazol-5-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2,8-dimethylimidazo[1,2-a]pyridin-6-yl)-7-(1-methylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2, 8-dimethylimidazo[1,2-a]pyridin-6-yl)-7-(1-ethylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2, 8-dimethylimidazo[1,2-a]pyridin-6-yl)-7-[1-(propan-2-yl)piperidin-4-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2, 8-dimethylimidazo[1,2-a]pyridin-6-yl)-7-[1-(2-hydroxyethyl)piperidin-4-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-(4-propylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-[4-(propan-2-yl)piperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 7-(4-cyclopropylpiperazin-1-yl)-2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-(4-cyclobutylpiperazin-1-yl)-2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-[4-(oxetan-3-yl)piperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-(1-ethyloctahydro-5H-pyrrol o[3,2-c]pyridin-5-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[1-(2-hydroxyethyl)octahydro-5H-pyrrolo[3,2-c]pyridin-5-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4-methoxy-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-(4-methylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4-hydroxy-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-(4-methylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(3R)-3,4-dimethylpiperazin-1-yl]-2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(3R)-4-ethyl-3-methylpiperazin-1-yl]-2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-[(3R)-3-methyl-4-propylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-[(3R)-4-(2-hydroxyethyl)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(3R,5 S)-3,5-dimethylpiperazin-1-yl]-2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-[4-(pyrrolidin-1-yl)piperidin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-[(3 S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-(4-methyl-1,4-diazepan-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(8-ethyl-2-methylimidazo[1,2-a]pyridin-6-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(8-ethyl-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[(3R)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(8-ethyl-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[(3 S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[1-(propan-2-yl)piperidin-4-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 7-(1-cyclopropylpiperidin-4-yl)-2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-(1-cyclobutylpiperidin-4-yl)-2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-[(3R)-3-methyl-4-(propan-2-yl)piperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(3R)-4-cyclopropyl-3-methylpiperazin-1-yl]-2-(4-ethyl-6-methylpyrazolo[1, 5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(3R)-4-cyclobutyl-3-methylpiperazin-1-yl]-2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-[(3R)-3-methyl-4-(oxetan-3-yl)piperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(8-ethyl-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[4-(2-hydroxyethyl)piperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 7-(4-cyclobutylpiperazin-1-yl)-2-(8-ethyl-2-methylimidazo[1,2-a]pyridin-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(8-ethyl-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[(3R)-4-(2-hydroxyethyl)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(3R)-4-cyclobutyl-3-methylpiperazin-1-yl]-2-(8-ethyl-2-methylimidazo[1,2-a]pyridin-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(8-ethyl-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[(3 S)-4-(2-hydroxyethyl)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(3 S)-4-cyclobutyl-3-methylpiperazin-1-yl]-2-(8-ethyl-2-methylimidazo[1,2-a]pyridin-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-(piperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-(1-methylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-(1-ethylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-[1-(2-hydroxyethyl)piperidin-4-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-(1-propylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-[(3R)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[1-(2-fluoroethyl)piperidin-4-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[1-(3-fluoropropyl)piperidin-4-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-[4-(2-fluoroethyl)piperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-[4-(3-fluoropropyl)piperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-[(3R)-4-(2-fluoroethyl)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-[(3R)-4-(3-fluoropropyl)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-[1-(2-fluoroethyl)piperidin-4-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-[1-(3-fluoropropyl)piperidin-4-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-{(3R)-4-[2-(2-hydroxyethoxy)ethyl]-3-methylpiperazin-1-yl}-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-7-(piperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-7-(1-methylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[(3R)-4-(2-hydroxyethyl)-3-methylpiperazin-1-yl]-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one, 2-[8-(hydroxymethyl)-2-methylimidazo[1,2-a]pyridin-6-yl]-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(3R,5 S)-3,5-dimethylpiperazin-1-yl]-2-(8-ethyl-2-methylimidazo[1,2-a]pyridin-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(8-ethyl-2-methylimidazo[1,2-a]pyridin-6-yl)-7-(4-methyl-1,4-diazepan-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-[8-(hydroxymethyl)-2-methylimidazo[1,2-a]pyridin-6-yl]-7-(4-methylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-(4-ethylpiperazin-1-yl)-2-[8-(hydroxymethyl)-2-methylimidazo[1,2-a]pyridin-6-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-[1-(propan-2-yl)piperidin-4-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 7-(1-cyclopropylpiperidin-4-yl)-2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-(1-cyclobutylpiperidin-4-yl)-2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-[1-(oxetan-3-yl)piperidin-4-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4-cyclopropyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4-cyclopropyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-(4-methylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4-cyclopropyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-(4-ethylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4-cyclopropyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-[4-(2-hydroxyethyl)piperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-(1-propylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-[4-(dimethylamino)-6-methylpyrazolo[1,5-a]pyrazin-2-yl]-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2-methyl-1H-benzimidazol-6-yl)-7-(4-methylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-(4-ethylpiperazin-1-yl)-2-(2-methyl-1H-benzimidazol-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[1-(2,2-dimethyl-1,3-dioxan-5-yl)piperidin-4-yl]-2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[1-(1,3-dihydroxypropan-2-yl)piperidin-4-yl]-2-(4-ethyl-6-methylpyrazolo[1, 5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(3R,5 S)-3,5-dimethylpiperazin-1-yl]-2-(1,3-dimethylpyrrolo[1,2-a]pyrazin-7-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(8-ethyl-2-methylimidazo[1,2-a]pyridin-6-yl)-7-(piperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(8-ethyl-2-methylimidazo[1,2-a]pyridin-6-yl)-7-(1-methylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(8-ethyl-2-methylimidazo[1,2-a]pyridin-6-yl)-7-(1-ethylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(8-ethyl-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[1-(2-hydroxyethyl)piperidin-4-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(3R)-3,4-dimethylpiperazin-1-yl]-2-(8-ethyl-2-methylimidazo[1,2-a]pyridin-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(8-ethyl-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[(3R)-4-ethyl-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-(1-ethylpiperidin-4-yl)-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[1-(2-hydroxyethyl)piperidin-4-yl]-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one, 7-(1-cyclobutylpiperidin-4-yl)-2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one, 9-methyl-2-(2-methyl-2H-indazol-5-yl)-7-(1-methylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[4-(dimethylamino)-4-methylpiperidin-1-yl]-2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[4-(ethylamino)-4-methylpiperidin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[4-methyl-4-(propylamino)piperidin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-{4-[(2-hydroxyethyl)amino]-4-methylpiperidin-1-yl}-4H-pyrido[1,2-a]pyrimidin-4-one, 7-(1-cyclobutylpiperidin-4-yl)-9-methyl-2-(2-methyl-2H-indazol-5-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[1-(2-hydroxyethyl)piperidin-4-yl]-9-methyl-2-(2-methyl-2H-indazol-5-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-7-(1-propylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(1,3-dimethylpyrrolo[1,2-a]pyrazin-7-yl)-7-[(3R)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(8-cyclopropyl-2-methylimidazo[1,2-a]pyridin-6-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(8-cyclopropyl-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[(3R)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(8-cyclopropyl-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[(3 S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(8-cyclopropyl-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[(3R,5 S)-3, 5-dimethylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 7-(1-cyclopropylpiperidin-4-yl)-9-methyl-2-(2-methyl-2H-indazol-5-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-(1-ethylpiperidin-4-yl)-9-methyl-2-(2-methyl-2H-indazol-5-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 9-methyl-2-(2-methyl-2H-indazol-5-yl)-7-(piperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[(1-methylpiperidin-4-yl)oxy]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(6-methyl-4-propylpyrazolo[1,5-a]pyrazin-2-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-(4-methylpiperazin-1-yl)-2-(6-methyl-4-propylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-(4-ethylpiperazin-1-yl)-2-(6-methyl-4-propylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[4-(2-hydroxyethyl)piperazin-1-yl]-2-(6-methyl-4-propylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(3R)-3-methylpiperazin-1-yl]-2-(6-methyl-4-propylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(3 S)-3-methylpiperazin-1-yl]-2-(6-methyl-4-propylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(3R,5 S)-3,5-dimethylpiperazin-1-yl]-2-(6-methyl-4-propylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(1,3-dimethylpyrrolo[1,2-a]pyrazin-7-yl)-7-[(3R)-3-methyl-4-(propan-2-yl)piperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 7-(4-amino-4-methylpiperidin-1-yl)-2-(1,3-dimethylpyrrolo[1,2-a]pyrazin-7-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[(3 S)-3-ethylpiperazin-1-yl]-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one, 2-[2-methyl-8-(trifluoromethyl)imidazo[1,2-a]pyridin-6-yl]-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(3R)-3-methylpiperazin-1-yl]-2-[2-methyl-8-(trifluoromethyl)imidazo[1,2-a]pyridin-6-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(3 S)-3-methylpiperazin-1-yl]-2-[2-methyl-8-(trifluoromethyl)imidazo[1,2-a]pyridin-6-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(3R,5 S)-3,5-dimethylpiperazin-1-yl]-2-[2-methyl-8-(trifluoromethyl)imidazo[1,2-a]pyridin-6-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 7-(4-amino-4-methylpiperidin-1-yl)-2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2,7-dimethyl-2H-indazol-5-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2,7-dimethyl-2H-indazol-5-yl)-7-(piperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2,7-dimethyl-2H-indazol-5-yl)-7-[(3R)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 7-(3-aminopropyl)-2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(1,3-dimethylpyrrolo[1,2-a]pyrazin-7-yl)-7-(1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-(2,2,6,6-tetramethyl-1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-(2,2,6,6-tetramethyl-1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[(3 aR,6aS)-hexahydropyrrolo[3,4-c]pyrrol-2(1H)-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-[(3 aR,6aS)-hexahydropyrrolo[3,4-c]pyrrol-2(1H)-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(3R,5 S)-3,5-dimethylpiperazin-1-yl]-2-(1-ethyl-3-methylpyrrolo[1,2-a]pyrazin-7-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-(1,4-diazepan-1-yl)-2-(1-ethyl-3-methylpyrrolo[1,2-a]pyrazin-7-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2,7-dimethyl-2H-indazol-5-yl)-7[(3 S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2,7-dimethyl-2H-indazol-5-yl)-7-[(3 S)-3,4-dimethylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2,7-dimethyl-2H-indazol-5-yl)-7-(1-methylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2,7-dimethyl-2H-indazol-5-yl)-7-(1-ethylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 9-methyl-2-(2-methyl-2H-indazol-5-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 9-methyl-2-(2-methyl-2H-indazol-5-yl)-7-[(3R)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 9-methyl-2-(2-methyl-2H-indazol-5-yl)-7-[(3 S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[3-(dimethylamino)azetidin-1-yl]-2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[3-(diethylamino)azetidin-1-yl]-2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[3-(pyrrolidin-1-yl)azetidin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 7-(1,4-diazepan-1-yl)-2-(4-ethyl-6-methylpyrazolo[1, 5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(3 aR,6aS)-hexahydropyrrolo[3,4-c]pyrrol-2(1H)-yl]-2-(6-methyl-4-propylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(6-methyl-4-propylpyrazolo[1,5-a]pyrazin-2-yl)-7-(1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-(1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(3 S)-3-(aminomethyl)pyrrolidin-1-yl]-2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[3-(piperidin-1-yl)azetidin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(6-methyl-4-propylpyrazolo[1,5-a]pyrazin-2-yl)-7-(piperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-(2,7-diazaspiro[4.4]non-2-yl)-2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2,7-dimethyl-2H-indazol-5-yl)-7-(4-methylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-{(3 S)-3-[(dimethylamino)methyl]pyrrolidin-1-yl}-2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-7-(piperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 9-methyl-2-(1-methyl-1H-indazol-5-yl)-7-(piperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-7-(1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-7-(1-methylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(1,7-dimethyl-1H-indazol-5-yl)-7-(piperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(1,7-dimethyl-1H-indazol-5-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(1,7-dimethyl-1H-indazol-5-yl)-7-[(3 S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 7-{(3 S)-3-[(diethylamino)methyl]pyrrolidin-1-yl}-2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-{(3 S)-3-[(ethylamino)methyl]pyrrolidin-1-yl}-4H-pyrido[1,2-a]pyrimidin-4-one, 7-{3-[(dimethylamino)methyl]azetidin-1-yl}-2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-{3-[(diethylamino)methyl]azetidin-1-yl}-2-(4,6-dimethylpyrazolo[1, 5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(1-ethyl-3-methylpyrrolo[1,2-a]pyrazin-7-yl)-7-[(8aS)-hexahydropyrrolo[1,2-a]pyrazin-2(1H)-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-7-[(3R)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 9-methyl-2-(1-methyl-1H-indazol-5-yl)-7-(1-methylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(3R)-3,4-dimethylpiperazin-1-yl]-2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one, 7-(1-ethylpiperidin-4-yl)-9-methyl-2-(1-methyl-1H-indazol-5-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-7-[(3 S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[1-(2-hydroxyethyl)piperidin-4-yl]-9-methyl-2-(1-methyl-1H-indazol-5-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(3 S)-3,4-dimethylpiperazin-1-yl]-2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-(1-ethylpiperidin-4-yl)-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one, 7-(1-cyclobutylpiperidin-4-yl)-2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-[1-(2-hydroxyethyl)piperidin-4-yl]-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(8-ethyl-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[(8aR)-hexahydropyrrolo[1,2-a]pyrazin-2(1H)-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(8-ethyl-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[(8aS)-hexahydropyrrolo[1,2-a]pyrazin-2(1H)-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(3R)-3-(aminomethyl)pyrrolidin-1-yl]-2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[(2 S,6 S)-2,6-dimethyl-1,2,3,6-tetrahydropyridin-4-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 7-{(3R)-3-[(dimethylamino)methyl]pyrrolidin-1-yl}-2-(4,6-dimethylpyrazolo[1, 5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(2S,6S)-2,6-dimethylpiperidin-4-yl]-2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[4-(2-hydroxyethyl)piperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(imidazo[1,2-a]pyridin-6-yl)-7-(4-methylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4-fluoro-2-methyl-1,3-benzoxazol-6-yl)-7-[(8aS)-hexahydropyrrolo[1,2-a]pyrazin-2(1H)-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 7-(2,7-diazaspiro[3 0.5]non-7-yl)-2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-(4-methylpiperazin-1-yl)-2-(2-methyl[1,2,4]triazolo[1,5-a]pyridin-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-(4-methylpiperazin-1-yl)-2-[2-methyl-8-(trifluoromethyl)imidazo[1,2-a]pyridin-6-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-methyl-6-[7-(4-methylpiperazin-1-yl)-4-oxo-4H-pyrido[1,2-a]pyrimidin-2-yl]imidazo[1,2-a]pyridine-8-carbonitrile 2-(2,8-dimethylimidazo[1,2-a]pyridin-6-yl)-7-(4-methylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-(4,7-diazaspiro[2.5]oct-7-yl)-2-(2,8-dimethylimidazo[1,2-a]pyridin-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-(1-methylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-(4-hydroxypiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-[(8aS)-hexahydropyrrolo[1,2-a]pyrazin-2(1H)-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-[(8aR)-hexahydropyrrolo[1,2-a]pyrazin-2(1H)-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 7-[(3R)-3-(dimethylamino)pyrrolidin-1-yl]-2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-[(3S)-3-(dimethylamino)pyrrolidin-1-yl]-2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[(8aS)-8a-methylhexahydropyrrolo[1,2-a]pyrazin-2(1H)-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-(4-ethylpiperazin-1-yl)-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-[(8aS)-hexahydropyrrolo[1,2-a]pyrazin-2(1H)-yl]-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2,8-dimethylimidazo[1,2-a]pyridin-6-yl)-7-(4-ethylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2,8-dimethylimidazo[1,2-a]pyridin-6-yl)-7-[(8aS)-hexahydropyrrolo[1,2-a]pyrazin-2(1H)-yl]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(2,8-dimethylimidazo[1,2-a]pyridin-6-yl)-7-(8a-methylhexahydropyrrolo[1,2-a]pyrazin-2(1H)-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-[(3R)-3-(dimethylamino)pyrrolidin-1-yl]-2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-{[2-(morpholin-4-yl)ethyl]amino}-4H-pyrido[1,2-a]pyrimidin-4-one 7-{[2-(dimethylamino)ethyl]amino}-2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-{[2-(dimethylamino)ethyl](methyl)amino}-2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-{methyl[2-(methylamino)ethyl]amino}-4H-pyrido[1,2-a]pyrimidin-4-one 7-[(3R)-3-(dimethylamino)pyrrolidin-1-yl]-2-(2,8-dimethylimidazo[1,2-a]pyridin-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-[(3S)-3-(dimethylamino)pyrrolidin-1-yl]-2-(2,8-dimethylimidazo[1,2-a]pyridin-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 7-[2-(dimethylamino)ethoxy]-2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one 7-[2-(dimethylamino)ethoxy]-2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-(piperidin-4-ylmethoxy)-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-[2-(piperidin-1-yl)ethoxy]-4H-pyrido[1,2-a]pyrimidin-4-one 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-[3-(morpholin-4-yl)propoxy]-4H-pyrido[1,2-a]pyrimidin-4-one 7-[3-(dimethylamino)propoxy]-2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2, 8-dimethylimidazo[1,2-a]pyridin-6-yl)-7-(4-methylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-(4,7-diazaspiro[2.5]oct-7-yl)-2-(2,8-dimethylimidazo[1,2-a]pyridin-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-(1-methylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-(4-hydroxypiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-[(8aS)-hexahydropyrrolo[1,2-a]pyrazin-2(1H)-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-[(8 aR)-hexahydropyrrolo[1,2-a]pyrazin-2(1H)-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(3R)-3-(dimethylamino)pyrrolidin-1-yl]-2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(3 S)-3-(dimethylamino)pyrrolidin-1-yl]-2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[(8aS)-8a-methylhexahydropyrrolo[1,2-a]pyrazin-2(1H)-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-(4-ethylpiperazin-1-yl)-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-[(8aS)-hexahydropyrrolo[1,2-a]pyrazin-2(1H)-yl]-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2,8-dimethylimidazo[1,2-a]pyridin-6-yl)-7-(4-ethylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2,8-dimethylimidazo[1,2-a]pyridin-6-yl)-7-[(8aS)-hexahydropyrrolo[1,2-a]pyrazin-2(1H)-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2,8-dimethylimidazo[1,2-a]pyridin-6-yl)-7-(8a-methylhexahydropyrrolo[1,2-a]pyrazin-2(1H)-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(3R)-3-(dimethylamino)pyrrolidin-1-yl]-2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-{[2-(morpholin-4-yl)ethyl]amino}-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(3R)-3-(dimethylamino)pyrrolidin-1-yl]-2-(2,8-dimethylimidazo[1,2-a]pyridin-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(3 S)-3-(dimethylamino)pyrrolidin-1-yl]-2-(2, 8-dimethylimidazo[1,2-a]pyridin-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, or ~~2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[(3aR,6aS)-5-methylhexahydropyrrolo[3,4-c]pyrrol-2(1H)-yl]-4H-pyrido[1,2-a]pyrimidin-4-one~~ 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[(3aR,6aS)-5-methylhexahydropyrrolo[3,4-c]pyrrol-2(1H)-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, or a salt, isotopologue, stereoisomer, racemate, enantiomer, diastereomer or tautomer thereof.

not grantedpublished claim 8no counterpart in the grant

The compound of claim 7 , wherein the compound is selected from the group consisting of: 2-(3,5-difluoro-4-hydroxyphenyl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one hydrochloride 7-[4-(dimethylamino)piperidin-1-yl]-2-(3-fluoro-4-methoxyphenyl)-4H-quinolizin-4-one acetate 2-(2-methyl-1,3-benzothiazol-6-yl)-7-(piperidin-4-yl)-4H-pyrimido[1,2-b]pyridazin-4-one trifluoroacetate (1:1), or 2-(1,3-dimethylpyrrolo[1,2-a]pyrazin-7-yl)-7-(1,2,3,6-tetrahydropyridin-4-yl)-4H-pyrazino[1,2-a]pyrimidin-4-one hydrochloride (1:2) or a free base, isotopologue, stereoisomer, racemate, enantiomer, diastereomer or tautomer thereof.

addedgranted claim 10no counterpart in the publication

The compound of claim 1 , wherein R 1 is heterocyclyl selected from azetidinyl, tetrahydrofuranyl, pyrrolidinyl, piperidinyl, piperazinyl, 1,4-diazepanyl, 1,2,5,6-tetrahydropyridinyl, 1,2,3,6-tetrahydropyridinyl, hexahydropyrrolo[3,4-b]pyrrol-(1H)-yl, (3aS,6aS)-hexahydropyrrolo[3,4-b]pyrrol-(1H)-yl, (3aR,6aR)-hexahydropyrrolo[3,4-b]pyrrol-(1H)-yl, hexahydropyrrolo[3,4-b]pyrrol-(2H)-yl, (3aS,6aS)-hexahydropyrrolo[3,4-b]pyrrol-(2H)-yl, hexahydropyrrolo[3,4-c]pyrrol-(1H)-yl, (3aR,6aS)-hexahydropyrrolo[3,4-c]pyrrol-(1H)-yl, octahydro-5H-pyrrolo[3,2-c]pyridinyl, octahydro-6H-pyrrolo[3,4-b]pyridinyl, (4aR,7aR)-octahydro-6H-pyrrolo[3,4-b]pyridinyl, (4aS,7aS)-octahydro-6H-pyrrolo[3,4-b]pyridinyl, hexahydropyrrolo[1,2-a]pyrazin-(2H)-one, hexahydropyrrolo[1,2-a]pyrazin-(1H)-yl, (7R,8aS)-hexahydropyrrolo[1,2-a]pyrazin-(1H)-yl, (8aS)-hexahydropyrrolo[1,2-a]pyrazin-(1H)-yl, (8aR)-hexahydropyrrolo[1,2-a]pyrazin-(1H)-yl, (8aS)-octahydropyrrolo[1,2-a]pyrazin-(1H)-yl, (8aR)-octahydropyrrolo[1,2-a]pyrazin-(1H)-yl, octahydro-2H-pyrido[1,2-a]pyrazinyl, 3-azabicyclo[3.1.0]hexyl, (1R,5S)-3-azabicyclo[3.1.0]hexyl, 8-azabicyclo[3.2.1]octyl, (1R,5S)-8-azabicyclo[3.2.1]octyl, 8-azabicyclo[3.2.1]oct-2-enyl, (1R,5S)-8-azabicyclo[3.2.1]oct-2-enyl, 9-azabicyclo[3.3.1]nonyl, (1R,5S)-9-azabicyclo[3.3.1]nonyl, 2,5-diazabicyclo[2.2.1]heptyl, (1S,4S)-2,5-diazabicyclo[2.2.1]heptyl, 2,5-diazabicyclo[2.2.2]octyl, 3,8-diazabicyclo[3.2.1]octyl, (1R,5S)-3,8-diazabicyclo[3.2.1]octyl, 1,4-diazabicyclo[3.2.2]nonyl, azaspiro[3.3]heptyl, 2,6-diazaspiro[3.3]heptyl, 2,7-diazaspiro[3.5]nonyl, 5,8-diazaspiro[3.5]nonyl, 2,7-diazaspiro[4.4]nonyl and 6,9-diazaspiro[4.5]decyl; wherein, each instance of heterocyclyl is optionally substituted one, two or three R 3 substituents and optionally, with one additional R 4 substituent.

addedgranted claim 11no counterpart in the publication

The compound of claim 1 , wherein R 2 is heteroaryl selected from furo[3,2-b]pyridinyl, furo[3,2-c]pyridinyl, furo[2,3-c]pyridinyl, thieno[3,2-c]pyridinyl, thieno[2,3-d]pyrimidinyl, 1H-pyrrolo[2,3-b]pyridinyl, 1H-pyrrolo[2,3-c]pyridinyl, pyrrolo[1,2-a]pyrimidinyl, pyrrolo[1,2-a]pyrazinyl, pyrrolo[1,2-b]pyridazinyl, pyrazolo[1,5-a]pyridinyl, pyrazolo[1,5-a]pyrazinyl, imidazo[1,2-a]pyridinyl, imidazo[1,2-a]pyrimidinyl, imidazo[1,2-c]pyrimidinyl, imidazo[1,2-b]pyridazinyl, imidazo[1,2-a]pyrazinyl, imidazo[2,1-b][1,3]thiazolyl, imidazo[2,1-b][1,3,4]thiadiazolyl, [1,3]oxazolo[4,5-b]pyridinyl and quinoxalinyl; wherein, each instance of heteroaryl is optionally substituted with one, two or three R 6 substituents and optionally, with one additional R 7 substituent.

addedgranted claim 12no counterpart in the publication

The compound of claim 9 , wherein the compound is selected from the group consisting of: 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-(piperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-(1-methylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-(1-ethylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[1-(propan-2-yl)piperidin-4-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4-ethyl-6-methylpyrazolo[1, 5-a]pyrazin-2-yl)-7-(piperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-(1-methylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-(1-ethylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-(1-propylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-7-(piperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-7-(1-methylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-[1-(propan-2-yl)piperidin-4-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-(1-propylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-7-(1-propylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(6-methyl-4-propylpyrazolo[1,5-a]pyrazin-2-yl)-7-(piperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-7-(piperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-7-(1-methylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-(1-ethylpiperidin-4-yl)-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-(1-ethylpiperidin-4-yl)-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one, or 7-[(2S,6S)-2,6-dimethylpiperidin-4-yl]-2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, or a salt, isotopologue, stereoisomer, racemate, enantiomer, diastereomer or tautomer thereof.

addedgranted claim 13no counterpart in the publication

The compound of claim 9 , wherein the compound is selected from the group consisting of: 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[(3 S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(3R,5S)-3,5-dimethylpiperazin-1-yl]-2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-(4-methylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(3 S)-3,4-dimethylpiperazin-1-yl]-2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[(3R,5 S)-3,4,5-trimethylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[(3R)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-(4-ethylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-(3,3-dimethylpiperazin-1-yl)-2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[(3R)-4-ethyl-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(3R)-3,4-dimethylpiperazin-1-yl]-2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(6-methylpyrazolo[1, 5-a]pyrazin-2-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-(4-methylpiperazin-1-yl)-2-(6-methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(3 S)-3-methylpiperazin-1-yl]-2-(6-methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(3R,5 S)-3, 5-dimethylpiperazin-1-yl]-2-(6-methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-7-(4-methylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-(4-ethylpiperazin-1-yl)-2-(6-methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(3R)-3-methylpiperazin-1-yl]-2-(6-methylpyrazolo[1, 5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-(4-ethylpiperazin-1-yl)-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-7-[(3R)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(3R)-3,4-dimethylpiperazin-1-yl]-2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[(3R)-4-ethyl-3-methylpiperazin-1-yl]-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one, 7-(3,3-dimethylpiperazin-1-yl)-2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-(4-methylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-(4-ethylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(3R,5 S)-3, 5-dimethylpiperazin-1-yl]-2-(4,6-dimethylpyrazolo[1, 5-a]pyrazin-2-yl)-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(3 S)-3,4-dimethylpiperazin-1-yl]-2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-7-[(3R,5 S)-3,4, 5-trimethylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-(4-propylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-[4-(propan-2-yl)piperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(3R)-3,4-dimethylpiperazin-1-yl]-2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(3R)-4-ethyl-3-methylpiperazin-1-yl]-2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-[(3R)-3-methyl-4-propylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(3R,5 S)-3, 5-dimethylpiperazin-1-yl]-2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-[(3 S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-[(3R)-3-methyl-4-(propan-2-yl)piperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-[(3R)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(6-methyl-4-propylpyrazolo[1,5-a]pyrazin-2-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-(4-methylpiperazin-1-yl)-2-(6-methyl-4-propylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-(4-ethylpiperazin-1-yl)-2-(6-methyl-4-propylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(3R)-3-methylpiperazin-1-yl]-2-(6-methyl-4-propylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(3 S)-3-methylpiperazin-1-yl]-2-(6-methyl-4-propylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(3R,5 S)-3, 5-dimethylpiperazin-1-yl]-2-(6-methyl-4-propylpyrazolo[1,5-a]pyrazin-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-[(3 S)-3-ethylpiperazin-1-yl]-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-7-[(3R)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(3R)-3,4-dimethylpiperazin-1-yl]-2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-7-[(3S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(3 S)-3,4-dimethylpiperazin-1-yl]-2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one, or 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-7-(4-ethylpiperazin-1-yl)-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one, or a salt, isotopologue, stereoisomer, racemate, enantiomer, diastereomer or tautomer thereof.

addedgranted claim 14no counterpart in the publication

The compound of claim 9 , wherein the compound is selected from the group consisting of: 2-(2-methylimidazo[1,2-a]pyridin-6-yl)-7-(piperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2-methylimidazo[1,2-a]pyridin-6-yl)-7-(1-methylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2-methylimidazo[1,2-a]pyridin-6-yl)-7-(1-propylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-(1-ethylpiperidin-4-yl)-2-(2-methylimidazo[1,2-a]pyridin-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2-methylimidazo[1,2-a]pyridin-6-yl)-7-[1-(propan-2-yl)piperidin-4-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2-methylimidazo[1,2-a]pyridin-7-yl)-7-(piperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2-methylimidazo[1,2-a]pyridin-7-yl)-7-(1-methylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-(1-ethylpiperidin-4-yl)-2-(2-methylimidazo[1,2-a]pyridin-7-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2,8-dimethylimidazo[1,2-a]pyridin-6-yl)-7-(piperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2,8-dimethylimidazo[1,2-a]pyridin-6-yl)-7-(1-methylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2,8-dimethylimidazo[1,2-a]pyridin-6-yl)-7-(1-ethylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2,8-dimethylimidazo[1,2-a]pyridin-6-yl)-7-[1-(propan-2-yl)piperidin-4-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(8-ethyl-2-methylimidazo[1,2-a]pyridin-6-yl)-7-(piperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(8-ethyl-2-methylimidazo[1,2-a]pyridin-6-yl)-7-(1-methylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, or 2-(8-ethyl-2-methylimidazo[1,2-a]pyridin-6-yl)-7-(1-ethylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, or a salt, isotopologue, stereoisomer, racemate, enantiomer, diastereomer or tautomer thereof.

addedgranted claim 15no counterpart in the publication

The compound of claim 9 , wherein the compound is selected from the group consisting of: 2-(imidazo[1,2-a]pyridin-7-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(imidazo[1,2-a]pyridin-6-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2-methylimidazo[1,2-a]pyridin-6-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2-methylimidazo[1,2-a]pyridin-6-yl)-7-(4-methylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2-methylimidazo[1,2-a]pyridin-6-yl)-7-[(3S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(3R,5 S)-3,5-dimethylpiperazin-1-yl]-2-(2-methylimidazo[1,2-a]pyridin-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2,8-dimethylimidazo[1,2-a]pyridin-6-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2-methylimidazo[1,2-a]pyridin-7-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2-methylimidazo[1,2-a]pyridin-7-yl)-7-(4-methylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-(4-ethylpiperazin-1-yl)-2-(2-methylimidazo[1,2-a]pyridin-7-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(8-ethyl-2-methylimidazo[1,2-a]pyridin-6-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(8-ethyl-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[(3R)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(8-ethyl-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[(3 S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(3R,5S)-3,5-dimethylpiperazin-1-yl]-2-(8-ethyl-2-methylimidazo[1,2-a]pyridin-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 7-[(3R)-3,4-dimethylpiperazin-1-yl]-2-(8-ethyl-2-methylimidazo[1,2-a]pyridin-6-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(8-ethyl-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[(3R)-4-ethyl-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(imidazo[1,2-a]pyridin-6-yl)-7-(4-methylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2,8-dimethylimidazo[1,2-a]pyridin-6-yl)-7-(4-methylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, or 2-(2,8-dimethylimidazo[1,2-a]pyridin-6-yl)-7-(4-ethylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, or a salt, isotopologue, stereoisomer, racemate, enantiomer, diastereomer or tautomer thereof.

addedgranted claim 16no counterpart in the publication

The compound of claim 9 , wherein the compound is selected from the group consisting of: 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-7-(1-methylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-7-(1-ethylpiperidin-4-yl)-9-methyl-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4,6-dimethylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-7-(1-propylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(6-methyl-4-propylpyrazolo[1,5-a]pyrazin-2-yl)-7-(piperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-7-(piperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, or 2-(4-ethyl-6-methylpyrazolo[1,5-a]pyrazin-2-yl)-9-methyl-7-(1-methylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, or a salt, isotopologue, stereoisomer, racemate, enantiomer, diastereomer or tautomer thereof.

addedgranted claim 17no counterpart in the publication

The compound of claim 9 , wherein the compound is selected from the group consisting of: 2-(2,8-dimethylimidazo[1,2-a]pyridin-6-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(8-ethyl-2-methylimidazo[1,2-a]pyridin-6-yl)-7-(piperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(8-ethyl-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[(3R)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(8-ethyl-2-methylimidazo[1,2-a]pyridin-6-yl)-7-[(3S)-3-methylpiperazin-1-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2,8-dimethylimidazo[1,2-a]pyridin-6-yl)-7-(4-methylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, or 2-(2,8-dimethylimidazo[1,2-a]pyridin-6-yl)-7-(4-ethylpiperazin-1-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, or a salt, isotopologue, stereoisomer, racemate, enantiomer, diastereomer or tautomer thereof.

addedgranted claim 18no counterpart in the publication

addedgranted claim 19no counterpart in the publication

The compound of claim 9 , wherein the compound is selected from the group consisting of: 2-(2,8-dimethylimidazo[1,2-a]pyridin-6-yl)-7-(piperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2,8-dimethylimidazo[1,2-a]pyridin-6-yl)-7-(1-methylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2,8-dimethylimidazo[1,2-a]pyridin-6-yl)-7-(1-ethylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(2,8-dimethylimidazo[1,2-a]pyridin-6-yl)-7-[1-(propan-2-yl)piperidin-4-yl]-4H-pyrido[1,2-a]pyrimidin-4-one, 2-(8-ethyl-2-methylimidazo[1,2-a]pyridin-6-yl)-7-(piperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, or 2-(8-ethyl-2-methylimidazo[1,2-a]pyridin-6-yl)-7-(1-methylpiperidin-4-yl)-4H-pyrido[1,2-a]pyrimidin-4-one, or a salt, isotopologue, stereoisomer, racemate, enantiomer, diastereomer or tautomer thereof.

not grantedpublished claim 10no counterpart in the grant

The pharmaceutical composition of claim 9 for use in the treatment of spinal muscular atrophy (SMA).

not grantedpublished claim 11no counterpart in the grant

A method for enhancing the inclusion of exon 7 of SMN2 into mRNA that is transcribed from the SMN2 gene, comprising contacting a human cell with the compound of claim 1 .

not grantedpublished claim 12no counterpart in the grant

A method for increasing the amount of Smn protein, comprising contacting a human cell with the compound of claim 1 .

not grantedpublished claim 13no counterpart in the grant

The method of claim 11 or 12 , wherein the human cell is a human cell from a human SMA patient.

not grantedpublished claim 14no counterpart in the grant

A method for treating SMA in a human subject in need thereof, comprising administering to the subject an effective amount of the compound of claim 1 .

not grantedpublished claim 15no counterpart in the grant

A method for treating SMA in a human subject in need thereof, comprising administering to the subject the pharmaceutical composition of claim 9 .

addedgranted claim 21no counterpart in the publication

A pharmaceutical composition comprising an effective amount of the compound of claim 9 and a pharmaceutically acceptable carrier, excipient or diluent.

Two documents only — the publication and the grant. What was filed, argued or amended between them is not held and is not shown here.

File wrapper

⤢ drag to zoom

USPTOApplicanthover for detail · click to open

Pendency

4.1 y

1,488 days filing → grant

Office actions

after a restriction

Responses

1 RCE

Examiner

Jeffrey H Murray

art unit 1624 · TC 1600

Law firm

Law firm · Log in to unlock

Citations: 61 back · 21 forward

See the full prosecution history — every USPTO and applicant action on this file, in order.

Documents

Log in to open the documents of this file: the application as filed, every office action and response, the notice of allowance.

Chain of title

⤢ drag to zoom

TitleLienReleasehover for detail · click to open

See the full assignment history — every owner this patent has passed through, with recordation dates and reel/frame numbers.