Polypeptides and nucleic acids encoded thereby

This application claims the benefit of U.S. Ser. No. 60/262,892, filed Jan. 19, 2001; U.S. Ser. No. 60/263,598, filed Jan. 23, 2001; U.S. Ser. No. 60/263,799, filed Jan. 24, 2001; U.S. Ser. No. 60/264,117, filed Jan. 25, 2001; U.S. Ser. No. 60/264,139, filed Jan. 25, 2001; U.S. Ser. No. 60/264,478, filed Jan. 26, 2001; U.S. Ser. No. 60/263,351, filed Jan. 30, 2001; U.S. Ser. No. 60/272,870, filed Mar. 2, 2001; U.S. Ser. No. 60/275,990, filed Mar. 14, 2001; U.S. Ser. No. 60/275,927, filed Mar. 14, 2001; U.S. Ser. No. 60/276,449, filed Mar. 15, 2001; U.S. Ser. No. 60/277,358, filed Mar. 20, 2001; U.S. Ser. No. 60/278,151, filed Mar. 23, 2001; U.S. Ser. No. 60/279,857, filed Mar. 29, 2001; U.S. Ser. No. 60/285,140, filed Apr. 20, 2001; U.S. Ser. No. 60/285,141, filed Apr. 20, 2001; U.S. Ser. No. 60/287,484, filed Apr. 30, 2001; U.S. Ser. No. 60/291,701, filed May 17, 2001; U.S. Ser. No. 60/296,960, filed Jun. 8, 2001; U.S. Ser. No. 60/304,353, filed Jul. 10, 2001; U.S. Ser. No. 60/304,355, filed Jul. 10, 2001; U.S. Ser. No. 60/304,886, filed Jul. 12, 2001; U.S. Ser. No. 60/311,289, filed Aug. 9, 2001; U.S. Ser. No. 60/311,975, filed Aug. 13, 2001; U.S. Ser. No. 60/312,937, filed Aug. 16, 2001; U.S. Ser. No. 60/330,227, filed Oct. 18, 2001; and U.S. Ser. No. 60/334,198, filed Nov. 29, 2001 each of which is incorporated by reference in its entirety.

The CD containing “CURA551.app” is herein incorporated by reference. This file was created on Jan. 28, 2003. It is 1.52 MB in size.

The invention relates to polynucleotides and the polypeptides encoded by such polynucleotides, as well as vectors, host cells, antibodies and recombinant methods for producing the polypeptides and polynucleotides, as well as methods for using the same.

The invention is based in part upon the discovery of nucleic acid sequences encoding novel polypeptides. The novel nucleic acids and polypeptides are referred to herein as NOVX, or NOV1, NOV2, NOV3, NOV4, NOV5, NOV6, NOV7, NOV8, NOV9, NOV10, NOV11, NOV12, NOV13, NOV14, NOV15, NOV16, NOV17, NOV18, NOV19, NOV20, NOV21, NOV22, NOV23, NOV24, NOV25, NOV26, NOV27, NOV28, NOV29, NOV30, NOV31, NOV32, and NOV33 nucleic acids and polypeptides. These nucleic acids and polypeptides, as well as derivatives, homologs, analogs and fragments thereof, will hereinafter be collectively designated as “NOVX” nucleic acid or polypeptide sequences.

In one aspect, the invention provides an isolated NOVX nucleic acid molecule encoding a NOVX polypeptide that includes a nucleic acid sequence that has identity to the nucleic acids disclosed in SEQ ID NOS:1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, and 122. In some embodiments, the NOVX nucleic acid molecule will hybridize under stringent conditions to a nucleic acid sequence complementary to a nucleic acid molecule that includes a protein-coding sequence of a NOVX nucleic acid sequence. The invention also includes an isolated nucleic acid that encodes a NOVX polypeptide, or a fragment, homolog, analog or derivative thereof. For example, the nucleic acid can encode a polypeptide at least 80% identical to a polypeptide comprising the amino acid sequences of SEQ ID NOS:2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, and 123. The nucleic acid can be, for example, a genomic DNA fragment or a cDNA molecule that includes the nucleic acid sequence of any of SEQ ID NOS:1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, and 122.

Also included in the invention is an oligonucleotide, e.g., an oligonucleotide which includes at least 6 contiguous nucleotides of a NOVX nucleic acid (e.g., SEQ ID NOS:1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, and 122) or a complement of said oligonucleotide. Also included in the invention are substantially purified NOVX polypeptides (SEQ ID NOS:2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, and 123). In certain embodiments, the NOVX polypeptides include an amino acid sequence that is substantially identical to the amino acid sequence of a human NOVX polypeptide.

The invention also features antibodies that immunoselectively bind to NOVX polypeptides, or fragments, homologs, analogs or derivatives thereof.

In another aspect, the invention includes pharmaceutical compositions that include therapeutically- or prophylactically-effective amounts of a therapeutic and a pharmaceutically acceptable carrier. The therapeutic can be, e.g., a NOVX nucleic acid, a NOVX polypeptide, or an antibody specific for a NOVX polypeptide. In a further aspect, the invention includes, in one or more containers, a therapeutically- or prophylactically-effective amount of this pharmaceutical composition.

In a further aspect, the invention includes a method of producing a polypeptide by culturing a cell that includes a NOVX nucleic acid, under conditions allowing for expression of the NOVX polypeptide encoded by the DNA. If desired, the NOVX polypeptide can then be recovered.

In another aspect, the invention includes a method of detecting the presence of a NOVX polypeptide in a sample. In the method, a sample is contacted with a compound that selectively binds to the polypeptide under conditions allowing for formation of a complex between the polypeptide and the compound. The complex is detected, if present, thereby identifying the NOVX polypeptide within the sample.

The invention also includes methods to identify specific cell or tissue types based on their expression of a NOVX.

Also included in the invention is a method of detecting the presence of a NOVX nucleic acid molecule in a sample by contacting the sample with a NOVX nucleic acid probe or primer, and detecting whether the nucleic acid probe or primer bound to a NOVX nucleic acid molecule in the sample.

In a further aspect, the invention provides a method for modulating the activity of a NOVX polypeptide by contacting a cell sample that includes the NOVX polypeptide with a compound that binds to the NOVX polypeptide in an amount sufficient to modulate the activity of said polypeptide. The compound can be, e.g., a small molecule, such as a nucleic acid, peptide, polypeptide, peptidomimetic, carbohydrate, lipid or other organic (carbon containing) or inorganic molecule, as further described herein.

Also within the scope of the invention is the use of a therapeutic in the manufacture of a medicament for treating or preventing disorders or syndromes including, e.g., trauma, regeneration (in vitro and in vivo), viral/bacterial/parasitic infections, Von Hippel-Lindau (VHL) syndrome, Alzheimer's disease, stroke, tuberous sclerosis, hypercalceimia, Parkinson's disease, Huntington's disease, cerebral palsy, epilepsy, Lesch-Nyhan syndrome, multiple sclerosis, ataxia-telangiectasia, leukodystrophies, behavioral disorders, addiction, anxiety, pain, actinic keratosis, acne, hair growth diseases, allopecia, pigmentation disorders, endocrine disorders, connective tissue disorders, such as severe neonatal Marfan syndrome, dominant ectopia lentis, familial ascending aortic aneurysm, inflammatory disorders such as osteo- and rheumatoid-arthritis, inflammatory bowel disease, Crohn's disease, immunological disorders, AIDS, cancers including but not limited to lung cancer, colon cancer, neoplasm, adenocarcinoma, lymphoma, prostate cancer, uterus cancer, leukemia or pancreatic cancer, blood disorders, asthma, psoriasis, vascular disorders, hypertension, skin disorders, renal disorders including Alport syndrome, immunological disorders, tissue injury, fibrosis disorders, bone diseases, osteogenesis imperfecta, Neurologic diseases, brain and/or autoimmune disorders like encephalomyelitis, neurodegenerative disorders, immune disorders, hematopoietic disorders, muscle disorders, inflammation and wound repair, bacterial, fungal, protozoal and viral infections (particularly infections caused by HIV-1 or HIV-2), pain, acute heart failure, hypotension, hypertension, urinary retention, osteoporosis, angina pectoris, myocardial infarction, ulcers, benign prostatic hypertrophy, arthrogryposis multiplex congenita, keratoconus, scoliosis, pancreatitis, obesity systemic lupus erythematosus, emphysema, scleroderma, allergy, ards, neuroprotection, fertility myasthenia gravis, diabetes, obesity, growth and reproductive disorders, hemophilia, hypercoagulation, immunodeficiencies, graft vesus host, congenital adrenal hyperplasia, endometriosis, xerostomia, ulcers, cirrhosis, transplantation, diverticular disease, hirschsprung's disease, appendicitis, tendinitis, renal artery stenosis, interstitial nephritis, glomerulonephritis, polycystic kidney disease, erythematosus, renal tubular acidosis, IgA nephropathy, anorexia, bulimia, psychotic disorders, including anxiety, schizophrenia, manic depression, delirium, dementia, severe mental retardation and dyskinesias, such as Huntington's disease and/or other pathologies and disorders of the like.

The therapeutic can be, e.g., a NOVX nucleic acid, a NOVX polypeptide, or a NOVX-specific antibody, or biologically-active derivatives or fragments thereof.

For example, the compositions of the present invention will have efficacy for treatment of patients suffering from the diseases and disorders disclosed above and/or other pathologies and disorders of the like. The polypeptides can be used as immunogens to produce antibodies specific for the invention, and as vaccines. They can also be used to screen for potential agonist and antagonist compounds. For example, a cDNA encoding NOVX may be useful in gene therapy, and NOVX may be useful when administered to a subject in need thereof. By way of non-limiting example, the compositions of the present invention will have efficacy for treatment of patients suffering from the diseases and disorders disclosed above and/or other pathologies and disorders of the like.

The invention further includes a method for screening for a modulator of disorders or syndromes including, e.g., the diseases and disorders disclosed above and/or other pathologies and disorders of the like. The method includes contacting a test compound with a NOVX polypeptide and determining if the test compound binds to said NOVX polypeptide. Binding of the test compound to the NOVX polypeptide indicates the test compound is a modulator of activity, or of latency or predisposition to the aforementioned disorders or syndromes.

Also within the scope of the invention is a method for screening for a modulator of activity, or of latency or predisposition to disorders or syndromes including, e.g., the diseases and disorders disclosed above and/or other pathologies and disorders of the like by administering a test compound to a test animal at increased risk for the aforementioned disorders or syndromes. The test animal expresses a recombinant polypeptide encoded by a NOVX nucleic acid. Expression or activity of NOVX polypeptide is then measured in the test animal, as is expression or activity of the protein in a control animal which recombinantly-expresses NOVX polypeptide and is not at increased risk for the disorder or syndrome. Next, the expression of NOVX polypeptide in both the test animal and the control animal is compared. A change in the activity of NOVX polypeptide in the test animal relative to the control animal indicates the test compound is a modulator of latency of the disorder or syndrome.

In yet another aspect, the invention includes a method for determining the presence of or predisposition to a disease associated with altered levels of a NOVX polypeptide, a NOVX nucleic acid, or both, in a subject (e.g., a human subject). The method includes measuring the amount of the NOVX polypeptide in a test sample from the subject and comparing the amount of the polypeptide in the test sample to the amount of the NOVX polypeptide present in a control sample. An alteration in the level of the NOVX polypeptide in the test sample as compared to the control sample indicates the presence of or predisposition to a disease in the subject. Preferably, the predisposition includes, e.g., the diseases and disorders disclosed above and/or other pathologies and disorders of the like. Also, the expression levels of the new polypeptides of the invention can be used in a method to screen for various cancers as well as to determine the stage of cancers.

In a further aspect, the invention includes a method of treating or preventing a pathological condition associated with a disorder in a mammal by administering to the subject a NOVX polypeptide, a NOVX nucleic acid, or a NOVX-specific antibody to a subject (e.g., a human subject), in an amount sufficient to alleviate or prevent the pathological condition. In preferred embodiments, the disorder, includes, e.g., the diseases and disorders disclosed above and/or other pathologies and disorders of the like.

In yet another aspect, the invention can be used in a method to identity the cellular receptors and downstream effectors of the invention by any one of a number of techniques commonly employed in the art. These include but are not limited to the two-hybrid system, affinity purification, co-precipitation with antibodies or other specific-interacting molecules.

NOVX nucleic acids and polypeptides are further useful in the generation of antibodies that bind immuno-specifically to the novel NOVX substances for use in therapeutic or diagnostic methods. These NOVX antibodies may be generated according to methods known in the art, using prediction from hydrophobicity charts, as described in the “Anti-NOVX Antibodies” section below. The disclosed NOVX proteins have multiple hydrophilic regions, each of which can be used as an immunogen. These NOVX proteins can be used in assay systems for functional analysis of various human disorders, which will help in understanding of pathology of the disease and development of new drug targets for various disorders.

The NOVX nucleic acids and proteins identified here may be useful in potential therapeutic applications implicated in (but not limited to) various pathologies and disorders as indicated below. The potential therapeutic applications for this invention include, but are not limited to: protein therapeutic, small molecule drug target, antibody target (therapeutic, diagnostic, drug targeting/cytotoxic antibody), diagnostic and/or prognostic marker, gene therapy (gene delivery/gene ablation), research tools, tissue regeneration in vivo and in vitro of all tissues and cell types composing (but not limited to) those defined here.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In the case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.

Other features and advantages of the invention will be apparent from the following detailed description and claims.

The present invention provides novel nucleotides and polypeptides encoded thereby. Included in the invention are the novel nucleic acid sequences and their encoded polypeptides. The sequences are collectively referred to herein as “NOVX nucleic acids” or “NOVX polynucleotides” and the corresponding encoded polypeptides are referred to as “NOVX polypeptides” or “NOVX proteins.” Unless indicated otherwise, “NOVX” is meant to refer to any of the novel sequences disclosed herein. Table A provides a summary of the NOVX nucleic acids and their encoded polypeptides.

NOVX nucleic acids and their encoded polypeptides are useful in a variety of applications and contexts. The various NOVX nucleic acids and polypeptides according to the invention are useful as novel members of the protein families according to the presence of domains and sequence relatedness to previously described proteins. Additionally, NOVX nucleic acids and polypeptides can also be used to identify proteins that are members of the family to which the NOVX polypeptides belong.

NOV1 is homologous to members of the neurotrophin-6 alpha family of proteins. Thus, the NOV1 nucleic acid and polypeptide, antibodies and related compounds according to the invention may be used to treat immune and nervous system disorders, e.g., proinflammatory disorder, immune disorder, inflammatory disease, septic shock, arthritis, bone pain, or bone deformity.

NOV2 is homologous to members of the guanylate kinase family of proteins. Thus, the NOV2 nucleic acid and polypeptide, antibodies and related compounds according to the invention will be useful in therapeutic and diagnostic applications in the mediation of biosynthesis and nucleotide metabolism. As such the NOV2 nucleic acid and polypeptide, antibodies and related compounds according to the invention may be used to treat genetic conditions, e.g., Von Hippel-Lindau (VHL) syndrome, diabetes, or tuberous sclerosis.

NOV3 is homologous to members of a family of the 85.6 kDa-like proteins that contain ankyrin domains. Thus NOV3 nucleic acid and polypeptide, antibodies and related compounds according to the invention will be useful in therapeutic and diagnostic applications in the mediation of signal transduction or cell activation. As such the NOV3 nucleic acid and polypeptide, antibodies and related compounds according to the invention may be used to treat genetic conditions, e.g., endometriosis, fertility, adrenoleukodystrophy, congenital adrenal hyperplasia, diabetes, Von Hippel-Lindau (vhl) syndrome, pancreatitis, obesity, hyperparathyroidism, hypoparathyroidism, hyperthyroidism, hypothyroidism, SIDS, xerostomia, scleroderma, hypercalceimia, ulcers, cirrhosis, transplantation, inflammatory bowel disease, diverticular disease, hirschsprung's disease, crohn's disease, appendicitis, hemophilia, hypercoagulation, idiopathic thrombocytopenic purpura, autoimmume disease, allergies, immunodeficiencies, graft vesus host, anemia, ataxia-telangiectasia, lymphedema, tonsilitis, osteoporosis, hypercalceimia, arthritis, ankylosing spondylitis, scoliosis, tendinitis, muscular dystrophy, lesch-nyhan syndrome, myasthenia gravis, dental disease and infection, cardiomyopathy, atherosclerosis, hypertension, congenital heart defects, aortic stenosis, atrial septal defect (asd), atrioventricular (a-v) canal defect, ductus arteriosus, pulmonary stenosis, subaortic stenosis, ventricular septal defect (vsd), valve diseases, tuberous sclerosis, aneurysm, fibromuscular dysplasia, stroke, bleeding disorders, alzheimer's disease, parkinson's disease, huntington's disease, cerebral palsy, epilepsy, multiple sclerosis, ataxia-telangiectasia, leukodystrophies, behavioral disorders, addiction, anxiety, pain, neuroprotection, endocrine dysfunctions, growth and reproductive disorders, cystitis, incontinence, renal artery stenosis, interstitial nephritis, glomerulonephritis, polycystic kidney disease, systemic lupus erythematosus, renal tubular acidosis, iga nephropathy, or vesicoureteral reflux.

NOV4 is homologous to members of the mytonic dystrophy kinase-related CDC42-binding kinase family of proteins. Thus, the NOV4 nucleic acids and polypeptides, antibodies and related compounds according to the invention may be used to treat muscle, or cell migration disorders, e.g., myotonic dystrophy, myotonic dystrophy type 2, proximal myotonic myopathy, proximal myotonic dystrophy, neuromuscular diseases associated with cardiomyopathy, multiple endocrine neoplasia type 1(MEN1), insulin dependent diabetes mellitus, familial paraganglioma type 2, spinocerebellar ataxia type 5, Bardet-Biedl syndrome, non-hodgkins lymphoma, cancers such as breast cancer, liver, lung, pancrease, and prostate cancers.

NOV5 is homologous tomembers of the S100 Calcium binding protein family. Thus, the NOV5 nucleic acid and polypeptide, antibodies and related compounds according to the invention may be used to treat genetic conditions, e.g., various cancers like breast, lung, and colorectal, as well as heart disease such as myocardial ischemia.

NOV6, NOV16, NOV18, NOV31, and NOV33 are homologous to the olfactory receptor/GPCR-like family of proteins. G-Protein Coupled Receptor (GPCRs) have been identified as an extremely large family of protein receptors in a number of species. Thus, the NOV6 nucleic acid and polypeptide, antibodies and related compounds according to the invention will be useful in therapeutic and diagnostic applications in the mediation of signal transduction. As such the NOV6 nucleic acid and polypeptide, antibodies and related compounds according to the invention may be used to treat, e.g., developmental diseases, MHC II and III diseases (immune diseases), taste and scent detectability disorders, Burkitt's lymphoma, corticoneurogenic disease, signal transduction pathway disorders, retinal diseases including those involving photoreception, cell growth rate disorders, cell shape disorders, feeding disorders, control of feeding, potential obesity due to over-eating, potential disorders due to starvation (lack of apetite), noninsulin-dependent diabetes mellitus (NIDDM1), bacterial, fungal, protozoal and viral infections (particularly infections caused by HIV-1 or HIV-2), pain, cancer (including but not limited to neoplasm, adenocarcinoma, lymphoma, prostate cancer, uterus cancer), anorexia, bulimia, asthma, parkinson's disease, acute heart failure, hypotension, hypertension, urinary retention, osteoporosis, crohn's disease, multiple sclerosis, and treatment of albright hereditary ostoeodystrophy, angina pectoris, myocardial infarction, ulcers, asthma, allergies, benign prostatic hypertrophy, and psychotic and neurological disorders, including anxiety, schizophrenia, manic depression, delirium, dementia, severe mental retardation, dentatorubro-pallidoluysian atrophy(DRPLA) hypophosphatemic rickets, autosomal dominant (2) acrocallosal syndrome and dyskinesias, such as huntington's disease or gilles de la tourette syndrome.

NOV7 is homologous to members of the carbonate dehydratase/anhydrase family of proteins. As such the NOV7 nucleic acids and polypeptides, antibodies and related compounds according to the invention may be used to treat respiratory or CO2 transport disorders, e.g., lung cancer, hypertension, asthma, emphysema, or diabetes.

NOV8 is homologous to members of the carboxypeptidase family of proteins. Thus, the NOV8 nucleic acids and polypeptides, antibodies and related compounds according to the invention may be used to treat digestive disorders, e.g., xerostomia, hypercalceimia, ulcers, Von Hippel-Lindau (VHL) syndrome, cirrhosis, transplantation, inflammatory bowel disease, diverticular disease, hirschsprung's disease, crohn's disease, appendicitis, stroke, tuberous sclerosis, anxiety, pain, endocrine dysfunctions, nueroprotection, diabetes, obesity, growth and reproductive disorders, myasthenia gravis.

NOV9 is homologous to members of the neurotransmitter receptor family of proteins. Thus, the NOV9 nucleic acid and polypeptide, antibodies and related compounds according to the invention may be used to treat, e.g., leukemia, acute nonlymphocytic, spinocerebellar ataxia-1, or neurological disorders.

NOV10 is homologous to members of the proto-oncogene MAF-like family of proteins. Thus, the NOV10 nucleic acid and polypeptide, antibodies and related compounds according to the invention may be used to treat, e.g., anemia, ataxia-telangiectasia, autoimmume disease, cancer, immunodeficiencies, hemophilia, hypercoagulation, idiopathic thrombocytopenic purpura, allergies, transplantation, graft versus host disease (GVHD), lymphaedema, systemic lupus erythematosus, asthma, emphysema, scleroderma, ARDS, diabetes, renal artery stenosis, interstitial nephritis, glomerulonephritis, polycystic kidney disease, systemic lupus erythematosus, renal tubular acidosis, IgA nephropathy, hypercalceimia, or Lesch-Nyhan syndrome.

NOV11 is homologous to members of the lysyl oxidase family of proteins. Thus, the NOV11 nucleic acids and polypeptides, antibodies and related compounds according to the invention may be used to treat digestive disorders, e.g., diabetes, Von Hippel-Lindau (VHL) syndrome, pancreatitis, obesity, endometriosis, fertility, hemophilia, hypercoagulation, idiopathic thrombocytopenic purpura, autoimmume disease, allergies, immunodeficiencies, transplantation, graft versus host disease (GVHD), lymphaedema, osteoporosis, hypercalceimia, arthritis, ankylosing spondylitis, scoliosis, systemic lupus erythematosus, asthma, emphysema, scleroderma, allergy, ARDS, renal artery stenosis, interstitial nephritis, glomerulonephritis, polycystic kidney disease, systemic lupus erythematosus, renal tubular acidosis, IgA nephropathy, Lesch-Nyhan syndrome, psoriasis, actinic keratosis, tuberous sclerosis, acne, hair growth/loss, allopecia, pigmentation disorders, and endocrine disorders.

NOV12 is homologous to members of the phosphatase family of proteins. Thus, the NOV12 nucleic acids and polypeptides, antibodies and related compounds according to the invention may be used to treat, e.g., hyperthyroidism, hypothyroidism, endometriosis, fertility, Von Hippel-Lindau (VHL) syndrome, cirrhosis, transplantation, hypogonadism, Alzheimer's disease, stroke, tuberous sclerosis, hypercalceimia, Parkinson's disease, Huntington's disease, cerebral palsy, epilepsy, Lesch-Nyhan syndrome, multiple sclerosis, ataxia-telangiectasia, leukodystrophies, behavioral disorders, addiction, anxiety, pain, neurodegeneration, endocrine dysfunctions, diabetes, obesity, growth and reproductive disorders, systemic lupus erythematosus, autoimmune disease, asthma, emphysema, scleroderma, allergy, ARDS, renal artery stenosis, interstitial nephritis, glomerulonephritis, polycystic kidney disease, renal tubular acidosis, IgA nephropathy, hemophilia, hypercoagulation, idiopathic thrombocytopenic purpura, immunodeficiencies, and graft versus host disease.

NOV13 is homologous to members of the chloride channel CLC-KA family of proteins. Thus, the NOV13 nucleic acid and polypeptide, antibodies and related compounds according to the invention may be used to treat, e.g., diabetes, autoimmune disease, renal artery stenosis, interstitial nephritis, glomerulonephritis, polycystic kidney disease, systemic lupus erythematosus, renal tubular acidosis, IgA nephropathy, hypercalceimia, or Lesch-Nyhan syndrome.

NOV14 is homologous to members of the mast cell function-associated antigen (MAFA) family of proteins. Thus, the NOV14 nucleic acid and polypeptide, antibodies and related compounds according to the invention may be used to treat, e.g., cancer, autoimmune disease, allergies, immunodeficiencies, transplantation, graft versus host disease (GVHD), or lymphaedema.

NOV15 is homologous to members of the murine epithelial growth factor (MEGF) family of proteins. Thus, the NOV15 nucleic acids and polypeptides, antibodies and related compounds according to the invention may be used to treat, e.g., cancer, trauma, bacterial and viral infections, regeneration (in vitro and in vivo), fertility, endometriosis, cardiomyopathy, atherosclerosis, hypertension, congenital heart defects, aortic stenosis, atrial septal defect (ASD), atrioventricular (A-V) canal defect, ductus arteriosus, pulmonary stenosis, subaortic stenosis, ventricular septal defect (VSD), valve diseases, tuberous sclerosis, scleroderma, obesity, transplantation, anemia, bleeding disorders, transplantation, diabetes, autoimmune disease, renal artery stenosis, interstitial nephritis, glomerulonephritis, polycystic kidney disease, systemic lupus erythematosus, renal tubular acidosis, IgA nephropathy, hypercalceimia, Lesch-Nyhan syndrome, systemic lupus erythematosus, autoimmune disease, asthma, emphysema, allergy, ARDS, von Hippel-Lindau (VHL) syndrome, Alzheimer's disease, stroke, hypercalceimia, Parkinson's disease, Huntington's disease, cerebral palsy, epilepsy, Lesch-Nyhan syndrome, multiple sclerosis, ataxia-telangiectasia, leukodystrophies, behavioral disorders, addiction, anxiety, pain, neurodegeneration, Hirschsprung's disease, Crohn's Disease, and appendicitis.

NOV17 is homologous to members of the monocarboxylate transporter (MCT)-like family of proteins. Thus, the NOV17 nucleic acids and polypeptides, antibodies and related compounds according to the invention may be used to treat, e.g., Salla disease, infantile sialic acid storage disease, cystinosis, or streptozotocin-induced diabetes.

NOV19 is homologous to members of the major Duchenne muscular dystrophy (DP71) family of proteins. Thus, the NOV19 nucleic acids and polypeptides, antibodies and related compounds according to the invention may be used to treat muscle and nervous system disorders, e.g., Duchenne muscular dystrophy, Becker muscular dystroph, cardiomyopathy, dilated, X-linked, McLeod phenotype, Lesch-Nyhan syndrome, myasthenia gravis.

NOV20 is homologous to members of the GPCR RTA family of proteins. Thus, the NOV20 nucleic acids and polypeptides, antibodies and related compounds according to the invention may be used to treat a wide range of disorders such as cancer, immune disorders, endocrine disorders and other diseases, e.g., developmental diseases; MHCII and III diseases (immune diseases); taste and scent detectability disorders; Burkitt's lymphoma; corticoneurogenic disease; signal transduction pathway disorders; metabolic pathway disorders; retinal diseases including those involving photoreception; cell growth rate disorders; cell shape disorders; metabolic disorders; feeding disorders; control of feeding; the metabolic syndrome X; wasting disorders associated with chronic diseases; obesity; potential obesity due to over-eating or metabolic disturbances; potential disorders due to starvation (lack of appetite); diabetes; noninsulin-dependent diabetes mellitus (NIDDM); infectious disease; bacterial, fungal, protozoal and viral infections (particularly infections caused by HIV-1 or HIV-2); pain; cancer (including but not limited to neoplasm; adenocarcinoma; lymphoma; prostate cancer; uterus cancer); cancer-associated cachexia; anorexia; bulimia; asthma; Parkinson's disease; acute heart failure; hypotension; hypertension; urinary retention; osteoporosis; Crohn's disease; multiple sclerosis; Albright Hereditary Ostoeodystrophy; angina pectoris; myocardial infarction; ulcers; allergies; benign prostatic hypertrophy; and psychotic and neurological disorders; including anxiety; schizophrenia; manic depression; delirium; dementia; neurodegenerative disorders; Alzheimer's disease; severe mental retardation; Dentatorubro-pallidoluysian atrophy (DRPLA); Hypophosphatemic rickets; autosomal dominant (2) Acrocallosal syndrome and dyskinesias, such as Huntington's disease or Gilles de la Tourette syndrome; immune disorders; Adrenoleukodystrophy; Congenital Adrenal Hyperplasia; Hemophilia; Hypercoagulation; Idiopathic thrombocytopenic purpura; autoimmume disease; immunodeficiencies; transplantation; Von Hippel-Lindau (VHL) syndrome; Stroke; Tuberous sclerosis; hypercalceimia; Cerebral palsy; Epilepsy; Lesch-Nyhan syndrome; Ataxia-telangiectasia; Leukodystrophies; Behavioral disorders; Addiction; Neuroprotection; Cirrhosis; Transplantation; Systemic lupus erythematosus; Emphysema; Scleroderma; ARDS; Renal artery stenosis; Interstitial nephritis; Glomerulonephritis; Polycystic kidney disease; Systemic lupus erythematosus; Renal tubular acidosis; IgA nephropathy; Cardiomyopathy; Atherosclerosis; Congenital heart defects; Aortic stenosis; Atrial septal defect (ASD); Atrioventricular (A-V) canal defect; Ductus arteriosus; Pulmonary stenosis; Subaortic stenosis; Ventricular septal defect (VSD); valve diseases; Scleroderma; fertility; Pancreatitis; Endocrine dysfunctions; Growth and reproductive disorders; Inflammatory bowel disease; Diverticular disease; Leukodystrophies; Graft vesus host; Hyperthyroidism; Endometriosis; and hematopoietic disorders.

NOV21 is homologous to members of the TFIIIC box B-binding subunit family of proteins. Thus, the NOV21 nucleic acids and polypeptides, antibodies and related compounds according to the invention may be used to treat cancer and viral infections, e.g., TFIIIC box B-binding subunit protein is cleaved and inactivated by the poliovirus-encoded 3C protease during poliovirus infection (Shen et al., Mol. Cell. Biol, 16: 4163–71 (1996)).

NOV22 is homologous to members of the nucleoside diphosphate kinase B family of proteins. Thus, the NOV22 nucleic acids and polypeptides, antibodies and related compounds according to the invention may be used to treat cancer, e.g. atherosclerosis, aneurysm, hypertension, fibromuscular dysplasia, stroke, scleroderma, obesity, transplantation, myocardial infarction, embolism, cardiovascular disorders, bypass surgery, fertility disorders, myasthenia gravis, leukodystrophies, pain, neuroprotection, systemic lupus erythematosus, autoimmune disease, asthma, emphysema, scleroderma, allergy, ARDS and other diseases, disorders and conditions of the like.

NOV23 is homologous to members of the T-cell family of proteins. Thus, the NOV23 nucleic acids and polypeptides, antibodies and related compounds according to the invention may be used to immune disorders, e.g., inflammation, allergies, autoimmune disease, and asthma.

NOV24 is homologous to members of the organic anion transporter (OAT) 3 family of proteins. Thus, the NOV24 nucleic acids and polypeptides, antibodies and related compounds according to the invention may be used to treat a wide range of disorders such as cancer, kidney disorders, immune disorders and other diseases, e.g., Von Hippel-Lindau (VHL) syndrome, Cirrhosis, Transplantation, Osteoporosis, Hypercalceimia, Arthritis, Ankylosing spondylitis, Scoliosis, Diabetes, Autoimmune disease, Renal artery stenosis, Interstitial nephritis, Glomerulonephritis, Polycystic kidney disease, Systemic lupus erythematosus, Renal tubular acidosis, IgA nephropathy, Lesch-Nyhan syndrome renal malfunction, nephrotoxicity, disease associated with cytotoxic drug, osteoporosis, osteopetrosis resistance, liver diseases, and heart diseases.

NOV25 and NOV26 are homologous to members of the ficolin family of proteins. Thus, such nucleic acid or protein therapeutics designed with the protein encoded for by NOV26 could function as an opsinin to target and eliminate bacteria by complement-mediated destruction. These proteins could be important for the treatment of bacterial septicemia. Ficolins may also have the ability to bind to elastins. Elastins are functionally important for lung alveolar development and inactivation of these proteins can lead to emphysema-like disease. Antibodies against NOV25 and NOV26 may prevent tissue destruction mediated by ficolin activity during emphysema, asthma and arthritis.

NOV27 is homologous to members of the peroxisomal Ca 2+ -dependent solute carrier family of proteins. Thus, the NOV27 nucleic acids and polypeptides, antibodies and related compounds according to the invention may be used to treat metabolic disorders, e.g., cancer, trauma, regeneration (in vitro and in vivo), viral/bacterial/parasitic infections, atherosclerosis, aneurysm, hypertension, fibromuscular dysplasia, stroke, scleroderma, obesity, Von Hippel-Lindau (VHL) syndrome, Alzheimer's disease, stroke, tuberous sclerosis, hypercalceimia, Parkinson's disease, Huntington's disease, cerebral palsy, epilepsy, Lesch-Nyhan syndrome, multiple sclerosis, ataxia-telangiectasia, leukodystrophies, behavioral disorders, addiction, anxiety, pain, diabetes, autoimmune disease, renal artery stenosis, interstitial nephritis, glomerulonephritis, polycystic kidney disease, systemic lupus erythematosus, renal tubular acidosis, IgA nephropathy, hypercalceimia, muscular dystrophy, Lesch-Nyhan syndrome, and myasthenia gravis.

NOV28, NOV29, and NOV30 are homologous to members of the Na+/glucose cotransporter family of proteins. Thus, the NOV28 nucleic acids and polypeptides, antibodies and related compounds according to the invention may be used to treat metabolic, immune and renal disorders, e.g., metabolic diseases such as diabetes and hypertension, or cancer, trauma, regeneration (in vitro and in vivo), viral/bacterial/parasitic infections, diabetes, autoimmune disease, renal artery stenosis, interstitial nephritis, glomerulonephritis, polycystic kidney disease, systemic lupus erythematosus, renal tubular acidosis, IgA nephropathy, hypercalceimia, Lesch-Nyhan syndrome, cardiomyopathy, atherosclerosis, hypertension, congenital heart defects, aortic stenosis, atrial septal defect (ASD), atrioventricular (A-V) canal defect, ductus arteriosus, pulmonary stenosis, subaortic stenosis, ventricular septal defect (VSD), valve diseases, tuberous sclerosis, scleroderma, obesity, transplantation and other diseases, disorders and conditions of the like.

NOV32 is homologous to members of the phosphoenolpyruvate carboxykinase family of proteins. Thus, the NOV32 nucleic acids and polypeptides, antibodies and related compounds according to the invention may be used to treat metabolic disorders, e.g., hypoglycemia.

The NOVX nucleic acids and proteins of the invention, therefore, are useful in potential therapeutic applications implicated, for example but not limited to, in various pathologies/disorders as described herein and/or other pathologies/disorders. Potential therapeutic uses for the invention(s) are, for example but not limited to, the following: (i) a protein therapeutic, (ii) a small molecule drug target, (iii) an antibody target (therapeutic, diagnostic, drug targeting/cytotoxic antibody), (iv) a nucleic acid useful in gene therapy (gene delivery/gene ablation), (v) an agent promoting tissue regeneration in vitro and in vivo, and (vi) a biological defense weapon.

NOV1

The disclosed NOV1 nucleic acid (alternatively referred to herein as CG56181-01) encodes a novel neutrophin-6 alpha-like protein and includes the 796 nucleotide sequence (SEQ ID NO:1) shown in Table 1A. The novel NOV1 nucleic acid of the invention maps to chromosome 19.

An open reading frame for the mature protein was identified beginning with an AGC, but no start codon, and ending with a TGA stop codon at nucleotides 775–777. Putative untranslated regions, if any, are found upstream from the initiation codon and downstream from the termination codon. The start and stop codons are in bold letters.

The NOV1 protein (SEQ ID NO:2) encoded by SEQ ID NO:1 is 258 amino acid residues in length and is presented using the one-letter amino acid code in Table 1B. The SignalP, Psort and/or Hydropathy results indicate that NOV1 has a signal peptide and is likely to be localized in the microbody (peroxisome) with a certainty of 0.5952. Alternatively, a NOV1 polypeptide is located to the cytoplasm with a certainty of 0.4500, the lysosome (lumen) with a certainty of 0.2100, or the mitochondrial matrix space with a certainty of 0.1000.

A search against the Patp database, a proprietary database that contains sequences published in patents and patent publication, yielded several homologous proteins shown in Table 1C.

In a BLAST search of public sequence databases, it was found, for example, that the NOV1 nucleic acid sequence of this invention has 762 of 796 bases (95%) identical to a gb:GENBANK-ID:HUMINT4PSG|acc:M86529.1 mRNA from Human neurotrophin-4 pseudogene sequence. Further, the full amino acid sequence of the disclosed protein of the invention has 239 of 258 amino acid residues (92%) identical to, and 244 of 258 amino acid residues (94%) similar to, the 257 amino acid residue ptnr:SWISSPROT-ACC:P34132 protein from Human (NEUROTROPHIN-6 ALPHA (NT-6 ALPHA)).

In all BLAST alignments herein, the “E-value” or “Expect” value is a numeric indication of the probability that the aligned sequences could have achieved their similarity to the BLAST query sequence by chance alone, within the database that was searched. For example, the probability that the subject (“Sbjct”) retrieved from the IIT BLAST analysis, matched the Query IIT sequence purely by chance is the E value. The Expect value (E) is a parameter that describes the number of hits one can “expect” to see just by chance when searching a database of a particular size. It decreases exponentially with the Score (S) that is assigned to a match between two sequences. Essentially, the E value describes the random background noise that exists for matches between sequences. Blasting is performed against public nucleotide databases such as GenBank databases and the GeneSeq patent database. For example, BLASTX searching is performed against public protein databases, which include GenBank databases, SwissProt, PDB and PIR.

The Expect value is used as a convenient way to create a significance threshold for reporting results. The default value used for blasting is typically set to 0.0001. In BLAST 2.0, the Expect value is also used instead of the P value (probability) to report the significance of matches. For example, an E value of one assigned to a hit can be interpreted as meaning that in a database of the current size one might expect to see one match with a similar score simply by chance. An E value of zero means that one would not expect to see any matches with a similar score simply by chance. See, e.g., http://www.ncbi.nlm.nih.gov/Education/BLASTinfo/. Occasionally, a string of X's or N's will result from a BLAST search. This is a result of automatic filtering of the query for low-complexity sequence that is performed to prevent artifactual hits. The filter substitutes any low-complexity sequence that it finds with the letter “N” in nucleotide sequence (e.g., “NNNNNNNNNNNNN”) or the letter “X” in protein sequences (e.g., “XXXXXXXXX”). Low-complexity regions can result in high scores that reflect compositional bias rather than significant position-by-position alignment. Wootton and Federhen, Methods Enzymol 266:554–571, 1996.

The NOV1 protein of the invention also has homolgy to the proteins shown in the BLASTP data in Table 1D.

A multiple sequence alignment is given in Table 1E, with the NOV1 protein of the invention being shown in line 1 in a ClustalW analysis comparing NOV with related protein sequences of Table 1D.

The presence of identifiable domains in the disclosed NOV1 protein was determined by using Pfam and then determining the Interpro number. The results are listed in Table 1F with the statistics and domain description.

Consistent with other known members of the neurotrophin family of proteins, NOV1 contains nerve growth factor domains as illustrated in Table 1F.

The NOV1 nucleic acid, and the encoded polypeptide, according to the invention are useful in a variety of applications and contexts. For example, NOV1 nucleic acids and polypeptides can be used to identify proteins that are members of the neurotrophin family of proteins. The NOV1 nucleic acids and polypeptides can also be used to screen for molecules, which inhibit or enhance NOV1 activity or function. Specifically, the nucleic acids and polypeptides according to the invention may be used as targets for the identification of small molecules that modulate or inhibit, e.g., development and survival of certain sympathetic and sensory neurons in both the central and peripheral nervous systems. These molecules can be used to treat, e.g., proinflammatory disorder, immune disorder, and inflammatory disease.

In addition, the NOV1 nucleic acid and polypeptide according to the invention are useful, inter alia, as novel members of the protein families according to the presence of domains and sequence relatedness to previously described proteins. For example, the NOV1 nucleic acid and polypeptide include structural motifs that are characteristic of proteins belonging to the family of nerve growth factors such as the neurotrophin proteins. Nerve growth factor (NGF) is the prototype for the neurotrophin family of polypeptides which are essential in the developments and survival of certain sympathetic and sensory neurons in both the central and peripheral nervous systems. NGF was discovered when mouse sarcoma tissue transplants in chicken embryos caused an increase in the size of spinal ganglia.

The NOV1 nucleic acid and polypeptide, antibodies and related compounds according to the invention will be useful in therapeutic and diagnostic applications in the mediation of the peripheral and central nervous system. As such the NOV1 nucleic acid and polypeptide, antibodies and related compounds according to the invention may be used to treat immune and nervous system disorders, e.g., proinflammatory disorder, immune disorder, inflammatory disease, septic shock, arthritis, bone pain, or bone deformity.

The NOV1 nucleic acid and polypeptide are useful for detecting specific cell types. For example, expression analysis has demonstrated that a NOV1 nucleic acid is expressed in placenta and uterus.

Additional utilities for the NOV1 nucleic acid and polypeptide according to the invention are disclosed herein.

NOV2

The disclosed NOV2 nucleic acid (alternatively referred to herein as CG56275-01) encodes a novel Guanylate kinase-like protein and includes the 1336 nucleotide sequence (SEQ ID NO:3) shown in Table 2A. The novel NOV2 nucleic acid of the invention maps to chromosome 2.

An open reading frame for the mature protein was identified beginning with an ATG initiation codon at nucleotides 3–5, and ending with a TGA stop codon at nucleotides 1326–1328. Putative untranslated regions, if any, are found upstream from the initiation codon and downstream from the termination codon. The start and stop codons are in bold letters.

The NOV2 protein (SEQ ID NO:4) encoded by SEQ ID NO:3 is 441 amino acid residues in length and is presented using the one-letter amino acid code in Table 2B. The SignalP, Psort and/or Hydropathy results indicates that NOV2 has a signal peptide and is likely to be localized in the microbody (peroxisome) with a certainty of 0.3000. Alternatively, a NOV2 polypeptide is located to the nucleus with a certainty of 0.3000, the mitochondrial matrix space with a certainty of 0.1000, or the lysosome (lumen) with a certainty of 0.1000.

Small nucleotide polymorphisms (SNP) variants of NOV2 are disclosed in Example 2.

A search against the Patp database, a proprietary database that contains sequences published in patents and patent publication, yielded several homologous proteins shown in Table 2C.

In a BLAST search of public sequence databases, it was found, for example, that the NOV2 nucleic acid sequence of this invention has 313 of 392 bases (79%) identical to a gb:GENBANK-ID:AB30499|acc:AB030499.1 mRNA from Rattus norvegicus ( Rattus norvegicus mRNA for DLG6 alpha, complete cds). Further, the full amino acid sequence of the disclosed NOV2 protein of the invention has 346 of 441 amino acid residues (78%) identical to, and 380 of 441 amino acid residues (86%) similar to, the 441 amino acid residue ptnr:SPTREMBL-ACC:Q9QYH1 protein from Rattus norvegicus (Rat) (DLG6 ALPHA).

The NOV2 protein of the invention also has homolgy to the proteins shown in the BLASTP data in Table 2D.

A multiple sequence alignment is given in Table 2E, with the NOV2 protein of the invention being shown in line 1 in a ClustalW analysis comparing NOV2 with related protein sequences of Table 2D.

The presence of identifiable domains in the disclosed NOV2 protein was determined by using Pfam and then determining the Interpro number. The results are listed in Table 2F with the statistics and domain description.

Consistent with other known members of the guanylate kinase family of proteins, NOV2 contains guanylate kinase domains as illustrated in Table 2F.

The NOV2 nucleic acid, and the encoded polypeptide, according to the invention are useful in a variety of applications and contexts. For example, NOV2 nucleic acids and polypeptides can be used to identify proteins that are members of the guanylate kinase family of proteins. The NOV2 nucleic acids and polypeptides can also be used to screen for molecules, which inhibit or enhance NOV2 activity or function. Specifically, the nucleic acids and polypeptides according to the invention may be used as targets for the identification of small molecules that modulate or inhibit, e.g., cell signaling pathways, cell junction organization, or transmembrane regulation. These molecules can be used to treat, e.g., Von Hippel-Lindau (VHL) syndrome, diabetes, and tuberous sclerosis.

In addition, the NOV2 nucleic acid and polypeptide according to the invention are useful, inter alia, as novel members of the protein families according to the presence of domains and sequence relatedness to previously described proteins. For example, the NOV2 nucleic acid and polypeptide include structural motifs that are characteristic of proteins belonging to the family of kinases such as the guanylate kinase proteins. Guanylate kinase is a critical enzyme for biosynthesis of GTP and dGTP, and its role in nucleotide metabolism makes it a target for cancer chemotherapy. The structure of mouse guanylate kinase (gmk) includes an N-terminal ATP binding motif and a neighboring guanylate kinase signature sequence (GKSS). The low molecular mass cytosolic forms of guanylate kinase, such as gmk and guk1, are implicated in the regulation of the supply of guanine nucleotides to cell signaling pathways, while the related families of high molecular mass and membrane-associated forms of guanylate kinase, such as MAGUK, CASK, SAP102, ZO-1, and MAGI-1, have roles in cell junction organization and transmembrane regulation.

The NOV2 nucleic acid and polypeptide, antibodies and related compounds according to the invention will be useful in therapeutic and diagnostic applications in the mediation of biosynthesis and nucleotide metabolism. As such the NOV2 nucleic acid and polypeptide, antibodies and related compounds according to the invention may be used to treat genetic conditions, e.g., Von Hippel-Lindau (VHL) syndrome, diabetes, or tuberous sclerosis.

The NOV2 nucleic acid and polypeptide are useful for detecting specific cell types. For example, expression analysis has demonstrated that a NOV2 nucleic acid is expressed in synovium/synovial membrane.

Additional utilities for the NOV2 nucleic acid and polypeptide according to the invention are disclosed herein.

NOV3

The disclosed NOV3 nucleic acid (alternatively referred to herein as CG53400-01) encodes a novel hypothetical 85.6 kDa-like protein and includes the 3089 nucleotide sequence (SEQ ID NO:5) shown in Table 3A. The novel NOV3 nucleic acid of the invention maps to chromosome 12.

An open reading frame for the mature protein was identified beginning with an ATG initiation codon at nucleotides 48–50, and ending with a TAA stop codon at nucleotides 30273029. Putative untranslated regions, if any, are found upstream from the initiation codon and downstream from the termination codon. The start and stop codons are in bold letters.

The NOV3 protein (SEQ ID NO:6) encoded by SEQ ID NO:5 is 993 amino acid residues in length and is presented using the one-letter amino acid code in Table 3B. The SignalP, Psort and/or Hydropathy results indicate that NOV3 has no known signal peptide and is likely to be localized in the mitochondrial matrix space with a certainty of 0.5083. Alternatively, a NOV3 polypeptide is located to the nucleus with a certainty of 0.3000, the mitochondrial inner membrane with a certainty of 0.2317, or the mitochondrial intermembrane space with a certainty of 0.2217.

Included in the invention are variants of the parent clone NOV3 as shown below in Table 3C. These novel variants were derived by laboratory cloning of cDNA fragments coding for a domain of the full length form of NOV3 (CG53400-01), between residues 596 and 968.

A search against the Patp database, a proprietary database that contains sequences published in patents and patent publication, yielded several homologous proteins shown in Table 3D.

In a BLAST search of public sequence databases, it was found, for example, that the NOV3 nucleic acid sequence of this invention has 1552 of 2369 bases (65%) identical to a gb:GENBANK-ID:HSM801363|acc:AL133087.1 mRNA from Homo sapiens mRNA; cDNA DKFZp434D2328 (from clone DKFZp434D2328); partial cds. Further, the full amino acid sequence of the disclosed NOV3 protein of the invention has 498 of 791 amino acid residues (62%) identical to, and 600 of 791 amino acid residues (75%) similar to, the 791 amino acid residue ptnr:SPTREMBL-ACC:Q9UFA4 protein from Human (HYPOTHETICAL 85.6 KDA PROTEIN).

The NOV3 protein of the invention also has homolgy to the proteins shown in the BLASTP data in Table 3E.

A multiple sequence alignment is given in Table 3F, with the NOV3 protein of the invention being shown in line 1 in a ClustalW analysis comparing NOV3 with related protein sequences of Table 3E.

The presence of identifiable domains in the disclosed NOV3 protein was determined by using Pfam and then determining the Interpro number. The results are listed in Table 3G with the statistics and domain description.

Consistent with other known members of the 85.6 kDa family of proteins, NOV3 contains ankyrin domains as illustrated in Table 3G.

The NOV3 nucleic acid, and the encoded polypeptide, according to the invention are useful in a variety of applications and contexts. For example, NOV3 nucleic acids and polypeptides can be used to identify proteins that are members of the ankyrin family of proteins. The NOV3 nucleic acids and polypeptides can also be used to screen for molecules, which inhibit or enhance NOV3 activity or function. Specifically, the nucleic acids and polypeptides according to the invention may be used as targets for the identification of small molecules that modulate or inhibit, e.g., red blood cell formation/organization, or signal transduction/cell activation. These molecules can be used to treat, e.g., spherocytosis.

In addition, the NOV3 nucleic acid and polypeptide according to the invention are useful, inter alia, as novel members of the protein families according to the presence of domains and sequence relatedness to previously described proteins. For example, the NOV3 nucleic acid and polypeptide include structural motifs that are characteristic of proteins belonging to the family of transmembrane proteins/membrane skeleton proteins such as the ankyrin proteins. Ankyrin is a globular protein (200 kD) that links spectrin and an integral membrane protein (Band III) in the erythrocyte plasma membrane. Ankyrin belongs to a family of closely related polypeptides associated with the plasma membrane of cells in a variety of cell types (e.g. lymphocytes, platelets, fibroblasts and endothelial tissues). Ankyrin has been shown to underlie membrane proteins including CD44, the voltage-dependent sodium channel, NA+/K+ ATPase and the anion exchanger protein. Functional diversity between members of the ankyrin family is generated by the expression of multiple genes as well as alternative splicing of pre-mRna's. The formation of a direct connection between ankyrin and functionally important transmembrane proteins/membrane skeleton may be one of the earliest events to occur during signal transduction and cell activation.

The NOV3 nucleic acid and polypeptide, antibodies and related compounds according to the invention will be useful in therapeutic and diagnostic applications in the mediation of signal transduction or cell activation. As such the NOV3 nucleic acid and polypeptide, antibodies and related compounds according to the invention may be used to treat genetic conditions, e.g., endometriosis, fertility, adrenoleukodystrophy, congenital adrenal hyperplasia, diabetes, Von Hippel-Lindau (vhl) syndrome, pancreatitis, obesity, hyperparathyroidism, hypoparathyroidism, hyperthyroidism, hypothyroidism, SIDS, xerostomia, scleroderma, hypercalceimia, ulcers, cirrhosis, transplantation, inflammatory bowel disease, diverticular disease, hirschsprung's disease, crohn's disease, appendicitis, hemophilia, hypercoagulation, idiopathic thrombocytopenic purpura, autoimmume disease, allergies, immunodeficiencies, graft vesus host, anemia, ataxia-telangiectasia, lymphedema, tonsilitis, osteoporosis, hypercalceimia, arthritis, ankylosing spondylitis, scoliosis, tendinitis, muscular dystrophy, lesch-nyhan syndrome, myasthenia gravis, dental disease and infection, cardiomyopathy, atherosclerosis, hypertension, congenital heart defects, aortic stenosis, atrial septal defect (asd), atrioventricular (a-v) canal defect, ductus arteriosus, pulmonary stenosis, subaortic stenosis, ventricular septal defect (vsd), valve diseases, tuberous sclerosis, aneurysm, fibromuscular dysplasia, stroke, bleeding disorders, alzheimer's disease, parkinson's disease, huntington's disease, cerebral palsy, epilepsy, multiple sclerosis, ataxia-telangiectasia, leukodystrophies, behavioral disorders, addiction, anxiety, pain, neuroprotection, endocrine dysfunctions, growth and reproductive disorders, cystitis, incontinence, renal artery stenosis, interstitial nephritis, glomerulonephritis, polycystic kidney disease, systemic lupus erythematosus, renal tubular acidosis, iga nephropathy, or vesicoureteral reflux.

The NOV3 nucleic acid and polypeptide are useful for detecting specific cell types. For example, expression analysis has demonstrated that a NOV3 nucleic acid is expressed in adrenal gland/suprarenal gland, bone, brain, cartilage, cervix, coronary artery, platelets, kidney, kidney cortex, liver, mammary gland/breast, pancreas, placenta, salivary glands, spleen, synovium/synovial membrane, thymus, cerebral medulla/cerebral white matter, and left cerebellum.

Additional utilities for the NOV3 nucleic acid and polypeptide according to the invention are disclosed herein.

NOV4

The NOV4 proteins descibed herein are novel myotonic dystrophy kinase-related CDC42 binding kinase (MRCK)-like proteins. The NOV4 nucleic acids disclosed herein map to chromosome 11q13. Two alternative novel NOV4 nucleic acids and polypeptides are disclosed herein, namely NOV4a and NOV4b.

NOV4a

A NOV4 variant is NOV4a (alternatively referred to herein as CG56209-01), which encodes the 3835 nucleotide sequence (SEQ ID NO:7) shown in Table 4A. An open reading frame for the mature protein was identified beginning with an ATG codon at nucleotides 98–100 and ending with a TAG codon at nucleotides 3689–3691. Putative untranslated regions, if any, downstream from the termination codon and upstream from the initiation codon are underlined. The start and stop codons are in bold letters.

The NOV4a protein (SEQ ID NO:8) encoded by SEQ ID NO:7 is 1197 amino acid residues in length and is presented using the one-letter amino acid code in Table 4B. The SignalP, Psort and/or Hydropathy results indicate that NOV4a has no known signal peptide and is likely to be localized in the nucleus with a certainty of 0.7600. Alternatively, a NOV4a polypeptide is located to the microbody (peroxisome) with a certainty of 0.3114, the lysosome (lumen) with a certainty of 0.1772, or the mitochondrial matrix space with a certainty of 0.1000.

SNP variants of NOV4a are disclosed in Example 2.

NOV4b

Alternatively, a NOV4 variant is NOV4b (alternatively referred to herein as CG5620902), which includes the 3985 nucleotide sequence (SEQ ID NO:9) shown in Table 4C. An open reading frame for the mature protein was identified beginning with an ATG codon at nucleotides 98–100 and ending with a TAG codon at nucleotides 3839–3841. Putative untranslated regions, if any, downstream from the termination codon and upstream from the initiation codon are underlined. The start and stop codons are in bold letters.

The NOV4b protein (SEQ ID NO:10) encoded by SEQ ID NO:9 is 1247 amino acid residues in length and is presented using the one-letter amino acid code in Table 4D. The SignalP, Psort and/or Hydropathy results indicate that NOV4b has no known signal peptide and is likely to be localized in the nucleus with a certainty of 0.8800. Alternatively, a NOV4b polypeptide is located to the microbody (peroxisome) with a certainty of 0.3226, the lysosome (lumen) with a certainty of 0.1925, or the mitochondrial matrix space with a certainty of 0.1000.

NOV4 Clones

Unless specifically addressed as NOV4a or NOV4b, any reference to NOV4 is assumed to encompass all variants.

A search against the Patp database, a proprietary database that contains sequences published in patents and patent publication, yielded several homologous proteins shown in Table 4E.

In a BLAST search of public sequence databases, it was found, for example, that the NOV4a nucleic acid sequence of this invention has 865 of 865 bases (100%) identical to a gb:GENBANK-ID:HSMDPKIN|acc:Y12337.1 mRNA from H. sapiens mRNA for myotonic dystrophy protein kinase like protein. Further, the fall amino acid sequence of the disclosed NOV4a protein of the invention has 314 of 572 amino acid residues (54%) identical to, and 418 of 572 amino acid residues (73%) similar to, the 1732 amino acid residue ptnr:SPTREMBL-ACC:O54874 protein from Rattus norvegicus (Rat) (MYTONIC DYSTROPHY KINASE-RELATED CDC42-BINDING KINASE).

Additional BLAST results are shown in Table 4F.

A multiple sequence alignment is given in Table 4G, with the NOV4 proteins of the invention being shown in lines 1 and 2 in a ClustalW analysis comparing NOV4 with related protein sequences of Table 4F.

The presence of identifiable domains in the disclosed NOV4 protein was determined by using Pfam and then determining the Interpro number. The results are listed in Table 4H with the statistics and domain description.

Consistent with other known members of the myotonic dystrophy kinase-related Cdc42-binding kinases (MRCKs) family of proteins, NOV4 contains protein kinase domains as illustrated in Table 4H.

NOV4 nucleic acids, and the encoded polypeptides, according to the invention are useful in a variety of applications and contexts. For example, NOV4 nucleic acids and polypeptides can be used to identify proteins that are members of the protein kinase family of proteins. The NOV4 nucleic acids and polypeptides can also be used to screen for molecules, which inhibit or enhance NOV4 activity or function. Specifically, the nucleic acids and polypeptides according to the invention may be used as targets for the identification of small molecules that modulate or inhibit, e.g., cytoskeletal reorganization or molecular switch mechanisms. These molecules can be used to treat, e.g., myotonic dystrophy, myotonic dystrophy type 2, proximal myotonic myopathy, or proximal myotonic dystrophy.

In addition, various NOV4 nucleic acids and polypeptides according to the invention are useful, inter alia, as novel members of the protein families according to the presence of domains and sequence relatedness to previously described proteins. For example, the NOV4 nucleic acids and their encoded polypeptides include structural motifs that are characteristic of proteins belonging to the family of protein kinases such as the MRCK protein. MRCK is a Ser/Thr kinase that is highly related to myotonic dystrophy kinase and ROKs. MRCK contains an N-terminal kinase domain, a coiled-coil region, a cysteine-rich domain (CR), a pleckstrin-like domain (PH), and a C-terminal p21 GTPase-binding domain (GBD). Two different MRCK genes are expressed in rat. MRCKa mRNA is enriched in brain and lung, while MRCKb mRNA is expressed in lung and kidney. MRCKa phosphorylates Ser/Thr residues in myelin basic protein, histone H1, and non-muscle myosin regulatory light chain. In HeLa cells, expression of kinase-dead MRCKa blocks Cdc42-dependent formation of focal complexes and peripheral microspikes, while in PC12 cells MRCKa may act downstream of Cdc42 and Rac1 to promote neurite outgrowth.

The NOV4 nucleic acids and polypeptides, antibodies and related compounds according to the invention will be useful in therapeutic and diagnostic applications in the mediation of cell migration and differentiation. As such the NOV4 nucleic acids and polypeptides, antibodies and related compounds according to the invention may be used to treat muscle, or cell migration disorders, e.g., myotonic dystrophy, myotonic dystrophy type 2, proximal myotonic myopathy, proximal myotonic dystrophy, neuromuscular diseases associated with cardiomyopathy, multiple endocrine neoplasia type 1(MEN1), insulin dependent diabetes mellitus, familial paraganglioma type 2, spinocerebellar ataxia type 5, Bardet-Biedl syndrome, non-hodgkins lymphoma, cancers such as breast cancer, liver, lung, pancrease, and prostate cancers.

The NOV4 nucleic acids and polypeptides are useful for detecting specific cell types. For example, expression analysis has demonstrated that a NOV4 nucleic acid is expressed in adrenal gland, bone marrow, brain—amygdala, brain—cerebellum, brain—hippocampus, brain—substantia nigra, brain—thalamus, brain—whole, fetal brain, fetal kidney, fetal liver, fetal lung, heart, kidney, lymphoma—Raji, mammary gland, pancreas, pituitary gland, placenta, prostate, salivary gland, skeletal muscle, small intestine, spinal cord, spleen, stomach, testis, thyroid, trachea, and uterus.

Additional utilities for NOV4 nucleic acids and polypeptides according to the invention are disclosed herein.

NOV5

The disclosed NOV5 nucleic acid (alternatively referred to herein as CG56288-01) encodes a novel S100 calcium binding-like protein and includes the 332 nucleotide sequence (SEQ ID NO:11) shown in Table 5A. Although SignalP, Psort and/or hydropathy suggest that the S100 Calcium Binding Protein-like protein may be localized in the cytoplasm, the protein predicted here is similar to the S100 Calcium Binding Protein family, some members of which are secreted. Therefore it is likely that this novel S100 Calcium Binding Protein-like protein is available at the same sub-cellular localization and hence accessible to a diagnostic probe and for various therapeutic applications.

An open reading frame for the mature protein was identified beginning with an ATG initiation codon at nucleotides 8–10, and ending with a TGA stop codon at nucleotides 320–322. Putative untranslated regions, if any, are found upstream from the initiation codon and downstream from the termination codon. The start and stop codons are in bold letters.

The NOV5 protein (SEQ ID NO:12) encoded by SEQ ID NO:11 is 104 amino acid residues in length and is presented using the one-letter amino acid code in Table 5B. The SignalP, Psort and/or Hydropathy results indicate that NOV5 has no known signal peptide and is likely to be localized in the mitochondrial matrix space with a certainty of 0.5964. Alternatively, a NOV5 polypeptide is located to the mitochondrial inner membrane with a certainty of 0.3037, the mitochondrial intermembrane space with a certainty of 0.3037, or the mitochondrial outer membrane with a certainty of 0.3037.

A search against the Patp database, a proprietary database that contains sequences published in patents and patent publication, yielded several homologous proteins shown in Table 5C.

In a BLAST search of public sequence databases, it was found, for example, that the NOV5 nucleic acid sequence of this invention has 305 of 335 bases (91%) identical to a gb:GENBANK-ID:HUMS100CP1|acc:D49355.1 mRNA from Human mRNA for S100C protein, complete cds. Further, the full amino acid sequence of the disclosed NOV5 protein of the invention has 102 of 103 amino acid residues (99%) identical to, and 102 of 103 amino acid residues (99%) similar to, the 104 amino acid residue ptnr:SPTREMBL-ACC:Q9UDP3 protein from Human (WUGSC:_H0456N16.1 PROTEIN).

The NOV5 protein of the invention also has homolgy to the proteins shown in the BLASTP data in Table 5D.

A multiple sequence alignment is given in Table 5E, with the NOV5 protein of the invention being shown in line 1 in a ClustalW analysis comparing NOV5 with related protein sequences of Table 5D.

The presence of identifiable domains in the disclosed NOV5 protein was determined by using Pfam and then determining the Interpro number. The results are listed in Table 5F with the statistics and domain description.

Consistent with other known members of the S100 family of proteins, NOV5 contains S100 calcium binding domains as illustrated in Table 5F.

The NOV5 nucleic acid, and the encoded polypeptide, according to the invention are useful in a variety of applications and contexts. For example, NOV5 nucleic acids and polypeptides can be used to identify proteins that are members of the S100 family of proteins. The NOV5 nucleic acids and polypeptides can also be used to screen for molecules, which inhibit or enhance NOV5 activity or function. Specifically, the nucleic acids and polypeptides according to the invention may be used as targets for the identification of small molecules that modulate or inhibit, e.g., calcium regulation. These molecules can be used to treat, e.g., various cancers like breast, lung, or colorectal.

In addition, the NOV5 nucleic acid and polypeptide according to the invention are useful, inter alia, as novel members of the protein families according to the presence of domains and sequence relatedness to previously described proteins. For example, the NOV5 nucleic acid and polypeptide include structural motifs that are characteristic of proteins belonging to the family of S100 proteins. S100 proteins are expressed in a cell-type specific manner in higher organisms, including humans, and are involved in the calcium-regulated control of very diverse cellular processes. Proteins of the S100 family belong to the large group of EF-hand calcium-binding proteins.

The NOV5 nucleic acid and polypeptide, antibodies and related compounds according to the invention will be useful in therapeutic and diagnostic applications in the mediation of calcium regulation. As such the NOV5 nucleic acid and polypeptide, antibodies and related compounds according to the invention may be used to treat genetic conditions, e.g., various cancers like breast, lung, and colorectal, as well as heart disease such as myocardial ischemia.

The NOV5 nucleic acid and polypeptide are useful for detecting specific cell types. For example, expression analysis has demonstrated that a NOV5 nucleic acid is expressed in elevated levels in colorectal cancers compared with that of normal colorectal mucosa, as well as in breast cancer-derived metastatic axillary lymph nodes, but not in normal lymph nodes or breast fibroadenomas. Accordingly, the NOV5 nucleic acids and polypeptides, antibodies and related compounds according to the invention will have diagnostic and therapeutic applications in the detection of cancer, e.g., breast or colorectal cancer. A NOV5 nucleic acid is also expressed in brain, lung, smooth muscle and keratinocyte tissue.

Additional utilities for the NOV5 nucleic acid and polypeptide according to the invention are disclosed herein.

NOV6

The disclosed NOV6 nucleic acid (alternatively referred to herein as CG56048-01) encodes a novel olfactory receptor-like protein/G-protein coupled receptor (GPCR) protein and includes the 11121 nucleotide sequence (SEQ ID NO:13) shown in Table 6A.

An open reading frame for the mature protein was identified beginning with an ATG initiation codon at nucleotides 30–32, and ending with a TAG stop codon at nucleotides 1119–1121. Putative untranslated regions, if any, are found upstream from the initiation codon and downstream from the termination codon. The start and stop codons are in bold letters.

The NOV6 protein (SEQ ID NO:14) encoded by SEQ ID NO:13 is 363 amino acid residues in length and is presented using the one-letter amino acid code in Table 6B. The SignalP, Psort and/or Hydropathy results indicate that NOV6 has a signal peptide and is likely to be localized in the plasma membrane with a certainty of 0.6000. Alternatively, a NOV6 polypeptide is located to the Golgi body with a certainty of 0.4000, the endoplasmic reticulum (membrane) with a certainty of 0.3000, or the mitochondrial inner membrane with a certainty of 0.0300. The SignalP indicates a likely cleavage site for a NOV6 polypeptide is between positions 41 and 42, i.e., at the dash in the sequence CFG-NL.

SNP variants of NOV6 are disclosed in Example 2.

A search against the Patp database, a proprietary database that contains sequences published in patents and patent publication, yielded several homologous proteins shown in Table 6C.

In a BLAST search of public sequence databases, it was found, for example, that the NOV6 nucleic acid sequence of this invention has 723 of 1057 bases (68%) identical to a gb:GENBANK-ID:AF190500|acc:AF190500.1 mRNA from Homo sapiens leucine-rich repeat-containing G protein-coupled receptor 7 (LGR7) mRNA, complete cds. Further, the fall amino acid sequence of the disclosed NOV6 protein of the invention has 203 of 339 amino acid residues (59%) identical to, and 271 of 339 amino acid residues (79%) similar to, the 757 amino acid residue ptnr:TREMBLNEW-ACC:AAG17167 protein from Human (LEUCINE-RICH REPEAT-CONTAINING G PROTEIN-COUPLED RECEPTOR 7).

The NOV6 protein of the invention also has homolgy to the proteins shown in the BLASTP data in Table 6D.

A multiple sequence alignment is given in Table 6E, with the NOV6 protein of the invention being shown in line 1 in a ClustalW analysis comparing NOV6 with related protein sequences of Table 6D.

The presence of identifiable domains in the disclosed NOV6 protein was determined by using Pfam and then determining the Interpro number. The results are listed in Table 6F with the statistics and domain description.

Consistent with other known members of the olfactory receptor family of proteins, NOV6 contains 7-transmembrane domains as illustrated in Table 6F.

The NOV6 nucleic acid, and the encoded polypeptide, according to the invention are useful in a variety of applications and contexts. For example, NOV6 nucleic acids and polypeptides can be used to identify proteins that are members of the olfactory receptor family of proteins. The NOV6 nucleic acids and polypeptides can also be used to screen for molecules, which inhibit or enhance NOV6 activity or function. Specifically, the nucleic acids and polypeptides according to the invention may be used as targets for the identification of small molecules that modulate or inhibit, e.g., cellular recognition, or G-protein-mediated transduction of odorant signals. These molecules can be used to treat, e.g., taste and scent detectability disorders, immune diseases, or signal transduction pathways.

In addition, the NOV6 nucleic acid and polypeptide according to the invention are useful, inter alia, as novel members of the protein families according to the presence of domains and sequence relatedness to previously described proteins. For example, the NOV6 nucleic acid and polypeptide include structural motifs that are characteristic of proteins belonging to the family of olfactory receptor proteins. Olfactory receptors have great variety, exquisite specificity, high sensitivity and fast response. The human olfactory epithelium contains two to three thousand distinct olfactory receptors, a class of G-protein coupled receptors. The receptors consist of seven hydrophobic segments that span the cell membrane (trans-membrane domains I–VII), separated by hydrophilic segments that project into the intra- or extra-cellular space. Transmembrane domains II–VII comprise a hypervariable segment that defines the ligand specificity of the receptor.

The NOV6 nucleic acid and polypeptide, antibodies and related compounds according to the invention will be useful in therapeutic and diagnostic applications in the mediation of signal transduction. As such the NOV6 nucleic acid and polypeptide, antibodies and related compounds according to the invention may be used to treat, e.g., developmental diseases, MHC II and III diseases (immune diseases), taste and scent detectability disorders, Burkitt's lymphoma, corticoneurogenic disease, signal transduction pathway disorders, retinal diseases including those involving photoreception, cell growth rate disorders, cell shape disorders, feeding disorders, control of feeding, potential obesity due to over-eating, potential disorders due to starvation (lack of apetite), noninsulin-dependent diabetes mellitus (NIDDM1), bacterial, fungal, protozoal and viral infections (particularly infections caused by HIV-1 or HIV-2), pain, cancer (including but not limited to neoplasm, adenocarcinoma, lymphoma, prostate cancer, uterus cancer), anorexia, bulimia, asthma, parkinson's disease, acute heart failure, hypotension, hypertension, urinary retention, osteoporosis, crohn's disease, multiple sclerosis, and treatment of albright hereditary ostoeodystrophy, angina pectoris, myocardial infarction, ulcers, asthma, allergies, benign prostatic hypertrophy, and psychotic and neurological disorders, including anxiety, schizophrenia, manic depression, delirium, dementia, severe mental retardation, dentatorubro-pallidoluysian atrophy(DRPLA) hypophosphatemic rickets, autosomal dominant (2) acrocallosal syndrome and dyskinesias, such as huntington's disease or gilles de la tourette syndrome. The NOV6 nucleic acid and polypeptide are useful for detecting specific cell types. For example, expression analysis has demonstrated that a NOV6 nucleic acid is predominantly expressed in olfactory epithelium and taste receptor cells of the tongue.

Additional utilities for the NOV6 nucleic acid and polypeptide according to the invention are disclosed herein.

NOV7

The NOV7 proteins descibed herein are novel carbonate dehydratase-like proteins. The NOV7 nucleic acids disclosed herein map to chromosome 15. Two alternative novel NOV7 nucleic acids and polypeptides are disclosed herein, namely NOV7a and NOV7b.

NOV7a

A NOV7 variant is NOV7a (alternatively referred to herein as CG50365-01), which encodes the 828 nucleotide sequence (SEQ ID NO:15) shown in Table 7A. An open reading frame for the mature protein was identified beginning with an ATG codon at nucleotides 16–18 and ending with a TAA codon at nucleotides 802–804. Putative untranslated regions, if any, downstream from the termination codon and upstream from the initiation codon are underlined. The start and stop codons are in bold letters.

The NOV7a protein (SEQ ID NO:16) encoded by SEQ ID NO:15 is 262 amino acid residues in length and is presented using the one-letter amino acid code in Table 7B. The SignalP, Psort and/or Hydropathy results indicate that NOV7a has no known signal peptide and is likely to be localized in the microbody peroxisome) with a certainty of 0.7480. Alternatively, a NOV7a polypeptide is located to the mitochondrial matrix space with a certainty of 0.1000, the lysosome (lumen) with a certainty of 0.1000, or the endoplasmic reticulum (membrane) with a certainty of 0.1000.

NOV7b

Alternatively, a NOV7 variant is NOV7b (alternatively referred to herein as CG50365-02), which includes the 833 nucleotide sequence (SEQ ID NO:17) shown in Table 7C. An open reading frame for the mature protein was identified beginning with an ATG codon at nucleotides 21–23 and ending with a TAA codon at nucleotides 807–809. Putative untranslated regions, if any, downstream from the termination codon and upstream from the initiation codon are underlined. The start and stop codons are in bold letters.

The NOV7b protein (SEQ ID NO:18) encoded by SEQ ID NO:17 is 262 amino acid residues in length and is presented using the one-letter amino acid code in Table 7D. The SignalP, Psort and/or Hydropathy results indicate that NOV7b has no known signal peptide and is likely to be localized in the microbody (peroxisome) with a certainty of 0.7480. Alternatively, a NOV7b polypeptide is located to the mitochondrial matrix space with a certainty of 0.1000, the lysosome (lumen) with a certainty of 0.1000, or the endoplasmic reticulum (membrane) with a certainty of 0.1000.

NOV7 Clones

Unless specifically addressed as NOV7a or NOV7b, any reference to NOV7 is assumed to encompass all variants.

A search against the Patp database, a proprietary database that contains sequences published in patents and patent publication, yielded several homologous proteins shown in Table 7E.

In a BLAST search of public sequence databases, it was found, for example, that the NOV7a nucleic acid sequence of this invention has 551 of 793 bases (69%) identical to a gb:GENBANK-ID:HUMCAIX|acc:M33987.1 mRNA from Human carbonic anhydrase I (CAI) mRNA, complete cds. Further, the full amino acid sequence of the disclosed NOV7a protein of the invention has 160 of 257 amino acid residues (62%) identical to, and 197 of 257 amino acid residues (76%) similar to, the 260 amino acid residue ptnr:SWISSPROT-ACC:Q92051 protein from Brachydanio rerio (Zebrafish) ( Zebra danio ) (CARBONIC ANHYDRASE (EC 4.2.1.1) (CARBONATE DEHYDRATASE)).

In a similar BLAST search of public sequence databases, it was found, for example, that the NOV7b nucleic acid sequence of this invention has 549 of 789 bases (69%) identical to a gb:GENBANK-ID:HSCAIR|acc:X05014.1 mRNA from Human cDNA for carbonic anhydrase I. Further, the fall amino acid sequence of the disclosed NOV7b protein of the invention has 156 of 261 amino acid residues (59%) identical to, and 202 of 261 amino acid residues (77%) similar to, the 261 amino acid residue ptnr:pir-id:CRHU1 protein from human (carbonate dehydratase (EC 4.2.1.1) [validated]).

Additional BLAST results are shown in Table 7F.

A multiple sequence alignment is given in Table 7G, with the NOV7 proteins of the invention being shown in lines 1 and 2 in a ClustalW analysis comparing NOV7 with related protein sequences of Table 7F.

The presence of identifiable domains in the disclosed NOV7 protein was determined by using Pfam and then determining the Interpro number. The results are listed in Table 7H with the statistics and domain description.

Consistent with other known members of the carbonate dehydratase family of proteins, NOV7 contains carbonic anhydrase domains as illustrated in Table 7H.

NOV7 nucleic acids, and the encoded polypeptides, according to the invention are useful in a variety of applications and contexts. For example, NOV7 nucleic acids and polypeptides can be used to identify proteins that are members of the carbonate dehydratase family of proteins. The NOV7 nucleic acids and polypeptides can also be used to screen for molecules, which inhibit or enhance NOV7 activity or function. Specifically, the nucleic acids and polypeptides according to the invention may be used as targets for the identification of small molecules that modulate or inhibit, e.g., a variety of biological processes such as respiration, calcification, acid-base balance, bone resorption and the formation of aqueous humor, cerebrospinal fluid, saliva, and gastric acid. These molecules can be used to treat, e.g., hypertension, asthma, or emphysema.

In addition, various NOV7 nucleic acids and polypeptides according to the invention are useful, inter alia, as novel members of the protein families according to the presence of domains and sequence relatedness to previously described proteins. For example, the NOV7 nucleic acids and their encoded polypeptides include structural motifs that are characteristic of proteins belonging to the lyase family such as the carbonic dehydratase protein. Carbonic dehydratase is an enzyme that catalyzes the equilibration of dissolved carbon dioxide and carbonic acid, speeding the movement of carbon dioxide from tissues to blood to alveolar air. It is a zinc metalloenzyme of great physiological importance.

The NOV7 nucleic acids and polypeptides, antibodies and related compounds according to the invention will be useful in therapeutic and diagnostic applications in the mediation of CO2 transport. As such the NOV7 nucleic acids and polypeptides, antibodies and related compounds according to the invention may be used to treat respiratory or CO2 transport disorders, e.g., lung cancer, hypertension, asthma, emphysema, or diabetes.

The NOV7 nucleic acids and polypeptides are useful for detecting specific cell types. For example, expression analysis has demonstrated that a NOV7 nucleic acid is expressed in lung.

Additional utilities for NOV7 nucleic acids and polypeptides according to the invention are disclosed herein.

NOV8

The NOV8 proteins descibed herein are novel carboxypeptidase-like proteins. The NOV8 nucleic acids disclosed herein map to chromosome 2. Four alternative novel NOV8 nucleic acids and polypeptides are disclosed herein, namely NOV8a, NOV8b, NOV8c and NOV8d.

NOV8a

A NOV8 variant is NOV8a (alternatively referred to herein as CG55794-01), which encodes the 1196 nucleotide sequence (SEQ ID NO:19) shown in Table 8A. An open reading frame for the mature protein was identified beginning with an ATG codon at nucleotides 16–18 and ending with a TAA codon at nucleotides 1138–1140. Putative untranslated regions, if any, downstream from the termination codon and upstream from the initiation codon are underlined. The start and stop codons are in bold letters.

The NOV8a protein (SEQ ID NO:20) encoded by SEQ ID NO:19 is 374 amino acid residues in length and is presented using the one-letter amino acid code in Table 8B. The SignalP, Psort and/or Hydropathy results indicate that NOV8a has a signal peptide and is likely to be localized extracellularly at the plasma membrane with a certainty of 0.9190. Alternatively, a NOV8a polypeptide is located to the lysosome (membrane) with a certainty of 0.2000, the microbody (peroxisome) with a certainty of 0.1292, or the endoplasmic reticulum (membrane) with a certainty of 0.1000. The SignalP indicates a likely cleavage site for a NOV8a peptide is between positions 20 and 21, i.e., at the dash in the sequence GLG-YD.

SNP variants of NOV8a are disclosed in Example 2.

NOV8b

Alternatively, a NOV8 variant is NOV8b (alternatively referred to herein as CG5579403), which includes the 1222 nucleotide sequence (SEQ ID NO:21) shown in Table 8C. An open reading frame for the mature protein was identified beginning with an ATG codon at nucleotides 41–43 and ending with a TAA codon at nucleotides 1163–1165. Putative untranslated regions, if any, downstream from the termination codon and upstream from the initiation codon are underlined. The start and stop codons are in bold letters.

The NOV8b protein (SEQ ID NO:22) encoded by SEQ ID NO:21 is 347 amino acid residues in length and is presented using the one-letter amino acid code in Table 8D. The SignalP, Psort and/or Hydropathy results indicate that NOV8b has a signal peptide and is likely to be localized extracellularly at the plasma membrane with a certainty of 0.9190. Alternatively, a NOV8b polypeptide is located to the lysosome (membrane) with a certainty of 0.2000, the microbody (peroxisome) with a certainty of 0.1345, or the endoplasmic reticulum (membrane) with a certainty of 0.1000. The SignalP indicates a likely cleavage site for a NOV8b peptide is between positions 20 and 21, i.e., at the dash in the sequence GLG-YD.

NOV8c

Alternatively, a NOV8 variant is NOV8c (alternatively referred to herein as CG55794-06), which includes the 977 nucleotide sequence (SEQ ID NO:23) shown in Table 8E. An open reading frame for the mature protein was identified beginning with an ATG codon at nucleotides 41–43 and ending with a TAG codon at nucleotides 671–673. Putative untranslated regions, if any, downstream from the termination codon and upstream from the initiation codon are underlined. The start and stop codons are in bold letters.

The NOV8c protein (SEQ ID NO:24) encoded by SEQ ID NO:23 is 210 amino acid residues in length and is presented using the one-letter amino acid code in Table 8F. The SignalP, Psort and/or Hydropathy results indicate that NOV8c has a signal peptide and is likely to be localized extracellularly at the plasma membrane with a certainty of 0.3700. Alternatively, a NOV8c polypeptide is located to the microbody (peroxisome) with a certainty of 0.2242, the lysosome (lumen) with a certainty of 0.1900, or the endoplasmic reticulum (membrane) with a certainty of 0.1000. The SignalP indicates a likely cleavage site for a NOV8c peptide is between positions 20 and 21, i.e., at the dash in the sequence GLG-YD.

NOV8d

Alternatively, a NOV8 variant is NOV8d (alternatively referred to herein as CG55794-07), which includes the 1378 nucleotide sequence (SEQ ID NO:25) shown in Table 8G. An open reading frame for the mature protein was identified beginning with an ATG codon at nucleotides 259–261 and ending with a TAA codon at nucleotides 1225–1227. Putative untranslated regions, if any, downstream from the termination codon and upstream from the initiation codon are underlined. The start and stop codons are in bold letters.

The NOV8d protein (SEQ ID NO:26) encoded by SEQ ID NO:25 is 322 amino acid residues in length and is presented using the one-letter amino acid code in Table 8H. The SignalP, Psort and/or Hydropathy results indicate that NOV8d has no known signal peptide and is likely to be localized in the cytoplasm at the endoplasmic reticulum (membrane) with a certainty of 0.8500. Alternatively, a NOV8d polypeptide is located to the microbody (peroxisome) with a certainty of 0.4781, the plasma membrane with a certainty of 0.4400, or the mitochondrial inner membrane with a certainty of 0.1000.

NOV8 Clones

Unless specifically addressed as NOV8a, NOV8b, NOV8c, or NOV8d any reference to NOV8 is assumed to encompass all variants.

A search against the Patp database, a proprietary database that contains sequences published in patents and patent publication, yielded several homologous proteins shown in Table 8I

In a BLAST search of public sequence databases, it was found, for example, that the NOV8a nucleic acid sequence of this invention has 584 of 914 bases (63%) identical to a gb:GENBANK-ID:AF190274|acc:AF190274.1 mRNA from Bothrops jararaca (Bothrops jararaca carboxypeptidase homolog mRNA, complete cds). Further, the full amino acid sequence of the disclosed NOV8a protein of the invention has 151 of 325 amino acid residues (46%) identical to, and 219 of 325 amino acid residues (67%) similar to, the 416 amino acid residue ptnr:SPTREMBL-ACC:Q9PUF2 protein from Bothrops jararaca (Jararaca) (CARBOXYPEPTIDASE HOMOLOG).

In a similar BLAST search of public sequence databases, it was found, for example, that the NOV8b nucleic acid sequence of this invention has 586 of 914 bases (64%) identical to a gb:GENBANK-ID:AF190274|acc:AF190274.1 mRNA from Bothrops jararaca (Bothrops jararaca carboxypeptidase homolog mRNA, complete cds). Further, the full amino acid sequence of the disclosed NOV8b protein of the invention has 152 of 325 amino acid residues (46%) identical to, and 219 of 325 amino acid residues (67%) similar to, the 416 amino acid residue ptnr:SPTREMBL-ACC:Q9PUF2 protein from Bothrops jararaca (Jararaca) (CARBOXYPEPTIDASE HOMOLOG).

In a further BLAST search of public sequence databases, it was found, for example, that the NOV8c nucleic acid sequence of this invention has 621 of 672 bases (92%) identical to a gb:GENBANK-ID:AX083139|acc:AX083139.1 mRNA from Homo sapiens (Sequence 42 from Patent WO0110903). Further, the full amino acid sequence of the disclosed NOV8d protein of the invention has 83 of 176 amino acid residues (47%) identical to, and 122 of 176 amino acid residues (69%) similar to, the 422 amino acid residue ptnr:SPTREMBL-ACC:Q9EQV9 protein from Rattus norvegicus (Rat) (PRE-PROCARBOXYPEPTIDASE R).

In yet a further BLAST search of public sequence databases, it was found, for example, that the NOV8d nucleic acid sequence of this invention has 1073 of 1077 bases (99%) identical to a gb:GENBANK-ID:AX083139|acc:AX083139.1 mRNA from Homo sapiens (Sequence 42 from Patent WO0110903). Further, the full amino acid sequence of the disclosed NOV8d protein of the invention has 142 of 283 amino acid residues (50%) identical to, and 199 of 283 amino acid residues (70%) similar to, the 416 amino acid residue ptnr:SPTREMBL-ACC:Q9PUF2 protein from Bothrops jararaca (Jararaca) (CARBOXYPEPTIDASE HOMOLOG).

Additional BLAST results are shown in Table 8J.

A multiple sequence alignment is given in Table 8K, with the NOV8 proteins of the invention being shown in lines 1 through 4 in a ClustalW analysis comparing NOV8 with related protein sequences of Table 8J.

The presence of identifiable domains in the disclosed NOV8 protein was determined by using Pfam and then determining the Interpro number. The results are listed in Table 8L with the statistics and domain description.

Consistent with other known members of the carboxypeptidase family of proteins, NOV8 contains a zinc carboxypeptidase domain as illustrated in Table 8L.

NOV8 nucleic acids, and the encoded polypeptides, according to the invention are useful in a variety of applications and contexts. For example, NOV8 nucleic acids and polypeptides can be used to identify proteins that are members of the carboxypeptidase family of proteins. The NOV8 nucleic acids and polypeptides can also be used to screen for molecules, which inhibit or enhance NOV8 activity or function. Specifically, the nucleic acids and polypeptides according to the invention may be used as targets for the identification of small molecules that modulate or inhibit, e.g., digestion or hydrolysis of polypeptide chains. These molecules can be used to treat, e.g., pancreatitis, ulcers, inflammatory bowel disease, diverticular disease, Crohn's disease, appendicitis, or obesity.

In addition, various NOV8 nucleic acids and polypeptides according to the invention are useful, inter alia, as novel members of the protein families according to the presence of domains and sequence relatedness to previously described proteins. For example, the NOV8 nucleic acids and their encoded polypeptides include structural motifs that are characteristic of proteins belonging to the carboxypeptidase family. Carboxypeptidase B, (CPB) like carboxypeptidase A, is a pancreatic exopeptidase. Unlike carboxypeptidase A, however, carboxypeptidase B catalyzes the hydrolysis of the peptide bonds involving basic amino acids lysine, arginine and ornithine. This hydrolysis occurs at the C-terminal bond in these polypeptides.

The NOV8 nucleic acids and polypeptides, antibodies and related compounds according to the invention will be useful in therapeutic and diagnostic applications in the mediation of hydrolysis. As such the NOV8 nucleic acids and polypeptides, antibodies and related compounds according to the invention may be used to treat digestive disorders, e.g., xerostomia, hypercalceimia, ulcers, Von Hippel-Lindau (VHL) syndrome, cirrhosis, transplantation, inflammatory bowel disease, diverticular disease, hirschsprang's disease, crohn's disease, appendicitis, stroke, tuberous sclerosis, anxiety, pain, endocrine dysfunctions, nueroprotection, diabetes, obesity, growth and reproductive disorders, myasthenia gravis.

The NOV8 nucleic acids and polypeptides are useful for detecting specific cell types. For example, expression analysis has demonstrated that a NOV8 nucleic acid is expressed in pooled mammalian tissue, small intestine, and spinal cord.

Additional utilities for NOV8 nucleic acids and polypeptides according to the invention are disclosed herein.

NOV9

The disclosed NOV9 nucleic acid (alternatively referred to herein as CG56463–01) encodes a novel neurotransmitter receptor-like protein and includes the 1142 nucleotide sequence (SEQ ID NO:27) shown in Table 9A. The NOV9 nucleic acid disclosed herein maps to chromosome 6p23.

An open reading frame for the mature protein was identified beginning with an GCT codon at nucleotides 3–5, and ending with a TAA stop codon at nucleotides 1020–1022. Putative untranslated regions, if any, are found upstream from the initiation codon and downstream from the termination codon. The start and stop codons are in bold letters.

The NOV9 protein (SEQ ID NO:28) encoded by SEQ ID NO:27 is 339 amino acid residues in length and is presented using the one-letter amino acid code in Table 9B. The SignalP, Psort and/or Hydropathy results indicate that NOV9 has a signal peptide and is likely to be localized in the plasma membrane with a certainty of 0.6000. Alternatively, a NOV9 polypeptide is located to the Golgi body with a certainty of 0.4000, the endoplasmic reticulum (membrane) with a certainty of 0.3000, or the mitochondrial inner membrane with a certainty of 0.0300. The SignalP indicates a likely cleavage site for a NOV9 polypeptide is between positions 47 and 48, i.e., at the dash in the sequence MIA-IL.

SNP variants of NOV9 are disclosed in Example 2.

A search against the Patp database, a proprietary database that contains sequences published in patents and patent publication, yielded several homologous proteins shown in Table 9C.

In a BLAST search of public sequence databases, it was found, for example, that the NOV9 nucleic acid sequence of this invention has 601 of 1000 bases (60%) identical to a gb:GENBANK-ID:AR035954|acc:AR035954.1 mRNA from Unknown. (Sequence 1 from patent U.S. Pat. No. 5,871,967). Further, the full amino acid sequence of the disclosed NOV9 protein of the invention has 152 of 330 amino acid residues (46%) identical to, and 216 of 330 amino acid residues (65%) similar to, the 337 amino acid residue ptnr:SPTREMBL-ACC:O14804 protein from Human (PUTATIVE NEUROTRANSMITTER RECEPTOR).

The NOV9 protein of the invention also has homolgy to the proteins shown in the BLASTP data in Table 9D.

A multiple sequence alignment is given in Table 9E, with the NOV9 protein of the invention being shown in line 1 in a ClustalW analysis comparing NOV9 with related protein sequences of Table 9D.

The presence of identifiable domains in the disclosed NOV9 protein was determined by using Pfam and then determining the Interpro number. The results are listed in Table 9F with the statistics and domain description.

Consistent with other known members of the neurotransmitter recpetor family of proteins, NOV9 contains 7-transmembrane domains as illustrated in Table 9F.

The NOV9 nucleic acid, and the encoded polypeptide, according to the invention are useful in a variety of applications and contexts. For example, NOV9 nucleic acids and polypeptides can be used to identify proteins that are members of the neurotransmitter receptor family of proteins. The NOV9 nucleic acids and polypeptides can also be used to screen for molecules, which inhibit or enhance NOV9 activity or function. Specifically, the nucleic acids and polypeptides according to the invention may be used as targets for the identification of small molecules that modulate or inhibit, e.g., cellular recognition, or G-protein-mediated transduction of neuromuscular/synaptic signals. These molecules can be used to treat, e.g., neurological disorders, immune diseases, or signal transduction pathways.

In addition, the NOV9 nucleic acid and polypeptide according to the invention are useful, inter alia, as novel members of the protein families according to the presence of domains and sequence relatedness to previously described proteins. For example, the NOV9 nucleic acid and polypeptide include structural motifs that are characteristic of proteins belonging to the family of neurotransmitter receptor proteins. Nerve cells are highly specialized for cell-to-cell communication. A number of small molecules called neurotransmitters act as the actual signals, released from one nerve cell only to dock on another cell. There are numerous subtypes of receptor for any given neurotransmitter. Docking molecules, or receptors, act as gates, triggered by the neurotransmitter. When a neurotransmitter molecule fits into a receptor, it typically opens the gate, allowing ions to travel through the cell's membrane. The ions, in turn, excite the cell. If the receiving cell is a nerve cell, this excitation can lead to release of its own neurotransmitters.

The vast majority of neurotransmitter receptors belong to a class of proteins known as the serpentine receptors. This class exhibits a characteristic transmembrane structure: spaning the cell membrane, seven times. The link between neurotransmitters and intracellular signaling is carried out by association either with G-proteins (small GTP-binding and hydrolyzing proteins) or with protein kinases, or by the receptor itself in the form of a ligand-gated ion channel (for example, the acetylcholine receptor). An additional characteristic of neurotransmitter receptors is that they are subject to ligand-induced desensitization: such that they can become unresponsive upon prolonged exposure to their neurotransmitter.

The NOV9 nucleic acid and polypeptide, antibodies and related compounds according to the invention will be useful in therapeutic and diagnostic applications in the mediation of signal transduction. As such the NOV9 nucleic acid and polypeptide, antibodies and related compounds according to the invention may be used to treat, e.g., leukemia, acute nonlymphocytic, spinocerebellar ataxia-1, or neurological disorders.

The NOV9 nucleic acid and polypeptide are useful for detecting specific cell types. For example, expression analysis has demonstrated that a NOV9 nucleic acid is predominantly expressed in skeletal muscle and selected areas of the brain.

Additional utilities for the NOV9 nucleic acid and polypeptide according to the invention are disclosed herein.

NOV10

The disclosed NOV10 nucleic acid (alternatively referred to herein as CG56321-01) encodes a novel proto-oncogene MAF-like protein and includes the 1189 nucleotide sequence (SEQ ID NO:29) shown in Table 10A. The NOV10 nucleic acid disclosed herein maps to chromosome 8.

An open reading frame for the mature protein was identified beginning with an ATG initiation codon at nucleotides 85–87, and ending with a TAG stop codon at nucleotides 11441146. Putative untranslated regions, if any, are found upstream from the initiation codon and downstream from the termination codon. The start and stop codons are in bold letters.

The NOV10 protein (SEQ ID NO:30) encoded by SEQ ID NO:29 is 353 amino acid residues in length and is presented using the one-letter amino acid code in Table 10B. The SignalP, Psort and/or Hydropathy results indicate that NOV10 has no known signal peptide and is likely to be localized in the nucleus with a certainty of 0.7600. Alternatively, a NOV10 polypeptide is located to the microbody (peroxisome) with a certainty of 0.5418, the lysosome (lumen) with a certainty of 0.1882, or the mitochondrial matrix space with a certainty of 0.1000.

A search against the Patp database, a proprietary database that contains sequences published in patents and patent publication, yielded several homologous proteins shown in Table 10C.

In a BLAST search of public sequence databases, it was found, for example, that the NOV10 nucleic acid sequence of this invention has 258 of 322 bases (80%) identical to a gb:GENBANK-ID:AF034693 |acc:AF034693.1 mRNA from Coturnix japonica ( Coturnix coturnix japonica bZip transcription factor MafA (mafA) gene, complete cds). Further, the full amino acid sequence of the disclosed NOV10 protein of the invention has 134 of 249 amino acid residues (53%) identical to, and 151 of 249 amino acid residues (60%) similar to, the 311 amino acid residue ptnr:SPTREMBL-ACC:Q90370 protein from Coturnix cotumix japonica (Japanese quail) (MAFB PROTEIN).

The NOV10 protein of the invention also has homolgy to the proteins shown in the BLASTP data in Table 10D.

A multiple sequence alignment is given in Table 10E, with the NOV10 protein of the invention being shown in line 1 in a ClustalW analysis comparing NOV10 with related protein sequences of Table 10D.

The presence of identifiable domains in the disclosed NOV10 protein was determined by using Pfam and then determining the Interpro number. The results are listed in Table 10F with the statistics and domain description.

Consistent with other known members of the basic leucine zipper (bZip) transcription factor family of proteins, NOV10 contains MAF domains as illustrated in Table 10F.

The NOV10 nucleic acid, and the encoded polypeptide, according to the invention are useful in a variety of applications and contexts. For example, NOV10 nucleic acids and polypeptides can be used to identify proteins that are members of the bZip transcription factor family of proteins. The NOV10 nucleic acids and polypeptides can also be used to screen for molecules, which inhibit or enhance NOV10 activity or function. Specifically, the nucleic acids and polypeptides according to the invention may be used as targets for the identification of small molecules that modulate or inhibit, e.g., gene regulation/expression. These molecules can be used to treat, e.g., autoimmune disorders or antioxidant induction of molecules such as NQO1, GST, Ya, or other detoxification enzymes.

In addition, the NOV10 nucleic acid and polypeptide according to the invention are useful, inter alia, as novel members of the protein families according to the presence of domains and sequence relatedness to previously described proteins. For example, the NOV10 nucleic acid and polypeptide include structural motifs that are characteristic of proteins belonging to the family of bZip transcription factor proteins. Transcription factors are proteins that bind to the enhancer or promoter regions and interact such that transcription occurs from only a small group of promoters in any cell. Most transcription factors can bind to specific DNA sequences, and these trans-regulatory proteins can be grouped together in families based on similarities in structure. Within such a family, proteins share a common framework structure in their respective DNA-binding sites, and slight differences in the amino acids at the binding site can alter the sequence of the DNA to which it binds. In addition to having this sequence-specific DNA-binding domain, transcription factors contain a domain involved in activating the transcription of the gene whose promoter or enhancer it has bound. Usually, this trans-activating domain enables that transcription factor to interact with proteins involved in binding RNA polymerase. This interaction often enhances the efficiency with which the basal transcriptional complex can be built and bind RNA polymerase II. There are several families of transcription factors.

The bZip transcription factor family of proteins are dimers, each of whose subunits contains a basic DNA-binding domain at the carboxyl end, followed closely by an a helix containing several leucine residues. These leucines are placed in the helix such that they interact with similarly spaced leucine residues on other bZip proteins to form a “leucine zipper” between them, causing dimers to form. This domain is followed by a regulatory domain that can interact with the promoter to stimulate or repress transcription.

The NOV10 nucleic acid and polypeptide, antibodies and related compounds according to the invention will be useful in therapeutic and diagnostic applications in the mediation of gene transcription. As such the NOV10 nucleic acid and polypeptide, antibodies and related compounds according to the invention may be used to treat, e.g., anemia, ataxia-telangiectasia, autoimmume disease, cancer, immunodeficiencies, hemophilia, hypercoagulation, idiopathic thrombocytopenic purpura, allergies, transplantation, graft versus host disease (GVHD), lymphaedema, systemic lupus erythematosus, asthma, emphysema, scleroderma, ARDS, diabetes, renal artery stenosis, interstitial nephritis, glomerulonephritis, polycystic kidney disease, systemic lupus erythematosus, renal tubular acidosis, IgA nephropathy, hypercalceimia, or Lesch-Nyhan syndrome.

The NOV10 nucleic acid and polypeptide are useful for detecting specific cell types. For example, expression analysis has demonstrated that a NOV10 nucleic acid is expressed in blood, lymphocyte, whole embryo, lung, pancreas, kidney and eye.

Additional utilities for the NOV10 nucleic acid and polypeptide according to the invention are disclosed herein.

NOV11

The NOV11 proteins descibed herein are novel lysyl oxidase-like proteins. The NOV11 nucleic acids disclosed herein map to chromosome 10. Two alternative novel NOV11 nucleic acids and polypeptides are disclosed herein, namely NOV11a and NOV11b.

NOV11a

A NOV11 variant is NOV11a (alternatively referred to herein as CG56381-01), which encodes the 2599 nucleotide sequence (SEQ ID NO:31) shown in Table 11A. An open reading frame for the mature protein was identified beginning with an ATG codon at nucleotides 78–80 and ending with a TGA codon at nucleotides 2568–2570. Putative untranslated regions, if any, downstream from the termination codon and upstream from the initiation codon are underlined. The start and stop codons are in bold letters.

The NOV11a protein (SEQ ID NO:32) encoded by SEQ ID NO:31 is 830 amino acid residues in length and is presented using the one-letter amino acid code in Table 11 B. The SignalP, Psort and/or Hydropathy results indicate that NOV11a has a signal peptide and is likely to be localized in the lysosome (lumen) with a certainty of 0.4247. Alternatively, a NOV11a polypeptide is located extracellularly with a certainty of 0.3700, the microbody (peroxisome) with a certainty of 0.1250, or the endoplasmic reticulum (membrane) with a certainty of 0.1000. The SignalP indicates a likely cleavage site for a NOV11a peptide between positions 24 and 25, i.e., at the dash in the sequence SRP-QS.

SNP variants of NOV11a are disclosed in Example 2.

NOV11b

Alternatively, a NOV11 variant is NOV11b (alternatively referred to herein as CG56381-02), which includes the 2592 nucleotide sequence (SEQ ID NO:33) shown in Table 11C. An open reading frame for the mature protein was identified beginning with an ATG codon at nucleotides 46–48 and ending with a TGA codon at nucleotides 2314–2316. Putative untranslated regions, if any, downstream from the termination codon and upstream from the initiation codon are underlined. The start and stop codons are in bold letters.

The NOV11b protein (SEQ ID NO:34) encoded by SEQ ID NO:33 is 756 amino acid residues in length and is presented using the one-letter amino acid code in Table 11D. The SignalP, Psort and/or Hydropathy results indicate that NOV11b has a signal peptide and is likely to be localized in the lysosome (lumen) with a certainty of 0.4302. Alternatively, a NOV11b polypeptide is located extracellularly with a certainty of 0.3700, the microbody (peroxisome) with a certainty of 0.1403, or the endoplasmic reticulum (membrane) with a certainty of 0.1000. The SignalP indicates a likely cleavgae site for a NOV11b peptide between positions 24 and 25, i.e., at the dash in the sequence SRP-QS.

NOV11 Clones

Unless specifically addressed as NOV11a or NOV11b, any reference to NOV11 is assumed to encompass all variants.

A search against the Patp database, a proprietary database that contains sequences published in patents and patent publication, yielded several homologous proteins shown in Table 11E.

In a BLAST search of public sequence databases, it was found, for example, that the NOV11 a nucleic acid sequence of this invention has 1075 of 1078 bases (99%) identical to a gb:GENBANK-ID:AK025542|acc:AK025542.1 mRNA from Homo sapiens cDNA: FLJ21889 fis, clone HEP03178. Further, the full amino acid sequence of the disclosed NOV11a protein of the invention has 404 of 705 amino acid residues (57%) identical to, and 523 of 705 amino acid residues (74%) similar to, the 774 amino acid residue ptnr:SPTREMBL-ACC:Q9Y4K0 protein from Human (LYSYL OXIDASE-RELATED PROTEIN).

In a similar BLAST search of public sequence databases, it was found, for example, that the NOV11b nucleic acid sequence of this invention has 1070 of 1076 bases (99%) identical to a gb:GENBANK-ID:AK025542|acc:AK025542.1 mRNA from Homo sapiens cDNA: FLJ21889 fis, clone HEP03178. Further, the full amino acid sequence of the disclosed NOV11b protein of the invention has 360 of 616 amino acid residues (58%) identical to, and 456 of 616 amino acid residues (74%) similar to, the 895 amino acid residue ptnr:SPTREMBL-ACC:Q9W6N1 protein from Perca flavescens (Yellow perch) (LYSYL OXIDASE RELATED PROTEIN HOMOLOG).

Additional BLAST results are shown in Table 11F.

A multiple sequence alignment is given in Table 11G, with the NOV11 proteins of the invention being shown in lines 1 and 2 in a ClustalW analysis comparing NOV11 with related protein sequences of Table 11F.

The presence of identifiable domains in the disclosed NOV11 protein was determined by using Pfam and then determining the Interpro number. The results are listed in Table 11H with the statistics and domain description.

Consistent with other known members of the copper-dependent amine oxidase family of proteins, NOV11 contains a lysyl oxidase domain as illustrated in Table 11H.

NOV11 nucleic acids, and the encoded polypeptides, according to the invention are useful in a variety of applications and contexts. For example, NOV11 nucleic acids and polypeptides can be used to identify proteins that are members of the copper-dependent amine oxidase family of proteins. The NOV11 nucleic acids and polypeptides can also be used to screen for molecules, which inhibit or enhance NOV11 activity or function. Specifically, the nucleic acids and polypeptides according to the invention may be used as targets for the identification of small molecules that modulate or inhibit, e.g., crosslinking of extracellular matrix proteins. These molecules can be used to treat, e.g., autoimmune disease, allergies, immunodeficiencies, asthma, psoriasis, acne, or pigmentation disorders.

In addition, various NOV11 nucleic acids and polypeptides according to the invention are useful, inter alia, as novel members of the protein families according to the presence of domains and sequence relatedness to previously described proteins. For example, the NOV11 nucleic acids and their encoded polypeptides include structural motifs that are characteristic of proteins belonging to the lysyl oxidase family. Lysyl oxidase (LOX) is a secreted enzyme that cross-links collagen and elastin, and thus is critical for the integrity of the extracellular matrix, the breakdown of which contributes to cancer invasion and metastasis. LOX is also important to the health of connective tissues and arteries. Lysyl oxidase requires a copper co-factor and therefore its activity can be lowered by a dietary deficiency.

The NOV11 nucleic acids and polypeptides, antibodies and related compounds according to the invention will be useful in therapeutic and diagnostic applications in the mediation of crosslinking and biogenesis of connective tissue matrices. As such the NOV11 nucleic acids and polypeptides, antibodies and related compounds according to the invention may be used to treat digestive disorders, e.g., diabetes, Von Hippel-Lindau (VHL) syndrome, pancreatitis, obesity, endometriosis, fertility, hemophilia, hypercoagulation, idiopathic thrombocytopenic purpura, autoimmume disease, allergies, immunodeficiencies, transplantation, graft versus host disease (GVHD), lymphaedema, osteoporosis, hypercalceimia, arthritis, ankylosing spondylitis, scoliosis, systemic lupus erythematosus, asthma, emphysema, scleroderma, allergy, ARDS, renal artery stenosis, interstitial nephritis, glomerulonephritis, polycystic kidney disease, systemic lupus erythematosus, renal tubular acidosis, IgA nephropathy, Lesch-Nyhan syndrome, psoriasis, actinic keratosis, tuberous sclerosis, acne, hair growth/loss, allopecia, pigmentation disorders, and endocrine disorders.

The NOV11 nucleic acids and polypeptides are useful for detecting specific cell types. For example, expression analysis has demonstrated that a NOV11 nucleic acid is expressed in kidney, lung, lymphoid tissue, mammary gland/breast, ovary, pancreas, testis, uterus, and bone.

Additional utilities for NOV11 nucleic acids and polypeptides according to the invention are disclosed herein.

NOV12

The NOV12 proteins descibed herein are novel phosphatase-like proteins. The NOV12 nucleic acids disclosed herein map to chromosome 17. Two alternative novel NOV12 nucleic acids and polypeptides are disclosed herein, namely NOV12a and NOV12b.

NOV12a

A NOV12 variant is NOV12a (alternatively referred to herein as CG56436-01), which encodes the 1002 nucleotide sequence (SEQ ID NO:35) shown in Table 12A. An open reading frame for the mature protein was identified beginning with an ATG codon at nucleotides 101–103 and ending with a TGA codon at nucleotides 902–904. Putative untranslated regions, if any, downstream from the termination codon and upstream from the initiation codon are underlined. The start and stop codons are in bold letters.

The NOV12a protein (SEQ ID NO:36) encoded by SEQ ID NO:35 is 267 amino acid residues in length and is presented using the one-letter amino acid code in Table 12B. The SignalP, Psort and/or Hydropathy results indicate that NOV12a has no known signal peptide and is likely to be localized in the mitochondrial matrix space with a certainty of 0.4728. Alternatively, a NOV12a polypeptide is located in the microbody (peroxisome) with a certainty of 0.2224, the lysosome (lumen) with a certainty of 0.1905, or the mitochondrial inner membrane with a certainty of 0.1762.

SNP variants of NOV12a are disclosed in Example 2.

NOV12b

Alternatively, a NOV12 variant is NOV12b (alternatively referred to herein as CG5643602), which includes the 903 nucleotide sequence (SEQ ID NO:37) shown in Table 12C. An open reading frame for the mature protein was identified beginning with an ATG codon at nucleotides 4–6 and ending with a TGA codon at nucleotides 805–807. Putative untranslated regions, if any, downstream from the termination codon and upstream from the initiation codon are underlined. The start and stop codons are in bold letters.

The NOV12b protein (SEQ ID NO:38) encoded by SEQ ID NO:37 is 267 amino acid residues in length and is presented using the one-letter amino acid code in Table 12D. The SignalP, Psort and/or Hydropathy results predict that NOV12b has no known signal peptide and is likely to be localized in the mitochondrial matrix space with a certainty of 0.4728. Alternatively, a NOV12b polypeptide is located in the microbody (peroxisome) with a certainty of 0.2224, the lysosome (lumen) with a certainty of 0.1905, or the mitochondrial inner membrane with a certainty of 0.1762.

NOV12 Clones

Unless specifically addressed as NOV12a or NOV12b, any reference to NOV12 is assumed to encompass all variants.

A search against the Patp database, a proprietary database that contains sequences published in patents and patent publication, yielded several homologous proteins shown in Table 12E.

In a BLAST search of public sequence databases, it was found, for example, that the NOV12a nucleic acid sequence of this invention has 609 of 916 bases (66%) identical to a gb:GENBANK-ID:GGA6529|acc:AJ006529.1 mRNA from Gallus gallus ( Gallus gallus mRNA for putative phosphatase). Further, the full amino acid sequence of the disclosed NOV12a protein of the invention has 159 of 265 amino acid residues (60%) identical to, and 199 of 265 amino acid residues (75%) similar to, the 268 amino acid residue ptnr:SPTREMBL-ACC:O73884 protein from Gallus gallus (Chicken) (PUTATIVE PHOSPHATASE).

In a similar BLAST search of public sequence databases, it was found, for example, that the NOV12b nucleic acid sequence of this invention has 579 of 865 bases (66%) identical to a gb:GENBANK-ID:GGA6529|acc:AJ006529.1 mRNA from Gallus gallus ( Gallus gallus mRNA for putative phosphatase). Further, the full amino acid sequence of the disclosed NOV12b protein of the invention has 159 of 265 amino acid residues (60%) identical to, and 199 of 265 amino acid residues (75%) similar to, the 268 amino acid residue ptnr:SPTREMBL-ACC:O73884 protein from Gallus gallus (Chicken) (PUTATIVE PHOSPHATASE).

Additional BLAST results are shown in Table 12F.

A multiple sequence alignment is given in Table 12G, with the NOV12 proteins of the invention being shown in lines 1 and 2 in a ClustalW analysis comparing NOV12 with related protein sequences of Table 12F.

The presence of identifiable domains in the disclosed NOV12 protein was determined by using Pfam and then determining the Interpro number. The results are listed in Table 12H with the statistics and domain description.

Consistent with other known members of the protein phosphatase family of proteins, NOV12 contains a hydrolase domain as illustrated in Table 12H.

NOV12 nucleic acids, and the encoded polypeptides, according to the invention are useful in a variety of applications and contexts. For example, NOV12 nucleic acids and polypeptides can be used to identify proteins that are members of the protein phosphatase family of proteins. The NOV12 nucleic acids and polypeptides can also be used to screen for molecules, which inhibit or enhance NOV12 activity or function. Specifically, the nucleic acids and polypeptides according to the invention may be used as targets for the identification of small molecules that modulate or inhibit, e.g., biological processes that control cell growth and homeostasis. These molecules can be used to treat, e.g., hyper/hypothyroidism, endometriosis, fertility, transplantation, hypogonadism, Alzheimer's disease, Parkinson's disease, neurodegeneration, or grwoth disorders.

In addition, various NOV12 nucleic acids and polypeptides according to the invention are useful, inter alia, as novel members of the protein families according to the presence of domains and sequence relatedness to previously described proteins. For example, the NOV12 nucleic acids and their encoded polypeptides include structural motifs that are characteristic of proteins belonging to the protein phosphatase family. The major protein phosphatases in all cells are highly conserved and widely distributed. They are integrally associated with the regulation of many neuronal functions and have been implicated in the etiology of several neurological disorders. Their involvement in the specific control of individual neuronal functions requires the specific regulation of distinct pools of protein phosphatase inside the cell. This is believed to be mediated by specific proteins which both target the enzyme to specific subcellular locations and modulate its activity towards colocalised substrates.

The NOV12 nucleic acids and polypeptides, antibodies and related compounds according to the invention will be useful in therapeutic and diagnostic applications in the mediation of cell signaling/signal transduction. As such the NOV12 nucleic acids and polypeptides, antibodies and related compounds according to the invention may be used to treat, e.g., hyperthyroidism, hypothyroidism, endometriosis, fertility, Von Hippel-Lindau (VHL) syndrome, cirrhosis, transplantation, hypogonadism, Alzheimer's disease, stroke, tuberous sclerosis, hypercalceimia, Parkinson's disease, Huntington's disease, cerebral palsy, epilepsy, Lesch-Nyhan syndrome, multiple sclerosis, ataxia-telangiectasia, leukodystrophies, behavioral disorders, addiction, anxiety, pain, neurodegeneration, endocrine dysfunctions, diabetes, obesity, growth and reproductive disorders, systemic lupus erythematosus, autoimmune disease, asthma, emphysema, scleroderma, allergy, ARDS, renal artery stenosis, interstitial nephritis, glomerulonephritis, polycystic kidney disease, renal tubular acidosis, IgA nephropathy, hemophilia, hypercoagulation, idiopathic thrombocytopenic purpura, immunodeficiencies, and graft versus host disease.

The NOV12 nucleic acids and polypeptides are useful for detecting specific cell types. For example, expression analysis has demonstrated that a NOV12 nucleic acid is expressed in bone marrow, brain, kidney, liver, lung, lung pleura, pituitary gland, placenta, and thyroid.

Additional utilities for NOV12 nucleic acids and polypeptides according to the invention are disclosed herein.

NOV13

The disclosed NOV13 nucleic acid (alternatively referred to herein as CG56441-01) encodes a novel chloride channel protein CLC-KA-like protein and includes the 1991 nucleotide sequence (SEQ ID NO:39) shown in Table 13A.

An open reading frame for the mature protein was identified beginning with an ATG initiation codon at nucleotides 8–10, and ending with a TAG stop codon at nucleotides 1973–1975. Putative untranslated regions, if any, are found upstream from the initiation codon and downstream from the termination codon. The start and stop codons are in bold letters.

The NOV13 protein (SEQ ID NO:40) encoded by SEQ ID NO:39 is 655 amino acid residues in length and is presented using the one-letter amino acid code in Table 13B. The SignalP, Psort and/or Hydropathy results indicate that NOV13 has a signal peptide and is likely to be localized at the plasma membrane with a certainty of 0.6000. Alternatively, a NOV13 polypeptide is located to the Golgi body with a certainty of 0.4000, the endoplasmic reticulum (membrane) with a certainty of 0.1882, or the microbody (peroxisome) with a certainty of 0.3000. The SignalP indicates a likely cleavage site for a NOV13 peptide between positions 66 and 67, i.e., at the dash in the sequence SYA-MN.

SNP variants of NOV13 are disclosed in Example 2.

A search against the Patp database, a proprietary database that contains sequences published in patents and patent publication, yielded several homologous proteins shown in Table 13C.

In a BLAST search of public sequence databases, it was found, for example, that the NOV13 nucleic acid sequence of this invention has 1768 of 1779 bases (99%) identical to a gb:GENBANK-ID:HSCLCHPRA|acc:Z30643.1 mRNA from H. sapiens mRNA for chloride channel (putative) 2139 bp. Further, the full amino acid sequence of the disclosed NOV13 protein of the invention has 578 of 579 amino acid residues (99%) identical to, and 578 of 579 amino acid residues (99%) similar to, the 687 amino acid residue ptnr:SWISSPROT-ACC:P51800 protein from Human (CHLORIDE CHANNEL PROTEIN CLC-KA (CLC-K1)).

The NOV13 protein of the invention also has homolgy to the proteins shown in the BLASTP data in Table 13D.

A multiple sequence alignment is given in Table 13E, with the NOV13 protein of the invention being shown in line 1 in a ClustalW analysis comparing NOV13 with related protein sequences of Table 13D.

The presence of identifiable domains in the disclosed NOV13 protein was determined by using Pfam and then determining the Interpro number. The results are listed in Table 13F with the statistics and domain description.

Consistent with other known members of the voltage-gated chloride channel family of proteins, NOV13 contains CLC domains as illustrated in Table 13F.

The NOV13 nucleic acid, and the encoded polypeptide, according to the invention are useful in a variety of applications and contexts. For example, NOV13 nucleic acids and polypeptides can be used to identify proteins that are members of the voltage-gated chloride channel family of proteins. The NOV13 nucleic acids and polypeptides can also be used to screen for molecules, which inhibit or enhance NOV13 activity or function. Specifically, the nucleic acids and polypeptides according to the invention may be used as targets for the identification of small molecules that modulate or inhibit, e.g., physiological function such as cell volume regulation, membrane potential stabilization, signal transduction, or transepithelial transport. These molecules can be used to treat, e.g., diseases associated with the kidney such as renal artery stenosis, diabetes, or renal tubular acidosis.

In addition, the NOV13 nucleic acid and polypeptide according to the invention are useful, inter alia, as novel members of the protein families according to the presence of domains and sequence relatedness to previously described proteins. For example, the NOV13 nucleic acid and polypeptide include structural motifs that are characteristic of proteins belonging to the family of voltage-gated chloride channel proteins. All functionally characterized members of the CLC family transport chloride, some in a voltage-regulated process. These channels serve a variety of physiological functions such as cell volume regulation, membrane potential stabilization, signal transduction, and transepithelial transport.

The NOV13 nucleic acid and polypeptide, antibodies and related compounds according to the invention will be useful in therapeutic and diagnostic applications in the mediation of kidney diseases. As such the NOV13 nucleic acid and polypeptide, antibodies and related compounds according to the invention may be used to treat, e.g., diabetes, autoimmune disease, renal artery stenosis, interstitial nephritis, glomerulonephritis, polycystic kidney disease, systemic lupus erythematosus, renal tubular acidosis, IgA nephropathy, hypercalceimia, or Lesch-Nyhan syndrome.

The NOV13 nucleic acid and polypeptide are useful for detecting specific cell types. For example, expression analysis has demonstrated that a NOV13 nucleic acid is expressed in the kidney.

Additional utilities for the NOV13 nucleic acid and polypeptide according to the invention are disclosed herein.

NOV14

The disclosed NOV14 nucleic acid (alternatively referred to herein as CG56443-01) encodes a novel mast cell function-associated antigen (MAFA)-like protein and includes the 645 nucleotide sequence (SEQ ID NO:41) shown in Table 14A. The NOV14 nucleic acid disclosed herein maps to chromosome 19.

An open reading frame for the mature protein was identified beginning with an ATG initiation codon at nucleotides 31–33, and ending with a TAA stop codon at nucleotides 604–606. Putative untranslated regions, if any, are found upstream from the initiation codon and downstream from the termination codon. The start and stop codons are in bold letters.

The NOV14 protein (SEQ ID NO:42) encoded by SEQ ID NO:41 is 191 amino acid residues in length and is presented using the one-letter amino acid code in Table 14B. The SignalP, Psort and/or Hydropathy results indicate that NOV14 has a signal peptide and is likely to be localized at the plasma membrane with a certainty of 0.7900. Alternatively, a NOV14 polypeptide is located to the microbody (peroxisome) with a certainty of 0.5804, the Golgi body with a certainty of 0.3000, or the endoplasmic reticulum (membrane) with a certainty of 0.2000. The SignalP indicates a likely cleavage site for a NOV14 peptide between positions 57 and 58, i.e., at the dash in the sequence SLA-LS.

A search against the Patp database, a proprietary database that contains sequences published in patents and patent publication, yielded several homologous proteins shown in Table 14C.

In a BLAST search of public sequence databases, it was found, for example, that the NOV14 nucleic acid sequence of this invention has 109 of 151 bases (72%) identical to a gb:GENBANK-ID:HSA007973|acc:AJ007973.1 mRNA from Homo sapiens LGMD2B gene. Further, the full amino acid sequence of the disclosed NOV14 protein of the invention has 62 of 179 amino acid residues (34%) identical to, and 87 of 179 amino acid residues (48%) similar to, the 188 amino acid residue ptnr:SPTREMBL-ACC:O88713 protein from Mouse (MAST CELL FUNCTION-ASSOCIATED ANTIGEN 2F1 (MAFA)).

The NOV14 protein of the invention also has homolgy to the proteins shown in the BLASTP data in Table 14D.

A multiple sequence alignment is given in Table 14E, with the NOV14 protein of the invention being shown in line 1 in a ClustalW analysis comparing NOV14 with related protein sequences of Table 14D.

The presence of identifiable domains in the disclosed NOV14 protein was determined by using Pfam and then determining the Interpro number. The results are listed in Table 14F with the statistics and domain description.

Consistent with other known members of the MAFA family of proteins, NOV14 contains an extracellular link (Xlink) domains as illustrated in Table 14F.

The NOV14 nucleic acid, and the encoded polypeptide, according to the invention are useful in a variety of applications and contexts. For example, NOV14 nucleic acids and polypeptides can be used to identify proteins that are members of the MAFA family of proteins. The NOV14 nucleic acids and polypeptides can also be used to screen for molecules, which inhibit or enhance NOV14 activity or function. Specifically, the nucleic acids and polypeptides according to the invention may be used as targets for the identification of small molecules that modulate or inhibit, e.g., cellular activation/cascade, allergic response, or the release of mediators such as histamine. These molecules can be used to treat, e.g., atopic disorders such as asthma, allergies, cancers such as lymphoma, or immunological disorders.

In addition, the NOV14 nucleic acid and polypeptide according to the invention are useful, inter alia, as novel members of the protein families according to the presence of domains and sequence relatedness to previously described proteins. For example, the NOV14 nucleic acid and polypeptide include structural motifs that are characteristic of proteins belonging to the family of MAFA proteins. Mast cells are part of the immune system. They carry Fcepsilon type receptors on their surface to which IgE antibodies bind specifically. Crosslinking by multivalent antigens initiates a biochemical cascade which causes the secretion of neurotransmitters and thus allergic reaction of the immediate type. It was recently discovered that this membrane protein carries an Immune Receptor Tyrosine based Inhibition Motif (ITIM).

The NOV14 nucleic acid and polypeptide, antibodies and related compounds according to the invention will be useful in therapeutic and diagnostic applications in the mediation of immune response, cancer, or atopy. As such the NOV14 nucleic acid and polypeptide, antibodies and related compounds according to the invention may be used to treat, e.g., cancer, autoimmune disease, allergies, immunodeficiencies, transplantation, graft versus host disease (GVHD), or lymphaedema.

The NOV14 nucleic acid and polypeptide are useful for detecting specific cell types. For example, expression analysis has demonstrated that a NOV14 nucleic acid is expressed in lymph, testis, liver, breast, melanocyte, heart, uterus, brain, and spleen.

Additional utilities for the NOV14 nucleic acid and polypeptide according to the invention are disclosed herein.

NOV15

The NOV15 proteins descibed herein are novel murine epidermal growth factor-6 (MEGF6). The NOV15 nucleic acids disclosed herein map to chromosome 1. Six alternative novel NOV15 nucleic acids and polypeptides are disclosed herein, namely NOV15a, NOV15b, NOV15c, NOV15d, NOV15e and NOV15f.

NOV15a

A NOV15 variant is NOV15a (alternatively referred to herein as CG56449-01), which encodes the 7337 nucleotide sequence (SEQ ID NO:43) shown in Table 15A. An open reading frame for the mature protein was identified beginning with an ATG codon at nucleotides 1–3 and ending with a TGA codon at nucleotides 4213–4215. Putative untranslated regions, if any, downstream from the termination codon and upstream from the initiation codon are underlined. The start and stop codons are in bold letters.

The NOV15a protein (SEQ ID NO:44) encoded by SEQ ID NO:43 is 1404 amino acid residues in length and is presented using the one-letter amino acid code in Table 15B. Although the SignalP, Psort and/or Hydropathy results indicate that NOV15a has a signal peptide and is likely to be localized in the mitochondrial matrix space with a certainty of 0.4753, the NOV15a protein disclosed here is similar to the EGF family, some members of which are released extracellularly. Alternatively, a NOV15a polypeptide is located to the microbody (peroxisome) with a certainty of 0.3000, the mitochondrial inner membrane with a certainty of 0.1802, or the mitochondrial intermembrane space with a certainty of 0.1802. The SignalP indicates a likely cleavage site for a NOV15a peptide is between positions 31 and 32, i.e., at the dash in the sequence GRG-AD.

SNP variants of NOV15a are disclosed in Example 2.

NOV15b

Alternatively, a NOV15 variant is NOV15b (alternatively referred to herein as CG56449-02), which includes the 7319 nucleotide sequence (SEQ ID NO:45) shown in Table 15C. An open reading frame for the mature protein was identified beginning with an ATG codon at nucleotides 1–3 and ending with a TGA codon at nucleotides 4195–4197. Putative untranslated regions, if any, downstream from the termination codon and upstream from the initiation codon are underlined. The start and stop codons are in bold letters.

The NOV15b protein (SEQ ID NO:46) encoded by SEQ ID NO:45 is 1398 amino acid residues in length and is presented using the one-letter amino acid code in Table 15D. Although the SignalP, Psort and/or Hydropathy results indicate that NOV15b has a signal peptide and is likely to be localized in the mitochondrial matrix space with a certainty of 0.4753, the NOV15b protein disclosed here is similar to the EGF family, some members of which are released extracellularly. Alternatively, a NOV15b polypeptide is located to the microbody (peroxisome) with a certainty of 0.3000, the mitochondrial inner membrane with a certainty of 0.1802, or the mitochondrial intermembrane space with a certainty of 0.1802. The SignalP indicates a likely cleavage site for a NOV15b peptide is between positions 31 and 32, i.e., at the dash in the sequence GRG-AD.

NOV15c

Alternatively, a NOV15 variant is NOV15c (alternatively referred to herein as CG56449-03), which includes the 4733 nucleotide sequence (SEQ ID NO:47) shown in Table 15F. An open reading frame for the mature protein was identified beginning with an ATG codon at nucleotides 1–3 and ending with a TAG codon at nucleotides 4351–4353. Putative untranslated regions, if any, downstream from the termination codon and upstream from the initiation codon are underlined. The start and stop codons are in bold letters.

The NOV15c protein (SEQ ID NO:48) encoded by SEQ ID NO:47 is 1450 amino acid residues in length and is presented using the one-letter amino acid code in Table 15F. Although the SignalP, Psort and/or Hydropathy results indicate that NOV15c has a signal peptide and is likely to be localized in the mitochondrial matrix space with a certainty of 0.4753, the NOV15c protein disclosed here is similar to the EGF family, some members of which are released extracellularly. Alternatively, a NOV15c polypeptide is located to the cytoplasm with a certainty of 0.4500, the mitochondrial inner membrane with a certainty of 0.1802, or the mitochondrial intermembrane space with a certainty of 0.1802. The SignalP indicates a likely cleavage site for a NOV15c peptide is between positions 31 and 32, i.e., at the dash in the sequence GRG-AD.

NOV15d

Alternatively, a NOV15 variant is NOV15d (alternatively referred to herein as CG56449-04), which includes the 877 nucleotide sequence (SEQ ID NO:49) shown in Table 15G. An open reading frame for the mature protein was identified beginning with an ATG codon at nucleotides 25–27 and ending with a TAG codon at nucleotides 535–537. Putative untranslated regions, if any, downstream from the termination codon and upstream from the initiation codon are underlined. The start and stop codons are in bold letters.

The NOV15d protein (SEQ ID NO:50) encoded by SEQ ID NO:49 is 170 amino acid residues in length and is presented using the one-letter amino acid code in Table 15H. The SignalP, Psort and/or Hydropathy results indicate that NOV15d has no known signal peptide and is likely to be localized in the cytoplasm with a certainty of 0.6500. Alternatively, a NOV15d polypeptide is located to the lysosome (lumen) with a certainty of 0.1853, or the mitochondrial matrix space with a certainty of 0.1000.

NOV15e

Alternatively, a NOV15 variant is NOV15e (alternatively referred to herein as CG56449-06), which includes the 7334 nucleotide sequence (SEQ ID NO:51) shown in Table 151. An open reading frame for the mature protein was identified beginning with an ATG codon at nucleotides 1–3 and ending with a TGA codon at nucleotides 4210–4212. Putative untranslated regions, if any, downstream from the termination codon and upstream from the initiation codon are underlined. The start and stop codons are in bold letters.

The NOV15e protein (SEQ ID NO:52) encoded by SEQ ID NO:51 is 1403 amino acid residues in length and is presented using the one-letter amino acid code in Table 15J. Although the SignalP, Psort and/or Hydropathy results indicate that NOV15e has a signal peptide and is likely to be localized in the mitochondrial matrix space with a certainty of 0.4753, the NOV15 e protein disclosed here is similar to the EGF family, some members of which are released extracellularly. Alternatively, a NOV15e polypeptide is located to the microbody (peroxisome) with a certainty of 0.3000, the mitochondrial inner membrane with a certainty of 0.1802, or the mitochondrial intermembrane space with a certainty of 0.1802. The SignalP indicates a likely cleavage site for a NOV15e peptide is between positions 31 and 32, i.e., at the dash in the sequence GRG-AD.

NOV15f

Alternatively, a NOV15 variant is NOV15f (alternatively referred to herein as CG56449-08), which includes the 4835 nucleotide sequence (SEQ ID NO:53) shown in Table 15K. An open reading frame for the mature protein was identified beginning with an ATG codon at nucleotides 1–3 and ending with a TAG codon at nucleotides 4732–4734. Putative untranslated regions, if any, downstream from the termination codon and upstream from the initiation codon are underlined. The start and stop codons are in bold letters.

The NOV15f protein (SEQ ID NO:54) encoded by SEQ ID NO:53 is 1577 amino acid residues in length and is presented using the one-letter amino acid code in Table 15L. The SignalP, Psort and/or Hydropathy results indicate that NOV15f has a signal peptide and is likely to be localized extracellularly with a certainty of 0.8200. Alternatively, a NOV15f polypeptide is located to the lysosome (lumen) with a certainty of 0.1900, the endoplasmic reticulum (membrane) with a certainty of 0.1000, or the endoplasmic reticulum (lumen) with a certainty of 0.1000. The SignalP indicates a likely cleavage site for a NOV15f peptide is between positions 30 and 31, i.e., at the dash in the sequence VGA-SV.

NOV15 Clones

Unless specifically addressed as NOV15a, NOV15b, NOV15c, NOV15d, NOV15e, or NOV15 f any reference to NOV15 is assumed to encompass all variants.

A search against the Patp database, a proprietary database that contains sequences published in patents and patent publication, yielded several homologous proteins shown in Table 15M.

In a BLAST search of public sequence databases, it was found, for example, that the NOV15a nucleic acid sequence of this invention has 2717 of 3360 bases (80%) identical to a gb:GENBANK-ID:AB011532|acc:AB011532.1 mRNA from Rattus norvegicus mRNA for MEGF6, complete cds. Further, the full amino acid sequence of the disclosed NOV15a protein of the invention has 1060 of 1364 amino acid residues (77%) identical to, and 1147 of 1364 amino acid residues (84%) similar to, the 1574 amino acid residue ptnr:SPTREMNML-ACC:O88281 protein from Rat (MEGF6).

In a similar BLAST search of public sequence databases, it was found, for example, that the NOV15b nucleic acid sequence of this invention has 2624 of 3343 bases (78%) identical to a gb:GENBANK-ID:AB011532|acc:AB011532.1 mRNA from Rattus norvegicus mRNA for MEGF6, complete cds. Further, the full amino acid sequence of the disclosed NOV15b protein of the invention has 1045 of 1363 amino acid residues (76%) identical to, and 1131 of 1363 amino acid residues (82%) similar to, the 1574 amino acid residue ptnr:SPTREMBL-ACC:O88281 protein from Rat (MEGF6).

In a similar BLAST search of public sequence databases, it was found, for example, that the NOV15c nucleic acid sequence of this invention has 3219 of 4514 bases (71%) identical to a gb:GENBANK-ID:AB011532|acc:AB011532.1 mRNA from Rattus norvegicus mRNA for MEGF6, complete cds. Further, the full amino acid sequence of the disclosed NOV15c protein of the invention has 966 of 1426 amino acid residues (67%) identical to, and 1062 of 1426 amino acid residues (74%) similar to, the 1574 amino acid residue ptnr:SPTREMBL-ACC:O88281 protein from Rat (MEGF6).

In a similar BLAST search of public sequence databases, it was found, for example, that the NOV15d nucleic acid sequence of this invention has 650 of 687 bases (94%) identical to a gb:GENBANK-ID:AB0115391|acc:AB011539.1 mRNA from Homo sapiens mRNA for MEGF6, partial cds. Further, the full amino acid sequence of the disclosed NOV15d protein of the invention has 106 of 141 amino acid residues (75%) identical to, and 108 of 141 amino acid residues (76%) similar to, the 153 amino acid residue ptnr:SPTREMBL-ACC:O75095 protein from Human (MEGF6).

In a further BLAST search of public sequence databases, it was found, for example, that the NOV15e nucleic acid sequence of this invention has 1072 of 1072 bases (100%) identical to a gb:GENBANK-ID:AB011539|acc:AB011539.1 mRNA from Homo sapiens mRNA for MEGF6, partial cds. Further, the full amino acid sequence of the disclosed NOV15e protein of the invention has 1059 of 1363 amino acid residues (77%) identical to, and 1147 of 1363 amino acid residues (84%) similar to, the 1574 amino acid residue ptnr:SPTREMBL-ACC:O88281 protein from Rat (MEGF6).

In yet a further BLAST search of public sequence databases, it was found, for example, that the NOV15f nucleic acid sequence of this invention has 2755 of 3390 bases (81%) identical to a gb:GENBANK-ID:AB011532|acc:AB011532.1 mRNA from Rattus norvegicus mRNA for MEGF6, complete cds. Further, the full amino acid sequence of the disclosed NOV15f protein of the invention has 1222 of 1562 amino acid residues (78%) identical to, and 1322 of 1562 amino acid residues (84%) similar to, the 1574 amino acid residue ptnr:SPTREMBL-ACC:O88281 protein from Rat (MEGF6).

Additional BLAST results are shown in Table 15N.

A multiple sequence alignment is given in Table 15O, with the NOV15 proteins of the invention being shown in lines 1 through 6 in a ClustalW analysis comparing NOV15 with related protein sequences of Table 15N.

The presence of identifiable domains in the disclosed NOV15 protein was determined by using Pfam and then determining the Interpro number. The results are listed in Table 15P with the statistics and domain description.

Consistent with other known members of the MEGF6 family of proteins, NOV15 contains an epithelial growth factor (EGF) domain as illustrated in Table 15P.

NOV15 nucleic acids, and the encoded polypeptides, according to the invention are useful in a variety of applications and contexts. For example, NOV15 nucleic acids and polypeptides can be used to identify proteins that are members of the EGF family of proteins. The NOV15 nucleic acids and polypeptides can also be used to screen for molecules, which inhibit or enhance NOV15 activity or function. Specifically, the nucleic acids and polypeptides according to the invention may be used as targets for the identification of small molecules that modulate or inhibit, e.g., cell adhesion or receptor-ligand interactions. These molecules can be used to treat, e.g., neurodegenerative disorders such as Alzheimers or Parkinson's disease, or connective tissue disorders such as Marfan syndrome.

In addition, various NOV15 nucleic acids and polypeptides according to the invention are useful, inter alia, as novel members of the protein families according to the presence of domains and sequence relatedness to previously described proteins. For example, the NOV15 nucleic acids and their encoded polypeptides include structural motifs that are characteristic of proteins belonging to the MEGF family. Proteins belonging to the MEGF/Fibrillin family of proteins share a common feature of having epidermal growth factor (EGF)-like motifs. Examples of proteins containing EGF-like motifs include the MEGF proteins, which are expressed in the brain and are involved in neural development and function, the fibrillins, which are involved in extracellular matrix structure and maintenance, and the notch proteins (MEGF6), which are thought to be involved in mediating cell-fate decisions during hematopoiesis and neural development. Thus, such proteins play a critical role in a number of extracellular events, including cell adhesion and receptor-ligand interactions. Defects in these proteins can have profound effects on cellular and extracellular physiology and structure. For example, a mutation in fibrillin 1 causes Marfan syndrome, a disease that involves connective tissue, bone and lung manifestations.

The NOV15 nucleic acids and polypeptides, antibodies and related compounds according to the invention will be useful in therapeutic and diagnostic applications in the mediation of cellular and extracellular physiology. As such the NOV15 nucleic acids and polypeptides, antibodies and related compounds according to the invention may be used to treat, e.g., cancer, trauma, bacterial and viral infections, regeneration (in vitro and in vivo), fertility, endometriosis, cardiomyopathy, atherosclerosis, hypertension, congenital heart defects, aortic stenosis, atrial septal defect (ASD), atrioventricular (A-V) canal defect, ductus arteriosus, pulmonary stenosis, subaortic stenosis, ventricular septal defect (VSD), valve diseases, tuberous sclerosis, scleroderma, obesity, transplantation, anemia, bleeding disorders, transplantation, diabetes, autoimmune disease, renal artery stenosis, interstitial nephritis, glomerulonephritis, polycystic kidney disease, systemic lupus erythematosus, renal tubular acidosis, IgA nephropathy, hypercalceimia, Lesch-Nyhan syndrome, systemic lupus erythematosus, autoimmune disease, asthma, emphysema, allergy, ARDS, von Hippel-Lindau (VHL) syndrome, Alzheimer's disease, stroke, hypercalceimia, Parkinson's disease, Huntington's disease, cerebral palsy, epilepsy, Lesch-Nyhan syndrome, multiple sclerosis, ataxia-telangiectasia, leukodystrophies, behavioral disorders, addiction, anxiety, pain, neurodegeneration, Hirschsprung's disease, Crohn's Disease, and appendicitis.

The NOV15 nucleic acids and polypeptides are useful for detecting specific cell types. For example, expression analysis has demonstrated that a NOV15 nucleic acid is expressed in: brain, colon, frontal lobe, heart, kidney, lung, mammary gland/breast, ovary, prostate, and vein. Additional utilities for NOV15 nucleic acids and polypeptides according to the invention are disclosed herein.

NOV16

The disclosed NOV16 nucleic acid (alternatively referred to herein as AL359846_A_da1) encodes a novel G-protein coupled receptor (GPCR)-like protein and includes the 990 nucleotide sequence (SEQ ID NO:55) shown in Table 16A. The NOV16 nucleic acid disclosed herein maps to chromosome 4.

An open reading frame for the mature protein was identified beginning with an ATG initiation codon at nucleotides 3–5, and ending with a TGA stop codon at nucleotides 945–947. Putative untranslated regions, if any, are found upstream from the initiation codon and downstream from the termination codon. The start and stop codons are in bold letters.

The NOV16 protein (SEQ ID NO:56) encoded by SEQ ID NO:55 is 314 amino acid residues in length and is presented using the one-letter amino acid code in Table 16B. The SignalP, Psort and/or Hydropathy results indicate that NOV16 has a signal peptide and is likely to be localized at the plasma membrane with a certainty of 0.6000. Alternatively, a NOV16 polypeptide is located to the Golgi body with a certainty of 0.4000, the endoplasmic reticulum (membrane) with a certainty of 0.3000, or the microbody (peroxisome) with a certainty of 0.3000. The SignalP indicates a likely cleavage site for a NOV16 peptide between positions 43 and 44, i.e., at the dash in the sequence GNS-LL.

A search against the Patp database, a proprietary database that contains sequences published in patents and patent publication, yielded several homologous proteins shown in Table 16C.

In a BLAST search of public sequence databases, it was found, for example, that the NOV16 nucleic acid sequence of this invention has 555 of 804 bases (69%) identical to a gb:GENBANK-ID:MMU133424|acc:AJ133424.1 mRNA from Mus musculus or 37a gene. Further, the full amino acid sequence of the disclosed NOV16 protein of the invention has 189 of 313 amino acid residues (60%) identical to, and 246 of 313 amino acid residues (78%) similar to, the 318 amino acid residue ptnr:SPTREMBL-ACC:Q9QZ21 protein from Mouse (OLFACTORY RECEPTOR).

The NOV16 protein of the invention also has homolgy to the proteins shown in the BLASTP data in Table 16D.

A multiple sequence alignment is given in Table 16E, with the NOV16 protein of the invention being shown in line 1 in a ClustalW analysis comparing NOV16 with related protein sequences of Table 16D.

The presence of identifiable domains in the disclosed NOV16 protein was determined by using Pfam and then determining the Interpro number. The results are listed in Table 16F with the statistics and domain description.

Consistent with other known members of the GPCR family of proteins, NOV16 contains a 7-transmembrane (7tm — 1) domain as illustrated in Table 16F.

The NOV16 nucleic acid, and the encoded polypeptide, according to the invention are useful in a variety of applications and contexts. For example, NOV16 nucleic acids and polypeptides can be used to identify proteins that are members of the GPCR family of proteins. The NOV16 nucleic acids and polypeptides can also be used to screen for molecules, which inhibit or enhance NOV16 activity or function. Specifically, the nucleic acids and polypeptides according to the invention may be used as targets for the identification of small molecules that modulate or inhibit, e.g., cell recognition or signal transduction. These molecules can be used to treat, e.g., taste and scent detectability disorders, weight disorders, immune diseases, or signal transduction pathways.

In addition, the NOV16 nucleic acid and polypeptide according to the invention are useful, inter alia, as novel members of the protein families according to the presence of domains and sequence relatedness to previously described proteins. For example, the NOV16 nucleic acid and polypeptide include structural motifs that are characteristic of proteins belonging to the family of GPCR proteins. The human GPCR genes are generally intron-less and belong to four gene subfamilies, displaying great sequence variability. These genes are dominantly expressed in olfactory epithelium. Olfactory receptors (ORs) have been identified as extremely large family of GPCRs in a number of species. As members of the GPCR family, these receptors share a seven transmembrane domain structure with many neurotransmitter and hormone receptors, and are likely to underlie the recognition and G-protein-mediated transduction of odorant signals. Like GPCRs, the ORs they can be expressed in a variety of tissues where they are thought to be involved in recognition and transmission of a variety of signals.

The NOV16 nucleic acid and polypeptide, antibodies and related compounds according to the invention will be useful in therapeutic and diagnostic applications in the mediation of signal transduction. As such the NOV16 nucleic acid and polypeptide, antibodies and related compounds according to the invention may be used to treat, e.g., developmental diseases, MHCII and III diseases (immune diseases), taste and scent detectability disorders, Burkitt's lymphoma, corticoneurogenic disease, signal transduction pathway disorders, retinal diseases including those involving photoreception, cell growth rate disorders, cell shape disorders, feeding disorders, control of feeding, potential obesity due to over-eating, potential disorders due to starvation (lack of apetite), noninsulin-dependent diabetes mellitus (NIDDM1), bacterial, fungal, protozoal and viral infections (particularly infections caused by HIV-1 or HIV-2), pain, cancer (including but not limited to Neoplasm; adenocarcinoma; lymphoma; prostate cancer; uterus cancer), anorexia, bulimia, asthma, Parkinson's disease, acute heart failure, hypotension, hypertension, urinary retention, osteoporosis, Crohn's disease, multiple sclerosis, angina pectoris, myocardial infarction, ulcers, asthma, allergies, benign prostatic hypertrophy, or psychotic and neurological disorders, including anxiety, schizophrenia, manic depression, delirium, dementia, and severe mental retardation.

The NOV16 nucleic acid and polypeptide are useful for detecting specific cell types. For example, expression analysis has demonstrated that a NOV16 nucleic acid is expressed in olfactory neuroepithelium and the heart.

Additional utilities for the NOV16 nucleic acid and polypeptide according to the invention are disclosed herein.

NOV17

The NOV17 proteins descibed herein are novel transporter-like proteins. Two alternative novel NOV17 nucleic acids and polypeptides are disclosed herein, namely NOV17a and NOV17b.

NOV17a is directed to a transporter protein having a hydrophilic amino terminus containing sequences enriched in proline (P), glutamate (E), serine (S), and threonine (T), i.e., PEST-containing transporter. The NOV17a nucleic acid disclosed herein maps to chromosome 6.

NOV17b is directed to a Na+ independent aromatic amino acid transporter. The NOV17b nucleic acid maps to chromosome 5.

NOV17a

A NOV17 variant is NOV17a (alternatively referred to herein as CG56459-01), which encodes the 1875 nucleotide sequence (SEQ ID NO:57) shown in Table 17A. An open reading frame for the mature protein was identified beginning with an ATG codon at nucleotides 5–7 and ending with a TAA codon at nucleotides 1823–1825. Putative untranslated regions, if any, downstream from the termination codon and upstream from the initiation codon are underlined. The start and stop codons are in bold letters.

The NOV17a protein (SEQ ID NO:58) encoded by SEQ ID NO:57 is 606 amino acid residues in length and is presented using the one-letter amino acid code in Table 17B. The SignalP, Psort and/or Hydropathy results indicate that NOV17a has no known signal peptide and is likely to be localized at the plasma membrane with a certainty of 0.8000. Alternatively, a NOV17a polypeptide is located in the Golgi body with a certainty of 0.4000, the endoplasmic reticulum (membrane) with a certainty of 0.3000, or the mitochondrial inner membrane with a certainty of 0.0300.

SNP variants of NOV17a are disclosed in Example 2.

NOV17b

Alternatively, a NOV17 variant is NOV17b (alternatively referred to herein as CG56459-02), which includes the 1605 nucleotide sequence (SEQ ID NO:59) shown in Table 17C. An open reading frame for the mature protein was identified beginning with an ATG codon at nucleotides 31–33 and ending with a TAA codon at nucleotides 1576–1578. Putative untranslated regions, if any, downstream from the termination codon and upstream from the initiation codon are underlined. The start and stop codons are in bold letters.

The NOV17b protein (SEQ ID NO:60) encoded by SEQ ID NO:59 is 515 amino acid residues in length and is presented using the one-letter amino acid code in Table 17D. The SignalP, Psort and/or Hydropathy results indicate that NOV17b has no known signal peptide and is likely to be localized at the plasma membrane with a certainty of 0.8000. Alternatively, a NOV17b polypeptide is located in the Golgi body with a certainty of 0.4000, the endoplasmic reticulum (membrane) with a certainty of 0.3000, or the mitochondrial inner membrane with a certainty of 0.0300.

NOV17 Clones

Unless specifically addressed as NOV17a or NOV17b, any reference to NOV17 is assumed to encompass all variants.

A search against the Patp database, a proprietary database that contains sequences published in patents and patent publication, yielded several homologous proteins shown in Table 17E.

In a BLAST search of public sequence databases, it was found, for example, that the NOV17a nucleic acid sequence of this invention has 687 of 711 bases (96%) identical to a gb:GENBANK-ID):AF 116652|acc:AF116652.1 mRNA from Homo sapiens PRO0813 mRNA, complete cds. Further, the full amino acid sequence of the disclosed NOV17a protein of the invention was found to have 283 of 564 amino acid residues (50%) identical to, and 363 of 564 amino acid residues (64%) similar to, the 613 amino acid residue ptnr:SWISSPROT-ACC:P36021 protein from Human (X-LINKED PEST-CONTAINING TRANSPORTER).

In a similar BLAST search of public sequence databases, it was found, for example, that the NOV17b nucleic acid sequence of this invention has 1363 of 1605 bases (84%) identical to a gb:GENBANK-ID:AB047324|acc:AB047324.1 mRNA from Rattus norvegicus TAT1 mRNA, complete cds. Further the fall amino acid sequence of the disclosed NOV17b protein of the invention was found to have 435 of 515 amino acid residues (84%) identical to, and 463 of 515 amino acid residues (89%) similar to, the 514 amino acid residue ptnr:TREMBLNEW-ACC:BAB55595 protein from Rat (TAT1 PROTEIN).

Additional BLAST results are shown in Table 17F.

A multiple sequence alignment is given in Table 17G, with the NOV17 proteins of the invention being shown in lines 1 and 2 in a ClustalW analysis comparing NOV17 with related protein sequences of Table 17F.

The presence of identifiable domains in the disclosed NOV17 protein was determined by using Pfam and then determining the Interpro number. The results are listed in Table 17H with the statistics and domain description.

Consistent with other known members of the proton-linked monocarboxylate transporter (MCTs) family of proteins, NOV17 contains a transporter domain as illustrated in Table 17H.

NOV17 nucleic acids, and the encoded polypeptides, according to the invention are useful in a variety of applications and contexts. For example, NOV17 nucleic acids and polypeptides can be used to identify proteins that are members of the MCTs family of proteins. The NOV17 nucleic acids and polypeptides can also be used to screen for molecules, which inhibit or enhance NOV17 activity or function. Specifically, the nucleic acids and polypeptides according to the invention may be used as targets for the identification of small molecules that modulate or inhibit, e.g., cellular metabolism, or transport of monocarboxylates such as lactate and pyruvate. These molecules can be used to treat, e.g., infantile sialic storage disease.

In addition, various NOV17 nucleic acids and polypeptides according to the invention are useful, inter alia, as novel members of the protein families according to the presence of domains and sequence relatedness to previously described proteins. For example, the NOV17 nucleic acids and their encoded polypeptides include structural motifs that are characteristic of proteins belonging to the MCTs family. Monocarboxylates such as lactate and pyruvate play a pivotal role in cellular physiology of most mammalian cells. Lactic acid, in particular, is produced in huge amounts as an end-product of glycolysis. Some tissues, such as white skeletal muscle, red blood cells and tumor cells, rely on this pathway to produce majority of their ATP under normal physiological conditions, while all tissues become dependent on this pathway during hypoxia or ischaemia. Two molecules of lactic acid are generated for every glucose molecule during glycolysis. Lactic acid must be transported out of the cell if high rates of glycolysis are to be maintained. Accumulation of lactic acid leads to a decrease in intracellular pH and cessation of glycolysis. Lactic acid transport is carried out by a recently identified family of proton-linked monocarboxylate transporters (MCTs) located at the plasma membrane. At least 9 MCTs (MCT 1–9)-related genes have so far been identified in mammals, each having a different tissue distribution. MCTs also mediate the transport of many other metabolically important monocarboxylates such as pyruvate, the branched-chain oxo acids derived from leucine, valine and isoleucine, and the ketone bodies acetoacetate, -hydroxybutyrate and acetate.

The NOV17 nucleic acids and polypeptides, antibodies and related compounds according to the invention will be useful in therapeutic and diagnostic applications in the mediation of cellular metabolism and transport. As such the NOV17 nucleic acids and polypeptides, antibodies and related compounds according to the invention may be used to treat, e.g., Salla disease, infantile sialic acid storage disease, cystinosis, or streptozotocin-induced diabetes.

The NOV17 nucleic acids and polypeptides are useful for detecting specific cell types. For example, expression analysis has demonstrated that a NOV17a nucleic acid is expressed in adrenal gland, bone marrow, brain—amygdala, brain—cerebellum, brain—hippocampus, brain substantia nigra, brain—thalamus, brain—whole, fetal brain, fetal kidney, fetal liver, fetal lung, heart, kidney, lymphoma—Raji, mammary gland, pancreas, pituitary gland, placenta, prostate, salivary gland, skeletal muscle, small intestine, spinal cord, spleen, stomach, testis, thyroid, trachea, and uterus. Conversely, a NOV17b nucleic acid is expressed in parathyroid gland, liver, colon, muscle, brain, placenta, vulva, testis, lung, kidney, skin, and colon adenocarcinoma.

Additional utilities for NOV17 nucleic acids and polypeptides according to the invention are disclosed herein.

NOV18

The NOV18 proteins descibed herein are novel olfactory receptor/G-protein coupled receptor (GPCR)-like proteins. Two alternative novel NOV18 nucleic acids and polypeptides are disclosed herein, namely NOV18a and NOV18b.

NOV18a

A NOV18 variant is NOV18a (alternatively referred to herein as CG56510-01), which encodes the 1001 nucleotide sequence (SEQ ID NO:61) shown in Table 18A. An open reading frame for the mature protein was identified beginning with an ATG codon at nucleotides 37–39 and ending with a TGA codon at nucleotides 958–960. Putative untranslated regions, if any, downstream from the termination codon and upstream from the initiation codon are underlined. The start and stop codons are in bold letters.

The NOV18a protein (SEQ ID NO:62) encoded by SEQ ID NO:61 is 307 amino acid residues in length and is presented using the one-letter amino acid code in Table 18B. The SignalP, Psort and/or Hydropathy results indicate that NOV18a has a signal peptide and is likely to be localized at the plasma membrane with a certainty of 0.6000. Alternatively, a NOV18a polypeptide is located in the Golgi body with a certainty of 0.4000, the endoplasmic reticulum (membrane) with a certainty of 0.3000, or the microbody (peroxisome) with a certainty of 0.3000. The SignalP indicates a likely cleavage site for a NOV18a peptide between positions 39 and 40, i.e., at the dash in the sequence VTG-NG.

SNP variants of NOV18a are disclosed in Example 2.

NOV18b

Alternatively, a NOV18 variant is NOV18b (alternatively referred to herein as CG56510-02), which includes the 1101 nucleotide sequence (SEQ ID NO:63) shown in Table 18C. An open reading frame for the mature protein was identified beginning with an ATG codon at nucleotides 148–150 and ending with a TGA codon at nucleotides 1069–1071. Putative untranslated regions, if any, downstream from the termination codon and upstream from the initiation codon are underlined. The start and stop codons are in bold letters.

The NOV18b nucleic acid (SEQ ID NO:63) encodes the NOV18a protein SEQ ID NO:62.

NOV18 Clones

Unless specifically addressed as NOV18a or NOV18b, any reference to NOV18 is assumed to encompass all variants.

A search against the Patp database, a proprietary database that contains sequences published in patents and patent publication, yielded several homologous proteins shown in Table 18D.

In a BLAST search of public sequence databases, it was found, for example, that the NOV18 nucleic acid sequences of this invention have 590 of 911 bases (64%) identical to a gb:GENBANK-ID:AF101730|acc:AF101730.1 mRNA from Pan troglodytes isolate PTOR1E1 olfactory receptor gene, complete cds. Further, the full amino acid sequence of the disclosed NOV18 protein of the invention has 205 of 306 amino acid residues (66%) identical to, and 251 of 306 amino acid residues (82%) similar to, the 316 amino acid residue ptnr:SPTREMBL-ACC:Q9UGF7 protein from Human (BA150A6.1 (NOVEL 7 TRANSMEMBRANE RECEPTOR(RHODOPSIN FAMILY) (OLFACTORY RECEPTOR LIKE) PROTEIN (HS6M1-27))). While it has not been annotated as an olfactory receptor, genomic clone Genbank ID AL049739.2 shows 100% homology to NOV18.

Additional BLAST results are shown in Table 18E.

A multiple sequence alignment is given in Table 18F, with the NOV18 protein of the invention being shown in line 1 in a ClustalW analysis comparing NOV18 with related protein sequences of Table 18E.

The presence of identifiable domains in the disclosed NOV18 protein was determined by using Pfam and then determining the Interpro number. The results are listed in Table 18G with the statistics and domain description.

Consistent with other known members of the olfactory receptor family of proteins, NOV18 contains 7-transmembrane domains as illustrated in Table 18G.

The NOV18 nucleic acids, and the encoded polypeptide, according to the invention are useful in a variety of applications and contexts. For example, NOV18 nucleic acids and polypeptides can be used to identify proteins that are members of the olfactory receptor family of proteins. The NOV18 nucleic acids and polypeptides can also be used to screen for molecules, which inhibit or enhance NOV18 activity or function. Specifically, the nucleic acids and polypeptides according to the invention may be used as targets for the identification of small molecules that modulate or inhibit, e.g., cellular recognition, or G-protein-mediated transduction of odorant signals. These molecules can be used to treat, e.g., taste and scent detectability disorders, immune diseases, or signal transduction pathways.

In addition, the NOV18 nucleic acids and polypeptide according to the invention are useful, inter alia, as novel members of the protein families according to the presence of domains and sequence relatedness to previously described proteins. For example, the NOV18 nucleic acids and polypeptide include structural motifs that are characteristic of proteins belonging to the family of olfactory receptor proteins. Olfactory receptors have great variety, exquisite specificity, high sensitivity and fast response. The human olfactory epithelium contains two to three thousand distinct olfactory receptors, a class of G-protein coupled receptors. The receptors consist of seven hydrophobic segments that span the cell membrane (trans-membrane domains I–VII), separated by hydrophilic segments that project into the intra- or extra-cellular space. Transmembrane domains II–VII comprise a hypervariable segment that defines the ligand specificity of the receptor.

The NOV18 nucleic acids and polypeptide, antibodies and related compounds according to the invention will be useful in therapeutic and diagnostic applications in the mediation of signal transduction. As such the NOV18 nucleic acids and polypeptide, antibodies and related compounds according to the invention may be used to treat, e.g., developmental diseases, MHC II and III diseases (immune diseases), taste and scent detectability disorders, Burkitt's lymphoma, corticoneurogenic disease, signal transduction pathway disorders, retinal diseases including those involving photoreception, cell growth rate disorders, cell shape disorders, feeding disorders, control of feeding, potential obesity due to over-eating, potential disorders due to starvation (lack of apetite), noninsulin-dependent diabetes mellitus (NIDDM1), bacterial, fungal, protozoal and viral infections (particularly infections caused by HIV-1 or HIV-2), pain, cancer (including but not limited to neoplasm, adenocarcinoma, lymphoma, prostate cancer, uterus cancer), anorexia, bulimia, asthma, parkinson's disease, acute heart failure, hypotension, hypertension, urinary retention, osteoporosis, crohn's disease, multiple sclerosis, and treatment of albright hereditary ostoeodystrophy, angina pectoris, myocardial infarction, ulcers, asthma, allergies, benign prostatic hypertrophy, and psychotic and neurological disorders, including anxiety, schizophrenia, manic depression, delirium, dementia, severe mental retardation, dentatorubro-pallidoluysian atrophy(DRPLA) hypophosphatemic rickets, autosomal dominant (2) acrocallosal syndrome and dyskinesias, such as huntington's disease or gilles de la tourette syndrome.

The NOV18 nucleic acids and polypeptide are useful for detecting specific cell types. For example, expression analysis has demonstrated that a NOV18 nucleic acid is predominantly expressed in olfactory epithelium and taste receptor cells of the tongue. However, it is also expressed in apical microvilli of the retinal pigment epithelium, arterial (aortic), basal forebrain, brain, Burkitt lymphoma cell lines, corpus callosum, cardiac (atria and ventricle), caudate nucleus, CNS and peripheral tissue, cerebellum, cerebral cortex, colon, cortical neurogenic cells, endothelial (coronary artery and umbilical vein) cells, palate epithelia, eye, neonatal eye, frontal cortex, fetal hematopoietic cells, heart, hippocampus, hypothalamus, leukocytes, liver, fetal liver, lung, lung lymphoma cell lines, fetal lymphoid tissue, adult lymphoid tissue, those that express MHC II and III nervous, medulla, subthalamic nucleus, ovary, pancreas, pituitary, placenta, pons, prostate, putamen, serum, skeletal muscle, small intestine, smooth muscle (coronary artery in aortic) spinal cord, spleen, stomach, testis, thalamus, and thymus tissue.

Additional utilities for the NOV18 nucleic acid and polypeptide according to the invention are disclosed herein.

NOV19

A NOV19 polypeptide has been identified as a Major Duchenne Muscular Dystrophy (DP71)-like protein. The novel NOV19 nucleic acid sequences maps to the chromosome Xp21.2. Two alternative novel NOV19, NOV19a and NOV19b, nucleic acids and encoded polypeptides are provided.

NOV19a

A NOV19 variant is the novel NOV19a (alternatively referred to herein as CG56574-01), which includes the 2463 nucleotide sequence (SEQ ID NO:64) shown in Table 19A. A NOV19a ORF begins with a TGG initiation codon at nucleotides 3–5 and ends with a TAA codon at nucleotides 2106–2108. Putative untranslated regions upstream from the initiation codon and downstream from the termination codon are underlined in Table 19A, and the start and stop codons are in bold letters.

The NOV19a polypeptide (SEQ ID NO:65) encoded by SEQ ID NO:64 is 701 amino acid residues in length and is presented using the one-letter amino acid code in Table 19B. The Psort profile for the NOV19a predicts that this peptide is likely to be localized at the nucleus with a certainty of 0.9700.

NOV19b

Alternatively, a NOV19 variant is the novel NOV19b (alternatively referred to herein as CG56574-02), which includes the 2005 nucleotide sequence (SEQ ID NO:66) shown in Table 19C. NOV19b was created by polymerase chain reaction (PCR) using the primers: 5′GAAGCTCACTCCTCCACTCGTACC 3′ (SEQ ID NO:237) and 5′ATGAATATTATAAAAACCATGCGGGAA 3′ (SEQ ID NO:238). Primers were designed based on in silico predictions of the full length or some portion (one or more exons) of the cDNA/protein sequence of the invention. The PCR product derived by exon linking, covering the entire open reading frame, was cloned into the pCR2.1 vector from Invitrogen to provide clone 127720::M 18533r3 — 0 — 0.698587.P22.

The NOV19b ORF begins with a Kozak consensus ATG initiation codon at nucleotides 53–55 and ends with a TAA codon at nucleotides 1958–1960. Putative untranslated regions upstream from the initiation codon and downstream from the termination codon are underlined in Table 19C, and the start and stop codons are in bold letters.

Variant sequences of NOV19b are included in Example 2. A variant sequence can include a single nucleotide polymorphism (SNP). A SNP can, in some instances, be referred to as a “cSNP” to denote that the nucleotide sequence containing the SNP originates as a cDNA.

The NOV19b protein (SEQ ID NO:67) encoded by SEQ ID NO:66 is 635 amino acid residues in length and is presented using the one-letter code in Table 19D. The Psort profile for NOV19b predicts that this sequence is likely to be localized at the cytoplasm with a certainty of 0.4500. The Signal P predicts a likely cleavage site for a NOV19b peptide is between positions 64 and 65, i.e., at the dash in the sequence CDA-LD.

NOV19 Clones

Unless specifically addressed as NOV19a or NOV19b, any reference to NOV19 is assumed to encompass all variants. NOV19a polypeptide is longer than the NOV19b polypeptide, having an additional 66 amino acids on the N-terminus. NOV19a also differs from NOV19b at four amino acid residues [aa 119 (W>L); aa 215 (N>Y); aa 255 (S>G); aa 607 (T>A)] as shown Table 19G.

A search against the Patp database, a proprietary database that contains sequences published in patents and patent publications, yielded several homologous proteins shown in Table 19E.

In a BLAST search of public sequence databases, it was found, for example, that the NOV19a nucleic acid sequence of this invention has 1793 of 1798 bases (99%) identical to a gb:GENBANK-ID:HSDMDR|acc:X14298.1 mRNA from Homo sapiens (Human mRNA for MAJOR DUCHENNE MUSCULAR DYSTROPHY PROTEIN (DP71)). The NOV19a polypeptide sequence of the invention was found to have 620 of 635 amino acid residues (97%) identical to, and 620 of 635 amino acid residues (97%) similar to, the 622 amino acid residue ptnr:SPTREMBL-ACC:Q02295 protein from Homo sapiens (MAJOR DUCHENNE MUSCULAR DYSTROPHY PROTEIN (DP71)).

Similarly, it was found, for example, that the NOV19b nucleic acid sequence of this invention has 1793 of 1798 bases (99%) identical to a gb:GENBANK-ID:E30218|acc:E30218.1 mRNA from unidentified (Shortened dystrophin). The NOV19b polypeptide sequence of the invention also was found to have 620 of 635 amino acid residues (97%) identical to, and 620 of 635 amino acid residues (97%) similar to, the 622 amino acid residue ptnr:SPTREMBL-ACC:Q02295 protein from Homo sapiens (MAJOR DUCHENNE MUSCULAR DYSTROPHY PROTEIN (DP71)).

Additional BLAST results are shown in Table 19F.

A multiple sequence alignment is given in Table 19G, with the NOV19 protein of the invention being shown on line 1, in a ClustalW analysis comparing NOV19 with related protein sequences disclosed in Table 19F.

The NOV19 Clustal W alignment shown in Table 19G was modified to begin at amino residue 2801. The data in Table 19G includes all of the regions overlapping with the NOV19 protein sequences.

The presence of identifiable domains in the protein disclosed herein was determined by searches using algorithms such as PROSITE, Blocks, Pfam, ProDomain, Prints and then determining the Interpro number by crossing the domain match (or numbers) using the Interpro website (http:www.ebi.ac.uk/interpro/). Table 19H lists the domain description from DOMAIN analysis results against NOV19.

Consistent with other known members of the DP71 family of proteins, NOV19 contains a zinc finger ZZ domain as illustrated in Table 19H. NOV19 nucleic acids, and the encoded polypeptides, according to the invention are useful in a variety of applications and contexts. For example, NOV19 nucleic acids and polypeptides can be used to identify proteins that are members of the DP71 family of proteins. The NOV19 nucleic acids and polypeptides can also be used to screen for molecules, which inhibit or enhance NOV19 activity or function. Specifically, the nucleic acids and polypeptides according to the invention may be used as targets for the identification of small molecules that modulate or inhibit, e.g., cellular activation, cellular metabolism and signal transduction. These molecules can be used to treat, e.g., deafness 4, congenital sensorineural, Duchenne muscular dystrophy, Becker muscular dystroph, cardiomyopathy, dilated, X-linked, McLeod phenotype, Lesch-Nyhan syndrome, myasthenia gravis, Adrenal hypoplasia, congenital, with hypogonadotropic hypogonadism, Dosage-sensitive sex reversal, Glycerol kinase deficiency; Gonadal dysgenesis, XY female type, Hyperglycerolemia, diabetes, obesity, and Retinitis pigmentosa-6.

In addition, various NOV19 nucleic acids and polypeptides according to the invention are useful, inter alia, as novel members of the protein families according to the presence of domains and sequence relatedness to previously described proteins. For example, the NOV19 nucleic acids and their encoded polypeptides include structural motifs that are characteristic of proteins belonging to the family of DP71 such as the Major Duchenne Muscular Dystrophy proteins involved in skeletal muscle and nerve physiology.

Duchenne muscular dystrophy (DMD) is an X-linked recessive disorder which manifest as a progressive degeneration of muscles and results in death. A less severe disorder, Becker's muscular dystrophy (BMD), is allelic to DMD. Some 30% of DMD patients also suffer also from mental retardation. The DMD gene is the largest known gene, consisting of almost 0.1% of the human genome (2,500 Kbp). The product of the DMD gene in the muscle, dystrophin, is a 427 kDa protein translated from a 14 kb mRNA. Dystrophin is a rod-shaped protein consisting of an actin binding N-terminal domain, a large domain of spectrin-like repeats, a cystein-rich domain with potential Ca2+ binding sites, and a C-terminal domain. A very similar isoform of dystrophin, encoded by the same gene, is found in the brain. The expression of the two isoforms is regulated by two promoters. One is active in muscle cells and glia cells. The other is active mainly in neurons. A 70.8 kDa protein, called Dp71, is the product of a promoter located between exons 62 and 63 of the DMD gene.

Dp71 is of special interest as it consists of the cysteine-rich and C-terminal domains of dystrophin, but lacks the actin binding domain and the spectrin-like repeats. Dp7 is by far the major product of the DMD gene in brain and many other nonmuscle tissues. Analysis of the expression of the DMD gene products during development has shown that Dp71 is already expressed in the embryonic stem cells. The known dystrophins and their mRNAs are detected only after differentiation of specialized cell types.

The NOV19 nucleic acids and polypeptides, antibodies and related compounds according to the invention will be useful in therapeutic and diagnostic applications in the mediation of muscle and nerve physiology. As such, the NOV19 nucleic acids and polypeptides, antibodies and related compounds according to the invention may be used to treat muscle and nervous system disorders, e.g., Duchenne muscular dystrophy, Becker muscular dystroph, cardiomyopathy, dilated, X-linked, McLeod phenotype, Lesch-Nyhan syndrome, myasthenia gravis.

The NOV19 nucleic acids and polypeptides are useful for detecting specific cell types. For example, expression analysis has demonstrated that a NOV19 nucleic acid is expressed in Adipose, Aorta, Vein, Umbilical Vein, Adrenal Gland/Suprarenal gland, Pancreas, Thyroid, Parotid Salivary glands, Stomach, Liver, Colon, Bone Marrow, Peripheral Blood, Spleen, Lymph node, Tonsils, Bone, Cartilage, Muscle, Skeletal Muscle, Brain, Cerebellum, Left cerebellum, Thalamus, Pituitary Gland, Temporal Lobe, Amygdala, Substantia Nigra, Hippocampus, Spinal Chord, Cervix, Mammary gland/Breast, Ovary, Placenta, Uterus, Oviduct/Uterine Tube/Fallopian tube, Prostate, Testis, Lung, Kidney, Retina, Cochlea, and Foreskin.

Additional utilities for NOV19 nucleic acids and polypeptides according to the invention are disclosed herein.

NOV20

A NOV20 polypeptide has been identified as a G Protein-Coupled Receptor RTA (GPCR)-like protein. The novel NOV20 nucleic acid sequences maps to the chromosome11. Two alternative novel NOV20, NOV20a and NOV20b, nucleic acids and encoded polypeptides are provided.

NOV20a

A NOV20 variant is the novel NOV20a (alternatively referred to herein as CG56517-01), which includes the 1219 nucleotide sequence (SEQ ID NO:68) shown in Table 20A. A NOV20a ORF begins with a Kozak onsensus sequence ATG initiation codon at nucleotides 31–33 and ends with a TGA codon at nucleotides 1051–1053. Putative untranslated regions upstream from the initiation codon and downstream from the termination codon are underlined in Table 20A, and the start and stop codons are in bold letters.

The NOV20a polypeptide (SEQ ID NO:69) encoded by SEQ ID NO:68 is 340 amino acid residues in length and is presented using the one-letter amino acid code in Table 20B. The Psort profile for the NOV20a and NOV20b proteins predicts that this peptides are likely to be localized at the plasma membrane with a certainty of 0.6000. The Signal P predicts a likely cleavage site for a NOV20 peptide is between positions 67 and 68, i.e., at the dash in the sequence VLW-FF.

NOV20b

Alternatively, a NOV20 variant is the novel NOV20b (alternatively referred to herein as CG56517-02), which includes the 1113 nucleotide sequence (SEQ ID NO:70) shown in Table 20C. NOV20b was created by polymerase chain reaction (PCR) using the primers: 5′-ATCAGGACAGCTGCAGGTGGGT-3′ (SEQ ID NO:242) and 5′-TCTCCTGTATGGACTCAGAAGAAGGTG-3′ (SEQ ID NO:243). Primers were designed based on in silico predictions of the fall length or some portion (one or more exons) of the cDNA/protein sequence of the invention. The PCR product derived by exon linking, covering the entire open reading frame, was cloned into the pCR2.1 vector from Invitrogen to provide clone CG56517-01.698754.A13.

The NOV20b ORF begins with a Kozak consensus ATG initiation codon at nucleotides 73–75 and ends with a TGA codon at nucleotides 1102–1104. Putative untranslated regions upstream from the initiation codon and downstream from the termination codon are underlined in Table 20C, and the start and stop codons are in bold letters.

The NOV20b protein (SEQ ID NO:71) encoded by SEQ ID NO:70 is 343 amino acid residues in length and is presented using the one-letter code in Table 20D.

NOV20 Clones

Unless specifically addressed as NOV20a or NOV20b, any reference to NOV20 is assumed to encompass all variants. NOV20b has four frame-shifts at position 762, 959, 986, and 1042 bp, respectively, when compared with NOV20a. These frame-shifts result in numerous amino acid differences between NOV20a and NOV20b.

A search against the Patp database, a proprietary database that contains sequences published in patents and patent publications, yielded several homologous proteins shown in Table 20E and Table 20F.

In a BLAST search of public sequence databases, it was found, for example, that the NOV20a nucleic acid sequence of this invention has 840 of 1032 bases (81%) identical to a gb:GENBANK-ID:RATRTA|acc:M35297.1 mRNA from Rattus norvegicus probableG protein-coupled receptor (RTA) mRNA, complete cds. NOV20a protein of the invention was found to have 265 of 343 amino acid residues (77%) identical to, and 280 of 343 amino acid residues (81%) similar to, the 343 amino acid residue ptnr:SWISSPROT-ACC:P23749 protein from probable Rattus norvegicus G protein-coupled receptor RTA.

Similarly, it was found, for example, that the NOV20b nucleic acid sequence of this invention has 903 of 1086 bases (83%) identical to a gb:GENBANK-ID:RATRTA|acc:M35297.1 mRNA from Rattus norvegicus G protein-coupled receptor (RTA) mRNA, complete cds. NOV20b protein of the invention was found to have 291 of 343 amino acid residues (84%) identical to, and 307 of 343 amino acid residues (89%) similar to, the 343 amino acid residue ptnr:SWISSPROT-ACC:P23749 protein from Rattus norvegicus probable G protein-coupled receptor RTA.

Additional BLAST results are shown in Table 20G.

A multiple sequence alignment is given in Table 20I, with the NOV20 protein of the invention being shown on line 1, in a ClustalW analysis comparing NOV20 with related protein sequences disclosed in Table 20G and Table 20H.

The presence of identifiable domains in the protein disclosed herein was determined by searches using algorithms such as PROSITE, Blocks, Pfam, ProDomain, Prints and then determining the Interpro number by crossing the domain match (or numbers) using the Interpro website (http:www.ebi.ac.uk/interpro/). The DOMAIN analysis results indicate that the NOV20 protein contains the following protein domain (as defined by Interpro): domain name 7tm — 1 7 transmembrane receptor (rhodopsin family). DOMAIN results for NOV20 were collected from the Conserved Domain Database (CDD) with Reverse Position Specific BLAST. This BLAST samples domains found in the Smart and Pfam collections.

As discussed below, the NOV20 protein of the invention contained significant homology to the 7tm — 1 domain. This indicates that the NOV20 sequence has properties similar to those of other proteins known to contain this 7tm — 1 domain and similar to the properties of these domains. The 254 amino acid domain termed 7tm — 1 (SEQ ID NO:248; Pfam Acc. No. 00001) a seven transmembrane receptor (rhodopsin family), is shown in Table 20J.

The DOMAIN results are listed in Table 20K and Table 20L with the statistics and domain description. An alignment of NOV20a residues 61–290 (SEQ ID NO:68) with the full 7tm — 1 domain, residues 1–254 (SEQ ID NO:248), are shown in Table 20K. A similar alignment of NOV20b residues 61–290 (SEQ ID NO:70), are shown in Table 20L. This indicates that the NOV20 sequences have properties similar to those of other proteins known to contain this domain as well as to the 254 amino acid 7tm domain (SEQ ID NO:248). For Table 20K and Table 20L, fully conserved single residues are indicated by the vertical line and “strong” semi-conserved residues are indicated by the “plus sign.” The “strong” group of conserved amino acid residues may be any one of the following groups of amino acids: STA, NEQK, NHQK, NDEQ, QHRK, MILV, MILF, HY, FYW.

Consistent with other known members of the GPCR family of proteins, NOV20 contains 7tm — 1 7 transmembrane receptor (rhodopsin family) domain as illustrated in Table 20K and Table 20L, as well as homology and cellular localization, i.e. plasma membrane.

NOV20 nucleic acids, and the encoded polypeptides, according to the invention are useful in a variety of applications and contexts. For example, NOV20 nucleic acids and polypeptides can be used to identify proteins that are members of the GPCR family of proteins. The NOV20 nucleic acids and polypeptides can also be used to screen for molecules, which inhibit or enhance NOV20 activity or function. Specifically, the nucleic acids and polypeptides according to the invention may be used as targets for the identification of small molecules that modulate or inhibit, e.g., cellular signal transduction. These molecules can be used to treat, e.g., cancer, immune disorders, and endocrine disorders.

In addition, various NOV20 nucleic acids and polypeptides according to the invention are useful, inter alia, as novel members of the protein families according to the presence of domains and sequence relatedness to previously described proteins. For example, the NOV20 nucleic acids and their encoded polypeptides include 7tm — 1 7 transmembrane receptor (rhodopsin family) domain and sequence homology that are characteristic of proteins belonging to the family of GPCR such as the G protein-coupled receptor (RTA). The GPCR1 protein of the invention has a high homology to the 7tm — 1 domain (PFam Acc. No. pfam00001). The 7tm — 1 domain is from the 7 transmembrane receptor family, which includes a number of different proteins, including, for example, serotonin receptors, dopamine receptors, histamine receptors, andrenergic receptors, cannabinoid receptors, angiotensin II receptors, chemokine receptors, opioid receptors, G-protein coupled receptor (GPCR) proteins, olfactory receptors (OR), and the like.

G-Protein Coupled Receptor proteins (“GPCRs”) have been identified as a large family of G protein-coupled receptors in a number of species. These receptors share a seven transmembrane domain structure with many neurotransmitter and hormone receptors, and are likely to underlie the recognition and G-protein-mediated transduction of various signals. Human GPCR generally do not contain introns and belong to four different gene subfamilies, displaying great sequence variability. These genes are dominantly expressed in olfactory epithelium. See, e.g., Ben-Arie et al., Hum. Mol. Genet. 3:229–235(1994); and, Online Mendelian Inheritance in Man (“OMIM”) entry # 164342 (http://www.ncbi.nlm.nih.gov/entrez/dispomim.cgi?).

The NOV20 nucleic acids and polypeptides, antibodies and related compounds according to the invention will be useful in therapeutic and diagnostic applications in the mediation of cellular signal transduction. As such the NOV20 nucleic acids and polypeptides, antibodies and related compounds according to the invention may be used to treat a wide range of disorders such as cancer, immune disorders, endocrine disorders and other diseases, e.g., developmental diseases; MHCII and III diseases (immune diseases); taste and scent detectability disorders; Burkitt's lymphoma; corticoneurogenic disease; signal transduction pathway disorders; metabolic pathway disorders; retinal diseases including those involving photoreception; cell growth rate disorders; cell shape disorders; metabolic disorders; feeding disorders; control of feeding; the metabolic syndrome X; wasting disorders associated with chronic diseases; obesity; potential obesity due to over-eating or metabolic disturbances; potential disorders due to starvation (lack of appetite); diabetes; noninsulin-dependent diabetes mellitus (NIDDM); infectious disease; bacterial, fungal, protozoal and viral infections (particularly infections caused by HIV-1 or HIV-2); pain; cancer (including but not limited to neoplasm; adenocarcinoma; lymphoma; prostate cancer; uterus cancer); cancer-associated cachexia; anorexia; bulimia; asthma; Parkinson's disease; acute heart failure; hypotension; hypertension; urinary retention; osteoporosis; Crohn's disease; multiple sclerosis; Albright Hereditary Ostoeodystrophy; angina pectoris; myocardial infarction; ulcers; allergies; benign prostatic hypertrophy; and psychotic and neurological disorders; including anxiety; schizophrenia; manic depression; delirium; dementia; neurodegenerative disorders; Alzheimer's disease; severe mental retardation; Dentatorubro-pallidoluysian atrophy (DRPLA); Hypophosphatemic rickets; autosomal dominant (2) Acrocallosal syndrome and dyskinesias, such as Huntington's disease or Gilles de la Tourette syndrome; immune disorders; Adrenoleukodystrophy; Congenital Adrenal Hyperplasia; Hemophilia; Hypercoagulation; Idiopathic thrombocytopenic purpura; autoimmume disease; immunodeficiencies; transplantation; Von Hippel-Lindau (VHL) syndrome; Stroke; Tuberous sclerosis; hypercalceimia; Cerebral palsy; Epilepsy; Lesch-Nyhan syndrome; Ataxia-telangiectasia; Leukodystrophies; Behavioral disorders; Addiction; Neuroprotection; Cirrhosis; Transplantation; Systemic lupus erythematosus; Emphysema; Scleroderma; ARDS; Renal artery stenosis; Interstitial nephritis; Glomerulonephritis; Polycystic kidney disease; Systemic lupus erythematosus; Renal tubular acidosis; IgA nephropathy; Cardiomyopathy; Atherosclerosis; Congenital heart defects; Aortic stenosis; Atrial septal defect (ASD); Atrioventricular (A-V) canal defect; Ductus arteriosus; Pulmonary stenosis; Subaortic stenosis; Ventricular septal defect (VSD); valve diseases; Scleroderma; fertility; Pancreatitis; Endocrine dysfunctions; Growth and reproductive disorders; Inflammatory bowel disease; Diverticular disease; Leukodystrophies; Graft vesus host; Hyperthyroidism; Endometriosis; and hematopoietic disorders.

The NOV20 nucleic acids and polypeptides are useful for detecting specific cell types. For example, expression analysis has demonstrated that a NOV20 nucleic acid is expressed in Brain, Synovium/Synovial membrane.

Additional utilities for NOV20 nucleic acids and polypeptides according to the invention are disclosed herein.

NOV21

A NOV21 polypeptide has been identified as a TFIIIC box B-binding subunit-like protein (also referred to as CG56500-01). The disclosed novel NOV21 nucleic acid (SEQ ID NO:72) of 6921 nucleotides is shown in Table 21A. The cDNA coding for the NOV21 was cloned by polymerase chain reaction (PCR) using the following primers: 5′-CCATGGGCCGACCGGCTC-3′ (SEQ ID NO:249) and 5′-TGGCGGGCTTCCTCGTCATC-3′ (SEQ ID NO:250) on the following pools of human cDNAs: Pool 1—adrenal gland, bone marrow, brain—amygdala, brain—cerebellum, brain—hippocampus, brain—substantia nigra, brain—thalamus, brain—whole, fetal brain, fetal kidney, fetal liver, fetal lung, heart, kidney, lymphoma—Raji, mammary gland, pancreas, pituitary gland, placenta, prostate, salivary gland, skeletal muscle, small intestine, spinal cord, spleen, stomach, testis, thyroid, trachea, uterus. The novel NOV21 nucleic acid sequences maps to the chromosome16p12.

An ORF begins with an ATG initiation codon at nucleotides 61–63 and ends with a TAG codon at nucleotides 6313–6315. A putative untranslated region and/or downstream from the termination codon is underlined in Table 21A, and the start and stop codons are in bold letters.

The NOV21 protein (SEQ ID NO:73) encoded by SEQ ID NO:72 is 2084 amino acid residues in length and is presented using the one-letter amino acid code in Table 21B. NOV21 has two SNP variants, whose variant positions for its nucleotide and amino acid sequences is numbered according to SEQ ID NOS:72 and 73, respectively. A variant sequence can include a single nucleotide polymorphism (SNP). A SNP can, in some instances, be referred to as a “cSNP” to denote that the nucleotide sequence containing the SNP originates as a cDNA.

NOV21 has at least two variants. Variant 13376755 is a G to A SNP at 129 bp of the nucleotide sequence that results in no change in the protein sequence (silent), and variant c100.2613 is an insertion of nucleotide C before 5780 bp of the nucleotide sequence that results in a frameshift with all amino acids after 1907 being discordant with the original protein sequence.

Psort analysis predicts the NOV21 protein of the invention to be localized in the nucleus with a certainty of 0.8000, as expected by a transcription factor subunit. As expected for a member of the TFIIIC box B-binding subunit protein family, no identifiable domains with significant score were identified in the NOV21 polypeptide by searches using algorithms such as PROSITE, Blocks, Pfam, ProDomain, Prints.

A search against the Patp database, a proprietary database that contains sequences published in patents and patent publications, yielded several homologous proteins shown in Table 21C.

In a BLAST search of public sequence databases, it was found, for example, that the nucleic acid sequence of this invention has 6006 of 6134 bases (97%) identical to a gb:GENBANK-ID:HSU02619|acc:U02619.1 mRNA from Homo sapiens (Human TFIIIC Box B-binding subunit mRNA, complete cds). The NOV21 polypeptide was found to have 1937 of 1948 amino acid residues (99%) identical to, and 1939 of 1948 amino acid residues (99%) similar to, the 2109 amino acid residue ptnr:SPTREMBL-ACC:Q12789 protein from Homo sapiens (TFIIIC BOX B-BINDING SUBUNIT (TRANSCRIPTION FACTOR (TFIIIC) ALPHA CHAIN) (3′ PARTIAL)). The NOV21 polypeptide lacks 25 internal amino acids, when compared to ptnr:SPTREMBL-ACC:Q12789 protein from Homo sapiens (Human) (TFIIIC BOX B-BINDING SUBUNIT (TRANSCRIPTION FACTOR (TFIIIC) ALPHA CHAIN) (3′ PARTIAL)).

NOV21 also has homology to the proteins shown in the BLASTP data in Table 21D.

A multiple sequence alignment is given in Table 21E, with the NOV21 protein being shown on line 1 in Table 21E in a ClustalW analysis, and comparing the NOV21 protein with the related protein sequences shown in Table 21D. This BLASTP data is displayed graphically in the ClustalW in Table 21E.

Consistent with other known members of the TFIIIC box B-binding subunit family of proteins, NOV21 has, for example, homology to other members of the TFIIIC box B-binding subunit family and nuclear localization.

NOV21 nucleic acids, and the encoded polypeptides, according to the invention are useful in a variety of applications and contexts. For example, NOV21 nucleic acids and polypeptides can be used to identify proteins that are members of the TFIIIC box B-binding subunit family of proteins. The NOV21 nucleic acids and polypeptides can also be used to screen for molecules, which inhibit or enhance NOV21 activity or function. Specifically, the nucleic acids and polypeptides according to the invention may be used as targets for the identification of small molecules that modulate or inhibit, e.g., gene transcription. These molecules can be used to treat, e.g., cancer and viral disease.

In addition, various NOV21 nucleic acids and polypeptides according to the invention are useful, inter alia, as novel members of the protein families according to the sequence relatedness to previously described proteins. For example, the NOV20 nucleic acids and their encoded polypeptides show homology to proteins belonging to the family of TFIIIC box B-binding subunit proteins such as the α-chain of the Human TFIIIC box B-binding subunit.

Transcription factor IIIC (TFIIIC) is a multisubunit basic TF for RNA polymerase III. It initiates transcription complex assembly on tRNA and related genes by binding to the internal box B promoter element and is also required for transcription of 5S rRNA and other stable nuclear and cytoplasmic RNAs transcribed by polymerase III. In mammalian cells, regulation of TFIIIC activity controls overall polymerase III transcription in response to growth factors and viral infection. A full-length cDNA (and genomic DNA from the transcription initiation region) encoding the box B binding subunit of human TFIIIC, the 243-kDa alpha subunit has been reported and shown to encode a component of TFIIIC. (L'Etoile et al., Proc Natl Acad Sci USA, 91: 1652–6(1994)).

The NOV21 nucleic acids and polypeptides, antibodies and related compounds according to the invention will be useful in therapeutic and diagnostic applications in gene regulation. As such the NOV21 nucleic acids and polypeptides, antibodies and related compounds according to the invention may be used to treat cancer and viral infections, e.g., TFIIIC box B-binding subunit protein is cleaved and inactivated by the poliovirus-encoded 3C protease during poliovirus infection (Shen et al., Mol. Cell. Biol, 16: 4163–71 (1996)).

The NOV21 nucleic acids and polypeptides are useful for detecting specific cell types. For example, expression analysis has demonstrated that a NOV21 nucleic acid is expressed in adrenal gland, bone marrow, brain—amygdala, brain—cerebellum, brain—hippocampus, brain substantia nigra, brain—thalamus, brain—whole, fetal brain, fetal kidney, fetal liver, fetal lung, heart, kidney, lymphoma—Raji, mammary gland, pancreas, pituitary gland, placenta, prostate, salivary gland, skeletal muscle, small intestine, spinal cord, spleen, stomach, testis, thyroid, trachea, uterus, Adipose, Aorta, Bone, Bronchus, Cartilage, Cervix, Chorionic Villus, Colon, Coronary Artery, Dermis, Epidermis, Hypothalamus, Liver, Lung, Lymph node, Lymphoid tissue, Myometrium, Ovary, Peripheral Blood, Respiratory Bronchiole, Retina, Right Cerebellum, synovium/synovial membrane, Temporal Lobe, Thymus, Tonsils, Umbilical Vein, Vein, Vulva, and Whole Organism.

Additional utilities for NOV21 nucleic acids and polypeptides according to the invention are disclosed herein.

NOV22

A NOV22 polypeptide has been identified as a Nucleoside Diphosphate Kinase B-like protein (also referred to as CG56475-01). The disclosed novel NOV22 nucleic acid (SEQ ID NO:74) of 473 nucleotides is shown in Table 22A. The novel NOV22 nucleic acid sequences maps to the chromosome 2.

An ORF begins with an ATG initiation codon at nucleotides 12–14 and ends with a TAA codon at nucleotides 464–466. A putative untranslated region and/or downstream from the termination codon is underlined in Table 22A, and the start and stop codons are in bold letters.

The NOV22 protein (SEQ ID NO:75) encoded by SEQ ID NO:74 is 181 amino acid residues in length and is presented using the one-letter amino acid code in Table 22B. Psort analysis predicts the NOV22 protein of the invention to be localized in the cytoplasm with a certainty of 0.6500.

A search against the Patp database, a proprietary database that contains sequences published in patents and patent publications, yielded several homologous proteins shown in Table

In a BLAST search of public sequence databases, it was found, for example, that the nucleic acid sequence of this invention has 376 of 475 bases (79%) identical to a gb:GENBANK-ID:HUMPUF|acc:L16785.1 mRNA from Homo sapiens (c-myc transcription factor (puf) mRNA, complete cds). The NOV22 polypeptide of the invention was found to have 100 of 152 amino acid residues (65%) identical to, and 113 of 152 amino acid residues (74%) similar to, the 152 amino acid residue ptnr:SWISSPROT-ACC:P22392 protein from Homo sapiens (NUCLEOSIDE DIPHOSPHATE KINASE B (EC 2.7.4.6) (NDK B) (NDP KINASE B) (NM23-H2) (C-MYC PURINE-BINDING TRANSCRIPTION FACTOR PUF)).

NOV22 also has homology to the proteins shown in the BLASTP data in Table 22D.

A multiple sequence alignment is given in Table 22E, with the NOV22 protein being shown on line 1 in Table 22E in a ClustalW analysis, and comparing the NOV22 protein with the related protein sequences shown in Table 22D. This BLASTP data is displayed graphically in the ClustalW in Table 22E.

The presence of identifiable domains in the protein disclosed herein was determined by searches using algorithms such as PROSITE, Blocks, Pfam, ProDomain, Prints and then determining the Interpro number by crossing the domain match (or numbers) using the Interpro website (http:www.ebi.ac.uk/interpro/). Table 22F lists the domain description from DOMAIN analysis results against NOV22.

Consistent with other known members of the subunit family of proteins, NOV22 has, for example, an Nucleoside Diphosphate Kinase (NDK) signature sequence and homology to other members of the Nucleoside Diphosphate Kinase B family.

NOV22 nucleic acids, and the encoded polypeptides, according to the invention are useful in a variety of applications and contexts. For example, NOV22 nucleic acids and polypeptides can be used to identify proteins that are members of the Nucleo side Diphosphate Kinase B family of proteins. The NOV22 nucleic acids and polypeptides can also be used to screen for molecules, which inhibit or enhance NOV22 activity or function. Specifically, the nucleic acids and polypeptides according to the invention may be used as targets for the identification of small molecules that modulate or inhibit, e.g., nucleic acid synthesis, CTP for lipid synthesis, UTP for polysaccharide synthesis and GTP for protein elongation, signal transduction and microtubule polymerization. These molecules can be used to treat disorders of metabolism, cellular growth and differentiation, e.g., cancer.

In addition, various NOV22 nucleic acids and polypeptides according to the invention are useful, inter alia, as novel members of the protein families according to the presence of domains and sequence relatedness to previously described proteins. For example, the NOV20 nucleic acids and their encoded polypeptides show homology to proteins belonging to the family of Nucleoside Diphosphate Kinase B such as human nicleoside diphosphate kinase B (EC 2.7.4.6).

Nucleoside diphosphate kinases (EC 2.7.4.6) (NDK) are enzymes required for the synthesis of nucleoside triphosphates (NTP) other than ATP. They provide NTPs for nucleic acid synthesis, CTP for lipid synthesis, UTP for polysaccharide synthesis and GTP for protein elongation, signal transduction and microtubule polymerization (Parks, R. and Agarwal R., In: The enzymes—Group transfer. Boyer P. D. (Ed.) Academic Press, New York, 1973, pp. 307–334).

In eukaryotes, there is a small family of NDK isozymes each of which acts in a different subcellular compartment and/or has a distinct biological function. Eukaryotic NDK isozymes are hexamers of two highly related chains (A and B) (Gilles, et al., J. Biol. Chem. 266: 8784–8789(1991)). By random association (A6, A5B . . . AB5, B6), these two kinds of chain form isoenzymes differing in their isoelectric point.

NDK are proteins of 17 Kd that act via a ping-pong mechanism in which a histidine residue is phosphorylated, by transfer of the terminal phosphate group from ATP. In the presence of magnesium, the phosphoenzyme can transfer its phosphate group to any NDP, to produce an NTP.

NDK isozymes have been sequenced from prokaryotic and eukaryotic sources. It has also been shown that the Drosophila awd (abnormal wing discs) protein, is a microtubule-associated NDK (Biggs et al., Cell 63: 933–940(1990)). Mammalian NDK is also known as metastasis inhibition factor nm23. The sequence of NDK has been highly conserved through evolution. There is a single histidine residue conserved in all known NDK isozymes within the NDK signature, which is involved in the catalytic mechanism (Gilles, et al., J. Biol. Chem. 266: 8784–8789 (1991)).

The NOV22 nucleic acids and polypeptides, antibodies and related compounds according to the invention will be useful in therapeutic and diagnostic applications in cellular growth and metabolism. As such the NOV22 nucleic acids and polypeptides, antibodies and related compounds according to the invention may be used to treat cancer, e.g., atherosclerosis, aneurysm, hypertension, fibromuscular dysplasia, stroke, scleroderma, obesity, transplantation, myocardial infarction, embolism, cardiovascular disorders, bypass surgery, fertility disorders, myasthenia gravis, leukodystrophies, pain, neuroprotection, systemic lupus erythematosus, autoimmune disease, asthma, emphysema, scleroderma, allergy, ARDS and other diseases, disorders and conditions of the like.

The NOV22 nucleic acids and polypeptides are useful for detecting specific cell types. For example, expression analysis has demonstrated that a NOV22 nucleic acid is expressed in lymphocyte, placental, liver, cardiovascular, nervous, respiratory, and immune systems, and this protein is found in reduced amount in tumor cells of high metastasic potential. Accordingly, the NOV22 nucleic acids, polypeptides, antibodies and related compounds according to the invention will have diagnostic and therapeutic applications in the detection of cancer.

Additional utilities for NOV22 nucleic acids and polypeptides according to the invention are disclosed herein.

NOV23

A NOV23 polypeptide has been identified as a T-cell-like protein (also referred to as CG56352-02). The disclosed novel NOV23 nucleic acid (SEQ ID NO:76) of 1326 nucleotides is shown in Table 23A. An ORF begins with an ATG initiation codon at nucleotides 19–21 and ends with a TAG codon at nucleotides 1324–1326. A putative untranslated region and/or downstream from the termination codon is underlined in Table 23A, and the start and stop codons are in bold letters. The NOV23 nucleotide sequence maps to chromosome 5.

The NOV23 protein (SEQ ID NO:77) encoded by SEQ ID NO:76 is 401 amino acid residues in length and is presented using the one-letter amino acid code in Table 23B. NOV23 has one SNP variants, whose variant positions for its nucleotide and amino acid sequences is numbered according to SEQ ID NOS:76 and 77, respectively. A variant sequence can include a single nucleotide polymorphism (SNP). A SNP can, in some instances, be referred to as a “cSNP” to denote that the nucleotide sequence containing the SNP originates as a cDNA. Variant 13376756 is a G to T SNP at 839 bp of the nucleotide sequence that results in an Arg to Leu change at amino acid 240 of protein sequence.

Psort analysis predicts the NOV23 protein of the invention to be localized in the endoplasmic reticulum (membrane) with a certainty of 0.6850. The Signal P predicts a likely cleavage site for a NOV23 peptide is between positions 26 and 27, i.e., at the dash in the sequence VHR-IG.

A search against the Patp database, a proprietary database that contains sequences published in patents and patent publications, yielded several homologous proteins shown in Table 23C.

In a BLAST search of public sequence databases, it was found, for example, that the NOV23 polypeptide of the invention was found to have 274 of 298 amino acid residues (91%) identical to, and 278 of 298 amino acid residues (93%) similar, to the 301 amino acid residue ptr:SPTREMBL-ACC:Q96K94 cDNA FLJ14428 FIS, clone HEMBA1006293 ( Homo sapiens ). NOV23 also has homology to the proteins shown in the BLASTP data in Table 23D.

A multiple sequence alignment is given in Table 23E, with the NOV23 protein being shown on line 1 in Table 23E in a ClustalW analysis, and comparing the NOV23 protein with the related protein sequences shown in Table 23D. This BLASTP data is displayed graphically in the ClustalW in Table 23E.

The presence of identifiable domains in the protein disclosed herein was determined by searches using algorithms such as PROSITE, Blocks, Pfam, ProDomain, Prints and then determining the Interpro number by crossing the domain match (or numbers) using the Interpro website (http:www.ebi.ac.uk/interpro/). Table 23F lists the domain description from DOMAIN analysis results against NOV23.

Consistent with other known members of the immunoglobulin superfamily class of proteins, e.g., T-cell proteins, NOV23 has, for example, an immunoglobulin signature sequence and homology to the ‘human gene 200’ protein (WO1049), may represent a previously unknown splice variant. NOV23 nucleic acids, and the encoded polypeptides, according to the invention are useful in a variety of applications and contexts. For example, NOV23 nucleic acids and polypeptides can be used to identify proteins that are members of the T-cell family of proteins. The NOV23 nucleic acids and polypeptides can also be used to screen for molecules, which inhibit or enhance NOV23 activity or function. Specifically, the nucleic acids and polypeptides according to the invention may be used as targets for the identification of small molecules that modulate or inhibit immune function. These molecules can be used to treat inflammation, allergies, and other immune disorders.

In addition, various NOV23 nucleic acids and polypeptides according to the invention are useful, inter alia, as novel members of the protein families according to the presence of domains and sequence relatedness to previously described proteins. For example, the NOV23 nucleic acids and their encoded polypeptides show homology to proteins belonging to the immunoglobulin superfamily such as kidney injury molecule-1 (KIM-1). KIM-1 seems to play a role in cell adhesion.

The basic structure of immunoglobulin (Ig) molecules is a tetramer of two light chains and two heavy chains linked by disulfide bonds (Gough, Trends Biochem. Sci. 6: 203–205(1981)). There are two types of light chains: kappa and lambda, each composed of a constant domain (CL) and a variable domain (VL). There are five types of heavy chains: alpha, delta, epsilon, gamma and mu, all consisting of a variable domain (VH) and three (in alpha, delta and gamma) or four (in epsilon and mu) constant domains (CH1 to CH4). The major histocompatibility complex (MHC) molecules are made of two chains. In class I the alpha chain is composed of three extracellular domains, a transmembrane region and a cytoplasmic tail (Klein and Figueroa, Immunol. Today 7: 41–44(1986)). The beta chain (beta-2-microglobulin) is composed of a single extracellular domain. In class II (Figueroa and Klein, J. Immunol. Today 7: 78–81(1986)), both the alpha and the beta chains are composed of two extracellular domains, a transmembrane region and a cytoplasmic tail. It is known that the Ig constant chain domains and a single extracellular domain in each type of MHC chains are related (Orr et al., Nature 282: 266–270 (1979); Cushley and Owen, Immunol. Today 4: 88–92(1983)).

These homologous domains are approximately one hundred amino acids long and include a conserved intradomain disulfide bond. Members of the immunoglobulin superfamily are found in hundreds of proteins of different functions. Examples include antibodies, the giant muscle kinase titin and receptor tyrosine kinases. Immunoglobulin-like domains may be involved in protein—protein and protein-ligand interactions.

The NOV23 nucleic acids and polypeptides, antibodies and related compounds according to the invention will be useful in therapeutic and diagnostic applications in cellular growth and metabolism. As such the NOV23 nucleic acids and polypeptides, antibodies and related compounds according to the invention may be used to immune disorders, e.g., inflammation, allergies, autoimmune disease, and asthma.

The NOV23 nucleic acids and polypeptides are useful for detecting specific cell types. For example, expression analysis has demonstrated that a NOV23 nucleic acid is differentially expressed in mononuclear cells, B and CD4+ lymphocytes, as well as secondary Th1, −2, and Tr1 cells. Accordingly, the NOV23 nucleic acids, polypeptides, antibodies and related compounds according to the invention will have diagnostic and therapeutic applications in the detection of immune disorders and inflammation.

Additional utilities for NOV23 nucleic acids and polypeptides according to the invention are disclosed herein.

NOV24

A NOV24 polypeptide has been identified as a Organin Anion Transporter (OAT)-like protein. The novel NOV24 nucleic acid sequences maps to the chromosome 11. Two alternative novel NOV24, NOV24a and NOV24b, nucleic acids and encoded polypeptides are provided.

NOV24a

A NOV24 variant is the novel NOV24a (alternatively referred to herein as CG56062-01), which includes the 1741 nucleotide sequence (SEQ ID NO:78) shown in Table 24A. A NOV24a ORF begins with a Kozak onsensus sequence ATG initiation codon at nucleotides 5–7 and ends with a TAA codon at nucleotides 1724–1726. Putative untranslated regions upstream from the initiation codon and downstream from the termination codon are underlined in Table 24A, and the start and stop codons are in bold letters.

The NOV24a polypeptide (SEQ ID NO:79) encoded by SEQ ID NO:78 is 573 amino acid residues in length is presented using the one-letter amino acid code in Table 24B. NOV24a has one SNP variant, whose variant position for its nucleotide and amino acid sequences is numbered according to SEQ ID NOS:78 and 79, respectively. A variant sequence can include a single nucleotide polymorphism (SNP). A SNP can, in some instances, be referred to as a “cSNP” to denote that the nucleotide sequence containing the SNP originates as a cDNA. NOV24b Variant 13374434 is a C to T SNP at 190 bp of the nucleotide sequence that result does not result in a change in the protein sequence (silent).

The Psort profile for the NOV24a and NOV24b proteins predicts that this peptides are likely to be localized at the plasma membrane with a certainty of 0.6000. The Signal P predicts a likely cleavage site for a NOV24a peptide is between positions 34 and 35, i.e., at the dash in the sequence LLA-CH. A similar cleavage sit is predicted between positions 41 and 42 in NOV24b.

NOV24b

Alternatively, a NOV24 variant is the novel NOV24b (alternatively referred to herein as CG56062-02), which includes the 1690 nucleotide sequence (SEQ ID NO:80) shown in Table 24C. NOV24b sequence was cloned by the polymerase chain reaction (PCR) using the primers: 5′ CATGGCCTTCACAGACCTGCT 3′ (SEQ ID NO:266) and 5′ CAGGTTCCAGGCAGCTTAGATG 3′(SEQ ID NO:267). Primers were designed based on in silico predictions of the full length or some portion (one or more exons) of the cDNA/protein sequence of the invention. These primers were used to amplify a cDNA from a pool containing expressed human sequences derived from the following tissues: adrenal gland, bone marrow, brain—amygdala, brain—cerebellum, brain—hippocampus, brain—substantia nigra, brain thalamus, brain—whole, fetal brain, fetal kidney, fetal liver, fetal lung, heart, kidney, lymphoma Raji, mammary gland, pancreas, pituitary gland, placenta, prostate, salivary gland, skeletal muscle, small intestine, spinal cord, spleen, stomach, testis, thyroid, trachea and uterus.

The NOV24b ORF begins with a Kozak consensus ATG initiation codon at nucleotides 5–7 and ends with a TAA codon at nucleotides 1673–1675. Putative untranslated regions upstream from the initiation codon and downstream from the termination codon are underlined in Table 24C, and the start and stop codons are in bold letters.

The NOV24b protein (SEQ ID NO:81) encoded by SEQ ID NO:80 is 556 amino acid residues in length and is presented using the one-letter code in Table 24D.

NOV24 Clones

Unless specifically addressed as NOV24a or NOV24b, any reference to NOV24 is assumed to encompass all variants. NOV24b polypeptide sequence is 17 amino acids shorter than NOV24a polypeptide and also has 13 different amono acids shown in Table 24E.

A search against the Patp database, a proprietary database that contains sequences published in patents and patent publications, yielded several homologous proteins shown in Table 24F and Table 24G.

In a BLAST search of public sequence databases, it was found, for example, that the NOV24a nucleic acid sequence of this invention has 680 of 1082 bases (62%) identical to a gb:GENBANK-ID:OCU242871 |acc:AJ242871.1 mRNA from Oryctolagus cuniculus ( Oryctolagus cuniculus mRNA for renal organic anion transporter 1 (rbOAT1)) (FIG. 3A). NOV24a polypeptide was found to have 196 of 424 amino acid residues (46%) identical to, and 277 of 424 amino acid residues (65%) similar to, the 536 amino acid residue ptnr:SPTREMBL-ACC:Q9R1U7 protein from Rattus norvegicus (ORGANIC ANION TRANSPORTER 3).

Similarly, it was found, for example, that the NOV24b nucleic acid sequence of this invention has 713 of 1132 bases (62%) identical to a gb:GENBANK-ID:AF097491 |acc:AF097491.1 mRNA from Homo sapiens ( Homo sapiens organic anion transporter 3 (OAT3) mRNA, complete cds). NOV24b was found to have 246 of 522 amino acid residues (47%) identical to, and 328 of 522 amino acid residues (62%) similar to, the 563 amino acid residue ptnr:SPTREMBL-ACC:O95742 protein from Homo sapiens (RENAL ORGANIC ANION TRANSPORT PROTEIN 1).

Additional BLAST results are shown in Table 24H and Table I.

A multiple sequence alignment is given in Table 24J, with the NOV24a protein of the invention being shown on line 1, in a ClustalW analysis comparing NOV24a with related protein sequences disclosed in Table 24H.

A similar multiple sequence alignment is given in Table 24K, with the NOV24b protein of the invention being shown on line 1, in a ClustalW analysis comparing NOV24b with related protein sequences disclosed in Table 24I.

The presence of identifiable domains in the NOV24 proteins disclosed herein was 60 determined by searches using algorithms such as PROSITE, Blocks, Pfam, ProDomain, Prints and then determining the Interpro number by crossing the domain match (or numbers) using the Interpro website (http:www.ebi.ac.uk/interpro/). The DOMAIN results are listed in Table 24L and Table 24M with the statistics and domain description. This indicates that the NOV24 sequences have properties similar to those of other proteins known to contain these domains.

Consistent with other known members of the OAT family of proteins, NOV24 has, for example, sugar transporter domain and homology to other members of the OAT Protein family. NOV24 nucleic acids, and the encoded polypeptides, according to the invention are useful in a variety of applications and contexts. For example, NOV24 nucleic acids and polypeptides can be used to identify proteins that are members of the OAT family of proteins. The NOV24 nucleic acids and polypeptides can also be used to screen for molecules, which inhibit or enhance NOV24 activity or function. Specifically, the nucleic acids and polypeptides according to the invention may be used as targets for the identification of small molecules that modulate or inhibit, e.g., molecular transport. These molecules can be used to treat, e.g., cancer, immune disorders, and kidney disorders.

In addition, various NOV24 nucleic acids and polypeptides according to the invention are useful, inter alia, as novel members of the protein families according to the presence of domains and sequence relatedness to previously described proteins. It is known that many members of the organic anion transporter (OAT), organic cation transporter (OCT), and organic anion-transporting polypeptide (oatp) gene families mediate the transport of diverse organic anions and cations. It has also been suggested that ATP-dependent primary active transporters such as MDR1/P-glycoprotein and the multidrug resistance-associated protein (MRP) gene family function as efflux pumps of renal tubular cells for more hydrophobic molecules and anionic conjugates.

A number transporters, such as the p-aminohippurate/dicarboxylate exchanger OAT1 the anion/sulfate exchanger SAT1, the peptide transporters PEPT1 and PEPT2, and the nucleoside transporters CNT1 and CNT2, are key proteins in organic anion handling that possess the same characteristics as has been predicted from previous physiological studies. The role of other cloned transporters, such as MRP1, MRP2, OATP1, OAT-K1, and OAT-K2, is still poorly characterized, whereas the only information that is available on the homologs OAT2, OAT3, OATP3, and MRP3–6 is that they are expressed in the kidney, but their localization, not to mention their function, remains to be elucidated.

The organic anion transporter 3 belongs to sugar transporter family. The sugar transporters belong to a family of membrane proteins responsible for the transport of various sugars in a wide range of prokaryotic and eukaryotic organisms. These integral membrane proteins are predicted to comprise twelve membrane spanning domains. It is likely that the transporters have evolved from an ancient protein present in living organisms before the divergence into prokaryotes and eukaryotes. In mammals, these proteins are expressed in a number of organs.

The NOV24 nucleic acids and polypeptides, antibodies and related compounds according to the invention will be useful in therapeutic and diagnostic applications in the mediation of molecular transport. As such the NOV24 nucleic acids and polypeptides, antibodies and related compounds according to the invention may be used to treat a wide range of disorders such as cancer, kidney disorders, immune disorders and other diseases, e.g., Von Hippel-Lindau (VHL) syndrome, Cirrhosis, Transplantation, Osteoporosis, Hypercalceimia, Arthritis, Ankylosing spondylitis, Scoliosis, Diabetes, Autoimmune disease, Renal artery stenosis, Interstitial nephritis, Glomerulonephritis, Polycystic kidney disease, Systemic lupus erythematosus, Renal tubular acidosis, IgA nephropathy, Lesch-Nyhan syndrome renal malfunction, nephrotoxicity, disease associated with cytotoxic drug, osteoporosis, osteopetrosis resistance, liver diseases, and heart diseases.

The NOV24 nucleic acids and polypeptides are useful for detecting specific cell types. For example, expression analysis has demonstrated that a NOV24 nucleic acid is expressed in Bone Marrow, Kidney, Intestine, Liver membrane, adrenal gland, bone marrow, brain amygdala, brain—cerebellum, brain—hippocampus, brain—substantia nigra, brain—thalamus, brain—whole, fetal brain, fetal kidney, fetal liver, fetal lung, heart, kidney, lymphoma—Raji, mammary gland, pancreas, pituitary gland, placenta, prostate, salivary gland, skeletal muscle, small intestine, spinal cord, spleen, stomach, testis, thyroid, trachea and uterus.

Additional utilities for NOV24 nucleic acids and polypeptides according to the invention are disclosed herein.

NOV25

A NOV25 polypeptide has been identified as a Ficolin-like protein. Eight alternative novel NOV25, NOV25a, NOV25b, NOV25c, NOV25d, NOV25e, NOV25f, NOV25g, and NOV25h, nucleic acids and encoded polypeptides are provided. The novel NOV25 nucleic acid sequences maps to the chromosome 9q34.

NOV25a

A NOV25 variant is the novel NOV25a (alternatively referred to herein as 152736829), which includes the 1082 nucleotide sequence (SEQ ID NO:82) shown in Table 25A. NOV25a sequence was cloned by polymerase chain reaction (PCR) using the following primers: GCTCGCTGTCCTGCTAGTCTTGTT (SEQ ID NO:278) and AGAAACATAATTCTCCCTCTGGTGAGG (SEQ ID NO:279) on the following pool of human cDNAs: Pool 1—Adrenal gland, bone marrow, brain—amygdala, brain—cerebellum, brain—hippocampus, brain—substantia nigra, brain—thalamus, brain—whole, fetal brain, fetal kidney, fetal liver, fetal lung, heart, kidney, lymphoma—Raji, mammary gland, pancreas, pituitary gland, placenta, prostate, salivary gland, skeletal muscle, small intestine, spinal cord, spleen, stomach, testis, thyroid, trachea, uterus. A NOV25a ORF begins with a ATG initiation codon at nucleotides 16–18 and ends with a TAG codon at nucleotides 928–930. Putative untranslated regions upstream from the initiation codon and downstream from the termination codon are underlined in Table 25A, and the start and stop codons are in bold letters.

The NOV25a polypeptide (SEQ ID NO:83) encoded by SEQ ID NO:82 is 304 amino acid residues in length and is presented using the one-letter amino acid code in Table 25B. NOV25a has one SNP variant, whose variant position for its nucleotide and amino acid sequences is numbered according to SEQ ID NOS:82 and 83, respectively. A variant sequence can include a single nucleotide polymorphism (SNP). A SNP can, in some instances, be referred to as a “cSNP” to denote that the nucleotide sequence containing the SNP originates as a cDNA. NOV25a Variant 13374708 is a G to A SNP at 774 bp of the nucleotide sequence that results in no change in the protein sequence (silent).

The Psort profile for the NOV25a predicts that this peptide is likely to be localized extracellularly with a certainty of 0.0.4944. The Signal P predicts a likely cleavage site for a NOV25a peptide is between positions 22 and 23, i.e., at the dash in the sequence AQA-AD.

NOV25b

Alternatively, a NOV25 variant is the novel NOV25b (alternatively referred to herein as CG56653-02), which includes the 1332 nucleotide sequence (SEQ ID NO:84) shown in Table 25C. NOV25b was cloned by polymerase chain reaction (PCR) using the following primers: GCTCGCTGTCCTGCTAGTCTTGTT (SEQ ID NO:280) and AGAAACATAATTCTCCCTCTGGTGAGG (SEQ ID NO:281) on the following pool of human cDNAs: Pool 1—Adrenal gland, bone marrow, brain—amygdala, brain—cerebellum, brain—hippocampus, brain—substantia nigra, brain—thalamus, brain—whole, fetal brain, fetal kidney, fetal liver, fetal lung, heart, kidney, lymphoma—Raji, mammary gland, pancreas, pituitary gland, placenta, prostate, salivary gland, skeletal muscle, small intestine, spinal cord, spleen, stomach, testis, thyroid, trachea, uterus. The NOV25b ORF begins with a Kozak consensus ATG initiation codon at nucleotides 183–185 and ends with a TAG codon at nucleotides 1107–1109. Putative untranslated regions upstream from the initiation codon and downstream from the termination codon are underlined in Table 25C, and the start and stop codons are in bold letters.

The NOV25b protein (SEQ ID NO:85) encoded by SEQ ID NO:84 is 308 amino acid residues in length is presented using the one-letter code in Table 25D. The Psort profile for NOV25b predicts that this sequence is likely to be localized extracellularly with a certainty of 0.4500. The Signal P predicts a likely cleavage site for a NOV25b peptide is between positions 29 and 30, i.e., at the dash in the sequence AQA-AD.

NOV25c

Alternatively, a NOV25 variant is the novel NOV25c (alternatively referred to herein as CG56653-03), which includes the 728 nucleotide sequence (SEQ ID NO:86) shown in Table 25E. NOV25c was cloned by the polymerase chain reaction (PCR) using the primers: 5′ GCTCGCTGTCCTGCTAGTCTTGTT 3′ (SEQ ID NO:282) and 5′ AGAAACATAATTCTCCCTCTGGTGAGG 3′ (SEQ ID NO:283). Primers were designed based on in silico predictions of the full length or some portion (one or more exons) of the cDNA/protein sequence of the invention. These primers were used to amplify a cDNA from a pool containing expressed human sequences derived from the following tissues: adrenal gland, bone marrow, brain—amygdala, brain—cerebellum, brain—hippocampus, brain—substantia nigra, brain—thalamus, brain—whole, fetal brain, fetal kidney, fetal liver, fetal lung, heart, kidney, lymphoma—Raji, mammary gland, pancreas, pituitary gland, placenta, prostate, salivary gland, skeletal muscle, small intestine, spinal cord, spleen, stomach, testis, thyroid, trachea and uterus. The NOV25c ORF begins with an ORF identified at nucleotides 1–2 and ends with a TAG codon at nucleotides 574–576. Putative untranslated regions upstream from the initiation codon and downstream from the termination codon are underlined in Table 25E, and the start and stop codons are in bold letters.

The NOV25c protein (SEQ ID NO:87) encoded by SEQ ID NO:86 is 191 amino acid residues in length is presented using the one-letter code in Table 25F. The Psort profile for NOV25c predicts that this sequence is likely to be localized in the cytoplasm with a certainty of 0.4500.

NOV25d

Alternatively, a NOV25 variant is the novel NOV25d (alternatively referred to herein as CG56653-04), which includes the 1104 nucleotide sequence (SEQ ID NO:88) shown in Table 25G. NOV25d was cloned by the polymerase chain reaction (PCR). Primers were designed based on in silico predictions of the full length or some portion (one or more exons) of the cDNA/protein sequence of the invention. These primers were used to amplify a cDNA from a pool containing expressed human sequences derived from the following tissues: adrenal gland, bone marrow, brain—amygdala, brain—cerebellum, brain—hippocampus, brain—substantia nigra, brain—thalamus, brain—whole, fetal brain, fetal kidney, fetal liver, fetal lung, heart, kidney, lymphoma—Raji, mammary gland, pancreas, pituitary gland, placenta, prostate, salivary gland, skeletal muscle, small intestine, spinal cord, spleen, stomach, testis, thyroid, trachea and uterus. The NOV25d ORF begins with a Kozak consensus ATG initiation codon at nucleotides 16–18 and ends with a TAG codon at nucleotides 883–885. Putative untranslated regions upstream from the initiation codon and downstream from the termination codon are underlined in Table 25G, and the start and stop codons are in bold letters.

The NOV25d protein (SEQ ID NO:89) encoded by SEQ ID NO:88 is 289 amino acid residues in length is presented using the one-letter code in Table 2511. The Psort profile for NOV25d predicts that this sequence is likely to be localized extracellularly with a certainty of 0.6472. The Signal P predicts a likely cleavage site for a NOV25d peptide is between positions 22 and 23, i.e., at the dash in the sequence AQA-AD.

NOV25e

Alternatively, a NOV25 variant is the novel NOV25e (alternatively referred to herein as CG56653-06), which includes the 988 nucleotide sequence (SEQ ID NO:90) shown in Table 251. NOV25e was cloned by the polymerase chain reaction (PCR) using the primers: 5′GTTTTGTCAGGGAGTTGAGAAACTGTG 3′ (SEQ ID NO:284) and 5′ GAAATGGGGTGACTTCCACGAC 3′ (SEQ ID NO:285). Primers were designed based on in silico predictions of the full length or some portion (one or more exons) of the cDNA/protein sequence of the invention. These primers were used to amplify a cDNA from a pool containing expressed human sequences derived from the following tissues: adrenal gland, bone marrow, brain—amygdala, brain—cerebellum, brain—hippocampus, brain—substantia nigra, brain thalamus, brain—whole, fetal brain, fetal kidney, fetal liver, fetal lung, heart, kidney, lymphoma Raji, mammary gland, pancreas, pituitary gland, placenta, prostate, salivary gland, skeletal muscle, small intestine, spinal cord, spleen, stomach, testis, thyroid, trachea and uterus. The NOV25e ORF begins with a Kozak consensus ATG initiation codon at nucleotides 56–58 and ends with a TAG codon at nucleotides 905–907. Putative untranslated regions upstream from the initiation codon and downstream from the termination codon are underlined in Table 251, and the start and stop codons are in bold letters.

The NOV25e protein (SEQ ID NO:91) encoded by SEQ ID NO:90 is 283 amino acid residues in length is presented using the one-letter code in Table 25J. A variant sequence can include a single nucleotide polymorphism (SNP). A SNP can, in some instances, be referred to as a “cSNP” to denote that the nucleotide sequence containing the SNP originates as a cDNA. A NOV24b Variant is a G to T SNP at 89 bp of the nucleotide sequence.

The Psort profile for NOV25e predicts that this sequence is likely to be localized extracellularly with a certainty of 0.6711. The Signal P predicts a likely cleavage site for a NOV25e peptide is between positions 29 and 30, i.e., at the dash in the sequence AQA-AD.

NOV25f

Alternatively, a NOV25 variant is the novel NOV25f (alternatively referred to herein as CG56653-01), which includes the 1194 nucleotide sequence (SEQ ID NO:92) shown in Table 25K. The NOV25f ORF begins with a Kozak consensus ATG initiation codon at nucleotides 15–18 and ends with a TAG codon at nucleotides 973–975. Putative untranslated regions upstream from the initiation codon and downstream from the termination codon are underlined in Table 25K, and the start and stop codons are in bold letters.

The NOV25f protein (SEQ ID NO:93) encoded by SEQ ID NO:92 is 319 amino acid residues in length is presented using the one-letter code in Table 25L. The Psort profile for NOV25f predicts that this sequence is likely to be localized extracellularly with a certainty of 0.4944.

NOV25g

Alternatively, a NOV25 variant is the novel NOV25g (alternatively referred to herein as CG56653-09), which includes the 1144 nucleotide sequence (SEQ ID NO:94) shown in Table 25M. NOV25g was derived by laboratory cloning of cDNA fragments, by in silico prediction of the sequence. cDNA fragments covering either the full length of the DNA sequence, or part of the sequence, or both, were cloned. In silico prediction was based on sequences available in Curagen's proprietary sequence databases or in the public human sequence databases, and provided either the fall length DNA sequence, or some portion thereof. The NOV25g ORF begins with a Kozak consensus ATG initiation codon at nucleotides 183–185 and ends with a TAG codon at nucleotides 981–983. Putative untranslated regions upstream from the initiation codon and downstream from the termination codon are underlined in Table 25M, and the start and stop codons are in bold letters.

The NOV25g protein (SEQ ID NO:95) encoded by SEQ ID NO:94 is 266 amino acid residues in length is presented using the one-letter code in Table 25N. The Psort profile for NOV25g predicts that this sequence is likely to be localized extracellularly with a certainty of 0.6711. The Signal P predicts a likely cleavage site for a NOV25g peptide is between positions 29 and 30, i.e., at the dash in the sequence AQA-AD.

NOV25h

Alternatively, a NOV25 variant is the novel NOV25h (alternatively referred to herein as CG56653-01 & CG56653-02 assembly 169319361), which includes the 900 nucleotide sequence (SEQ ID NO:96) shown in Table 250. The NOV25h ORF begins at nucleotides 1–2 and ends with a TAG codon at nucleotides 898.

The NOV25h protein (SEQ ID NO:97) encoded by SEQ ID NO:96 is 300 amino acid residues in length is presented using the one-letter code in Table 25P. The Psort profile for NOV25h predicts that this sequence is likely to be localized extracellularly with a certainty of 0.4500.

NOV25 Clones

Unless specifically addressed as NOV25a, NOV25b, NOV25c, NOV25d, NOV25e, NOV25f, NOV25g, or NOV25h, any reference to NOV25 is assumed to encompass all variants. Further, Patp, BLAST, and DOMAIN analyses are presented for NOV25b, the longest NOV25 polypetide sequence.

A search against the Patp database, a proprietary database that contains sequences published in patents and patent publications, yielded several homologous proteins shown in Table 25Q.

NOV25 polypeptides are ficolin-like proteins with sequence homology to the Fibrinogen protein family. In a BLAST search of public sequence databases, it was found, for example, that the NOV25b nucleic sequence of this invention has 956 of 982 bases (97%) identical to a gb:GENBANK-ID:S80990|acc:S80990.1 mRNA from Homo sapiens [ficolin (human, uterus, mRNA, 1736 nt)]. The full NOV25b polypeptide sequence was found to have 252 of 276 amino acid residues (91%) identical to, and 258 of 276 amino acid residues (93%) similar to, the 319 amino acid residue ptnr:SPTREMBL-ACC:Q92596 protein from Homo sapiens.

Additional BLAST results are shown in Table 25R.

A multiple sequence alignment is given in Table 25S, with the NOV25 protein of the invention being shown on line 1, in a ClustalW analysis comparing NOV25 with related protein sequences disclosed in Table 25R.

The presence of identifiable domains in the protein disclosed herein was determined by searches using algorithms such as PROSITE, Blocks, Pfam, ProDomain, Prints and then determining the Interpro number by crossing the domain match (or numbers) using the Interpro website (http:www.ebi.ac.uk/interpro/). Table 25T lists the domain description from DOMAIN analysis results against NOV25.

Consistent with other known members of the Fibrinogen family of proteins, e.g., ficolins, NOV25 contains fibrinogen and collagen domains as illustrated in Table 25T (Ohashi and Erickson, J. Biol. Chem., 272: 14220–6(1997)). NOV25 nucleic acids, and the encoded polypeptides, according to the invention are useful in a variety of applications and contexts. For example, NOV25 nucleic acids and polypeptides can be used to identify proteins that are members of the Fibrinogen family of proteins. The NOV25 nucleic acids and polypeptides can also be used to screen for molecules, which inhibit or enhance NOV25 activity or function. Specifically, the nucleic acids and polypeptides according to the invention may be used as targets for the identification of small molecules that modulate or inhibit, e.g., cellular activation, cellular metabolism, host defense and signal transduction. These molecules can be used to treat, e.g., arthritis, autoimmune disease, immunodeficiencies, anemia, ataxia-telangiectasia, hemophilia, hypercoagulation, idiopathic thrombocytopenic purpura, graft versus host disease, endometriosis, fertility, systemic lupus erythematosus, asthma, emphysema, scleroderma, allergies, ARDS, hypercoagulation, as well as other diseases, disorders and conditions.

In addition, various NOV25 nucleic acids and polypeptides according to the invention are useful, inter alia, as novel members of the protein families according to the presence of domains and sequence relatedness to previously described proteins. For example, the NOV25 nucleic acids and their encoded polypeptides include structural motifs that are characteristic of proteins belonging to the ficolin family of proteins involved in cytokine and steroid physiology (Ohashi and Erickson, J. Biol. Chem., 272: 14220–6(1997)).

Ficolin was originally isolated as a protein from pig uterus membrane extracts that bound transforming growth factor—(Ichijo et al., J. Biol. Chem., 266: 22459–64 91991)). Ficolins have also been identified from human blood as a corticosteroid binding protein, termed hucolin (Edgar, FEBS Lett., 375: 159–61 (1995)), an elastin binding protein, termed EBP-37 (Harumiya et al., J. Biochem., 117: 1029–35(1995)), and a GlcNAc binding lectin, termed P35 (Matsushita et al., J. Biol. Chem. 271: 2448–54(1996)). Ficolin cDNAs, are termed human ficolin (Lu et al., Biochem. J., 313: 473–8(1996)), ficolin-1 (HarTumiya et al., J. Biochem., 120: 745–51(1996)), and P35-related gene (Endo et al., Genomics, 36: 515–21, (1996)) have been cloned.

The amino acid sequence of ficolins consist of a short N-terminal domain, a middle collagen-like domain, and aC-terminal fibrinogen-like (fbg)1domain (Ohashi and Erickson, J. Biol. Chem., 272: 14220–6(1997)). The collagen domains assemble these proteins into trimers, and electron microscopy shows that four or six trimers are connected together by the N-terminal domain, leaving the C-terminal lectin domains to project in a multimeric array (13–17). Like C1q and collectins play roles in immune defense, ficolins have been implicated in a similar role, in that human plasma ficolin (P35) is a lectin that binds to the carbohydrate of bacterial surface (Lu et al., Immunology, 89: 289–94(1996)) and enhances opsonic activity of white blood cells, e.g., polymorphonuclear neutrophils (Matsushita et al., J. Biol. Chem., 271: 2448–54(1996)). Ficolin may play a role in alleviating inflammation in joints and other sites of inflammation.

Indeed, experiments comparing the gene expression levels of matched white blood cell fraction, e.g., peripheral blood lymphocytes (PBLs), and synovial fluid from three Rheumatoid Arthritis (RA) patients showed significantly lower level of NOV25f of the present invention in the RA patients. Specifically, the NOV25f gene was found to be upregulated 26-fold The presence of this ficolin in the PBLs was, on average, 26-fold over the level found in the synoviocytes of these RA patients.

Based on the surprising result from GeneCalling that Ficolin is upregulated to such a high extent in PBLs vs synoviocytes in RA patients, and coupling this knowledge with the TaqMan profiles presented below, ficolin may be useful as a protein therapeutic in RA patients and other patients with autoimmune diseases. Ficolin, or pharmaceutically active portions thereof, may be administered to RA patients directly into the joint space of the knee or other joint space to alleviate inflammation and promote healing.

Protein therapeutics designed with the protein encoded for by NOV25 could function as an opsinin to target and eliminate bacteria by complement-mediated destruction. These proteins could be important for the treatment of bacterial septicemia. Ficolins may also have the ability to bind to elastins. Elastins are functionally important for lung alveolar development and inactivation of these proteins can lead to emphysema-like disease. Antibodies against NOV25 may prevent tissue destruction mediated by ficolin activity during emphysema, asthma and arthritis.

The NOV25 nucleic acids and polypeptides are useful for detecting specific cell types. For example, expression analysis has demonstrated that a NOV25 nucleic acid is expressed in white blood cells, Aorta, Colon, Bone Marrow, Joints, Peripheral Blood, Spleen, Pituitary Gland, Mammary gland/Breast, Uterus, Prostate, Lung, and Kidney.

Additional utilities for NOV25 nucleic acids and polypeptides according to the invention are disclosed herein.

NOV26

A NOV26 polypeptide has been identified as a ficolin-like protein (also referred to as 152736833). The disclosed novel NOV26 nucleic acid (SEQ ID NO:98) of 779 nucleotides is shown in Table 26A. The cDNA coding for the NOV26 was cloned by polymerase chain reaction (PCR) using the following primers: GCTCGCTGTCCTGCTAGTCTTGTT (SEQ ID NO:291) and AGAAACATAATTCTCCCTCTGGTGAGG (SEQ ID NO:292) on the following pool of human cDNAs: Pool 1—Adrenal gland, bone marrow, brain—amygdala, brain cerebellum, brain—hippocampus, brain—substantia nigra, brain—thalamus, brain—whole, fetal brain, fetal kidney, fetal liver, fetal lung, heart, kidney, lymphoma—Raji, mammary gland, pancreas, pituitary gland, placenta, prostate, salivary gland, skeletal muscle, small intestine, spinal cord, spleen, stomach, testis, thyroid, trachea, uterus. The novel NOV26 nucleic acid sequences maps to the chromosome 9.

An ORF begins with an Kozak consensus ATG initiation codon at nucleotides 16–18 and ends with a TAG codon at nucleotides 625–627. A putative untranslated region and/or downstream from the termination codon is underlined in Table 26A, and the start and stop codons are in bold letters.

The NOV26 protein (SEQ ID NO:99) encoded by SEQ ID NO:98 is 203 amino acid residues in length and is presented using the one-letter amino acid code in Table 26B. Psort analysis predicts the NOV26 protein of the invention to be localized extracellularly with a certainty of 0.4944. The Signal P predicts a likely cleavage site for a NOV26 peptide is between positions 22 and 23, i.e., at the dash in the sequence AQA-AD.

A search against the Patp database, a proprietary database that contains sequences published in patents and patent publications, yielded several homologous proteins shown in Table 26C.

In a BLAST search of public sequence databases, it was found, for example, that the nucleic acid sequence of this invention has 487 of 496 bases (98%) identical to a gb:GENBANK-ID:D83920|acc:D83920.1 mRNA from Homo sapiens (Human uterus mRNA for human ficolin-1, complete cds). The full amino acid sequence of the protein of the invention was found to have 152 of 152 amino acid residues (100%) identical to, and 152 of 152 amino acid residues (100%) similar to, the 319 amino acid residue ptnr:SPTREMBL-ACC: Q92596 protein from Homo sapiens (FICOLIN).

NOV26 also has homology to the proteins shown in the BLASTP data in Table 26D.

A multiple sequence alignment is given in Table 26E, with the NOV26 protein being shown on line 1 in Table 26E in a ClustalW analysis, and comparing the NOV26 protein with the related protein sequences shown in Table 26D. This BLASTP data is displayed graphically in the ClustalW in Table 26E.

The presence of identifiable domains in the protein disclosed herein was determined by searches using algorithms such as PROSITE, Blocks, Pfam, ProDomain, Prints and then determining the Interpro number by crossing the domain match (or numbers) using the Interpro website (http:www.ebi.ac.uk/interpro/). Table 26F lists the domain description from DOMAIN analysis results against NOV26.

Consistent with other known members of the Fibrinogen family of proteins, e.g., ficolin, NOV26 contains fibrinogen and collagen domains as illustrated in Table 25T (Ohashi and Erickson, J. Biol. Chem., 272: 14220–6(1997)). NOV26 nucleic acids, and the encoded polypeptides, according to the invention are useful in a variety of applications and contexts. For example, NOV26 nucleic acids and polypeptides can be used to identify proteins that are members of the Fibrinogen family of proteins. The NOV26 nucleic acids and polypeptides can also be used to screen for molecules, which inhibit or enhance NOV26 activity or function. Specifically, the nucleic acids and polypeptides according to the invention may be used as targets for the identification of small molecules that modulate or inhibit, e.g., cellular activation, cellular metabolism, host defense and signal transduction. These molecules can be used to treat, e.g., arthritis, autoimmune disease, immunodeficiencies, anemia, ataxia-telangiectasia, hemophilia, emphysema, hypercoagulation, idiopathic thrombocytopenic purpura, graft versus host disease, endometriosis, fertility, systemic lupus erythematosus, asthma, emphysema, scleroderma, allergies, ARDS, hypercoagulation, as well as other diseases, disorders and conditions.

In addition, various NOV26 nucleic acids and polypeptides according to the invention are useful, inter alia, as novel members of the protein families according to the presence of domains and sequence relatedness to previously described proteins. For example, the NOV26 nucleic acids and their encoded polypeptides include structural motifs that are characteristic of proteins belonging to the ficolin family of proteins involved in cytokine and steroid physiology (Ohashi and Erickson, J. Biol. Chem., 272: 14220–6(1997)).

Ficolin was originally isolated as a protein from pig uterus membrane extracts that bound transforming growth factor—(Ichijo et al., J. Biol. Chem., 266: 22459–64 91991)). Ficolins have also been identified from human blood as a corticosteroid binding protein, termed hucolin (Edgar, FEBS Lett., 375: 159–61 (1995)), an elastin binding protein, termed EBP-37 (Harumiya et al., J. Biochem., 117: 1029–35(1995)), and a GlcNAc binding lectin, termed P35 (Matsushita et al., J. Biol. Chem. 271: 2448–54(1996)). Ficolin cDNAs, are termed human ficolin (Lu et al., Biochem. J., 313: 473–8(1996)), ficolin-1 (Harumiya et al., J. Biochem., 120: 745–51(1996)), and P35-related gene (Endo et al., Genomics, 36: 515–21, (1996)) have been cloned.

The amino acid sequence of ficolins consist of a short N-terminal domain, a middle collagen-like domain, and a C-terminal fibrinogen-like (fbg)1domain (Ohashi and Erickson, J. Biol. Chem., 272: 14220–6(1997)). The collagen domains assemble these proteins into trimers, and electron microscopy shows that four or six trimers are connected together by the N-terminal domain, leaving the C-terminal lectin domains to project in a multimeric array (13–17). Like C1q and collectins play roles in immune defense, ficolins have been implicated in a similar role, in that human plasma ficolin (P35) is a lectin that binds to the carbohydrate of bacterial surface (Lu et al., Immunology, 89: 289–94(1996)) and enhances opsonic activity of white blood cells, e.g., polymorphonuclear neutrophils (Matsushita et al., J. Biol. Chem., 271: 2448–54(1996)). Ficolin may play a role in alleviating inflammation in joints and other sites of inflammation.

Protein therapeutics designed with the protein encoded for by NOV26 could function as an opsinin to target and eliminate bacteria by complement—mediated destruction. These proteins could be important for the treatment of bacterial septicemia. Ficolins may also have the ability to bind to elastins. Elastins are functionally important for lung alveolar development and inactivation of these proteins can lead to emphysema-like disease. Antibodies against NOV26 may prevent tissue destruction mediated by ficolin activity during emphysema, asthma and arthritis.

The NOV26 nucleic acids and polypeptides are useful for detecting specific cell types. For example, expression analysis has demonstrated that a NOV25 nucleic acid is expressed in peripheral blood leukocytes, uterus, spleen, lung, and thymus.

Additional utilities for NOV26 nucleic acids and polypeptides according to the invention are disclosed herein.

NOV27

A NOV27 polypeptide has been identified as a peroxisomal Ca-dependent solute carrier like protein (also referred to as CG56262-01). The disclosed novel NOV27 nucleic acid (SEQ ID NO:100) of 1551 nucleotides is shown in Table 27A. An ORF begins with a Kozak consensus ATG initiation codon at nucleotides 108–110 and ends with a TGA codon at nucleotides 1512–1514. A putative untranslated region and/or downstream from the termination codon is underlined in Table 27A, and the start and stop codons are in bold letters. The novel NOV27 nucleic acid sequences maps to the chromosome 19.

The NOV27 protein (SEQ ID NO:101) encoded by SEQ ID NO:100 is 468 amino acid residues in length and is presented using the one-letter amino acid code in Table 27B3 Psort analysis predicts the NOV27 protein of the invention to be localized in the cytoplasm with a certainty of 0.4500.

NOV27 has a SNP variant, whose variant position for its nucleotide and amino acid sequence is numbered according to SEQ ID NOS:100 and 101, respectively. A variant sequence can include a single nucleotide polymorphism (SNP). A SNP can, in some instances, be referred to as a “cSNP” to denote that the nucleotide sequence containing the SNP originates as a cDNA.

NOV27 has at least one variant. NOV27 variant 13376757 is a G to A SNP at 1529 bp of the nucleotide sequence that results in no change in the protein sequence since the SNP is not in the amino acid coding region.

A search against the Patp database, a proprietary database that contains sequences published in patents and patent publications, yielded several homologous proteins shown in Table 27C.

In a BLAST search of public sequence databases, it was found, for example, that the nucleic acid sequence of this invention has 886 of 1379 bases (64%) identical to a gb:GENBANK-ID:AF123303|acc:AF123303.1 mRNA from Homo sapiens (calcium-binding transporter mRNA, partial cds). The full amino acid sequence of the protein of the invention was found to have 280 of 461 amino acid residues (60%) identical to, and 365 of 461 amino acid residues (79%) similar to, the 475 amino acid residue ptnr:SPTREMBL-ACC:O18757 protein from Oryctolagus cuniculus (PEROXISOMAL CA-DEPENDENT SOLUTE CARRIER).

NOV27 also has homology to the proteins shown in the BLASTP data in Table 27D.

A multiple sequence alignment is given in Table 27E, with the NOV27 protein being shown on line 1 in Table 27E in a ClustalW analysis, and comparing the NOV27 protein with the related protein sequences shown in Table 27D. This BLASTP data is displayed graphically in the ClustalW in Table 27E.

The presence of identifiable domains in the protein disclosed herein was determined by searches using algorithms such as PROSITE, Blocks, Pfam, ProDomain, Prints and then determining the Interpro number by crossing the domain match (or numbers) using the Interpro website (http:www.ebi.ac.uk/interpro/). Table 27F lists the domain description from DOMAIN analysis results against NOV27.

Consistent with other known members of the mitochondrial carrier proteins, e.g., peroxisomal Ca-dependent solute carrier family of proteins, NOV27 contains EF hand calcium binding domains and mitochondrial carrier transport signature domains as illustrated in Table 27F. NOV27 nucleic acids, and the encoded polypeptides, according to the invention are useful in a variety of applications and contexts. For example, NOV27 nucleic acids and polypeptides can be used to identify proteins that are members of the peroxisomal Ca-dependent solute carrier family of proteins. The NOV27 nucleic acids and polypeptides can also be used to screen for molecules, which inhibit or enhance NOV27 activity or function. Specifically, the NOV27 nucleic acids and polypeptides according to the invention may be used as targets for the identification of small molecules that modulate or inhibit, e.g., transport facilitation. These molecules can be used to treat, e.g., cancer, trauma, regeneration (in vitro and in vivo), viral/bacterial/parasitic infections, atherosclerosis, aneurysm, hypertension, fibromuscular dysplasia, stroke, scleroderma, obesity, Von Hippel-Lindau (VHL) syndrome, Alzheimer's disease, stroke, tuberous sclerosis, hypercalceimia, Parkinson's disease, Huntington's disease, cerebral palsy, epilepsy, Lesch-Nyhan syndrome, multiple sclerosis, ataxia-telangiectasia, leukodystrophies, behavioral disorders, addiction, anxiety, pain, diabetes, autoimmune disease, renal artery stenosis, interstitial nephritis, glomerulonephritis, polycystic kidney disease, systemic lupus erythematosus, renal tubular acidosis, IgA nephropathy, hypercalceimia, muscular dystrophy, Lesch-Nyhan syndrome, myasthenia gravis and other diseases, disorders and conditions of the like.

In addition, various NOV27 nucleic acids and polypeptides according to the invention are useful, inter alia, as novel members of the protein families according to the presence of domains and sequence relatedness to previously described proteins. For example, the NOV27 nucleic acids and their encoded polypeptides include structural motifs and homology that are characteristic of proteins belonging to the family of mitochondrial carrier proteins such as the peroxisomal Ca-dependent solute carrier proteins.

Many calcium-binding proteins belong to the same evolutionary family and share a type of calcium-binding domain known as the EF-hand. This type of domain consists of a twelve residue loop flanked on both side by a twelve residue alpha-helical domain. Different types of substrate carrier proteins involved in energy transfer are found in the inner mitochondrial membrane such as the ADP, ATP carrier protein (AAC) (ADP/ATP translocase), the 2-oxoglutarate/malate carrier protein (OGCP), the phosphate carrier protein, which transports phosphate groups from the cytosol into the mitochondrial matrix all share a common carrier protein motif. NOV27 also resembles the peroxisomal Ca-dependent solute carrier from rabbit. Although the Psort suggests that this is a cytosolic protein rather than mitochondrial, it is hypothesized that it might function in the uncoupling of ATP translocation and play a role in metabolic disease.

The NOV27 nucleic acids and polypeptides, antibodies and related compounds according to the invention will be useful in therapeutic and diagnostic applications for the treatment of metabolic disorders. As such the NOV27 nucleic acids and polypeptides, antibodies and related compounds according to the invention may be used to treat metabolic disorders, e.g., cancer, trauma, regeneration (in vitro and in vivo), viral/bacterial/parasitic infections, atherosclerosis, aneurysm, hypertension, fibromuscular dysplasia, stroke, scleroderma, obesity, Von Hippel-Lindau (VHL) syndrome, Alzheimer's disease, stroke, tuberous sclerosis, hypercalceimia, Parkinson's disease, Huntington's disease, cerebral palsy, epilepsy, Lesch-Nyhan syndrome, multiple sclerosis, ataxia-telangiectasia, leukodystrophies, behavioral disorders, addiction, anxiety, pain, diabetes, autoimmune disease, renal artery stenosis, interstitial nephritis, glomerulonephritis, polycystic kidney disease, systemic lupus erythematosus, renal tubular acidosis, IgA nephropathy, hypercalceimia, muscular dystrophy, Lesch-Nyhan syndrome, and myasthenia gravis.

The NOV27 nucleic acids and polypeptides are useful for detecting specific cell types. For example, expression analysis has demonstrated that a NOV27 nucleic acid is expressed in Adrenal Gland/Suprarenal gland, Amygdala, Aorta, Brain, Bronchus, Cerebral Medulla/Cerebral white matter, Cervix, Coronary Artery, Frontal Lobe, Heart, Kidney, Liver, Lung, Mammary gland/Breast, Ovary, Oviduct/Uterine Tube/Fallopian tube, Parietal Lobe, Peripheral Blood, Pituitary Gland, Prostate, Retina, Skeletal Muscle, Spinal Chord, Spleen, Substantia Nigra, Temporal Lobe, Testis, Thalamus, Thymus, Thyroid, and Vein.

Additional utilities for NOV27 nucleic acids and polypeptides according to the invention are disclosed herein.

NOV28

A NOV28 polypeptide has been identified as a Sodium-glucose cotransporter (SGLT)-like protein (also referred to as CG56559-01). The disclosed novel NOV28 nucleic acid (SEQ ID NO:102) of 1900 nucleotides is shown in Table 28A. The novel NOV28 nucleic acid sequences maps to the chromosome 17.

An ORF begins with a Kozak consensus ATG initiation codon at nucleotides 51–53 and ends with a TGA codon at nucleotides 1851–1853. A putative untranslated region and/or downstream from the termination codon is underlined in Table 28A, and the start and stop codons are in bold letters.

The NOV28 protein (SEQ ID NO:103) encoded by SEQ ID NO:102 is 600 amino acid residues in length and is presented using the one-letter amino acid code in Table 28B. NOV28 has at least five SNP variants, whose variant positions for its nucleotides and amino acids sequences is numbered according to SEQ ID NOS:102 and 103, respectively. A variant sequence can include a single nucleotide polymorphism (SNP). A SNP can, in some instances, be referred to as a “cSNP” to denote that the nucleotide sequence containing the SNP originates as a cDNA.

NOV28 variant 13376762 is an A to T SNP at 158 bp of the nucleotide sequence that results in no change in the protein sequence (silent), variant 13376761 is a C to T SNP at 491 bp of the nucleotide sequence that results in no change in the protein sequence (silent), variant 13376760 is a T to C SNP at 565 bp of the nucleotide sequence that results in a Leu to Pro change at amino acid 172 of protein sequence, variant 13376759 is a C to T SNP at 867 bp of the nucleotide sequence that results in no change in the protein sequence (silent), and variant 13376758 is a C to T SNP at 1762 bp of the nucleotide sequence that results in a Pro to Leu change at amino acid 571 of protein sequence.

Psort analysis predicts the NOV28 protein of the invention to be localized to the plasma membrane with a certainty of 0.8200. The Signal P predicts a likely cleavage site for a NOV28 peptide is between positions 42 and 43, i.e., at the dash in the sequence CRA-SR.

A search against the Patp database, a proprietary database that contains sequences published in patents and patent publications, yielded several homologous proteins shown in Table 28C.

In a BLAST search of public sequence databases, it was found, for example, that the nucleic acid sequence of this invention has 1451 of 1839 bases (78%) identical to a gb:GENBANK-ID:OCU08813|acc:U08813.1 mRNA from Oryctolagus cuniculus (Na+/glucose cotransporter-related protein mRNA, complete cds). NOV28 polypeptide of the invention was found to have 532 of 600 amino acid residues (88%) identical to, and 560 of 600 amino acid residues (93%) similar to, the 597 amino acid residue ptnr:SPTREMBL-ACC:Q28610 protein from Oryctolagus cuniculus (NA+/GLUCOSE COTRANSPORTER-RELATED PROTEIN).

NOV28 also has homology to the proteins shown in the BLASTP data in Table 28D.

A multiple sequence alignment is given in Table 28E, with the NOV28 protein being shown on line 1 in Table 28E in a ClustalW analysis, and comparing the NOV28 protein with the related protein sequences shown in Table 28D. This BLASTP data is displayed graphically in the ClustalW in Table 28E.

The presence of identifiable domains in the protein disclosed herein was determined by searches using algorithms such as PROSITE, Blocks, Pfam, ProDomain, Prints and then determining the Interpro number by crossing the domain match (or numbers) using the Interpro website (http:www.ebi.ac.uk/interpro/). Table 28F lists the domain description from DOMAIN analysis results against NOV28.

Consistent with other known members of the sodium:solute symporter family (SSF), the NOV28 Na+/glucose transporter-like protein contains the sodium:solute symporter family domain and an integral membrane domain as illustrated in Table 28F (Ohashi and Erickson, J. Biol. Chem., 272: 14220–6(1997)). NOV28 nucleic acids, and the encoded polypeptides, according to the invention are useful in a variety of applications and contexts. For example, NOV28 nucleic acids and polypeptides can be used to identify proteins that are members of the sodium:solute symporter family of proteins. The NOV28 nucleic acids and polypeptides can also be used to screen for molecules, which inhibit or enhance NOV28 activity or function. Specifically, the nucleic acids and polypeptides according to the invention may be used as targets for the identification of small molecules that modulate or inhibit, e.g., cellular activation and cellular metabolism. These molecules can be used to treat, e.g., for metabolic diseases such cancer, trauma, regeneration (in vitro and in vivo), viral/bacterial/parasitic infections, diabetes, autoimmune disease, renal artery stenosis, interstitial nephritis, glomerulonephritis, polycystic kidney disease, systemic lupus erythematosus, renal tubular acidosis, IgA nephropathy, hypercalceimia, Lesch-Nyhan syndrome, cardiomyopathy, atherosclerosis, hypertension, congenital heart defects, aortic stenosis, atrial septal defect (ASD), atrioventricular (A-V) canal defect, ductus arteriosus, pulmonary stenosis, subaortic stenosis, ventricular septal defect (VSD), valve diseases, tuberous sclerosis, scleroderma, obesity, transplantation and other diseases, disorders and conditions of the like.

In addition, various NOV28 nucleic acids and polypeptides according to the invention are useful, inter alia, as novel members of the protein families according to the presence of domains and sequence relatedness to previously described proteins. For example, the NOV28 nucleic acids and their encoded polypeptides include structural motifs that are characteristic of proteins belonging to the SSF family such as the Na+/glucose transporter proteins involved in renal transport and metabolism. (Ohashi and Erickson, J. Biol. Chem., 272: 14220–6(1997)).

Integral membrane proteins that mediate the intake of a wide variety of molecules with the concomitant uptake of sodium ions are grouped into a number of distinct families. One of these families, known as the SSF, consists of integral membrane proteins that are predicted to comprise at least ten membrane spanning domains. Members of the SSF catalyze solute:Na+ symport (Reizer et al.,. Biochem. Biophys. Acta, 1197: 133–166(1994)) can transport sugars, amino acids, nucleosides, inositols, vitamins, urea or anions, depending on the system. Members of the SSF family have been identified in bacteria, archaea and animals, and all functionally well characterized members catalyze solute uptake via Na+ symport.

The NOV28 nucleic acids and polypeptides, antibodies and related compounds according to the invention will be useful in therapeutic and diagnostic applications in the mediation of metabolism and immune function and renal physiology. As such, the NOV28 nucleic acids and polypeptides, antibodies and related compounds according to the invention may be used to treat metabolic, immune and renal disorders, e.g., metabolic diseases such as diabetes and hypertension, or cancer, trauma, regeneration (in vitro and in vivo), viral/bacterial/parasitic infections, diabetes, autoimmune disease, renal artery stenosis, interstitial nephritis, glomerulonephritis, polycystic kidney disease, systemic lupus erythematosus, renal tubular acidosis, IgA nephropathy, hypercalceimia, Lesch-Nyhan syndrome, cardiomyopathy, atherosclerosis, hypertension, congenital heart defects, aortic stenosis, atrial septal defect (ASD), atrioventricular (A-V) canal defect, ductus arteriosus, pulmonary stenosis, subaortic stenosis, ventricular septal defect (VSD), valve diseases, tuberous sclerosis, scleroderma, obesity, transplantation and other diseases, disorders and conditions of the like. The NOV28 nucleic acids and polypeptides are useful for detecting specific cell types. For example, expression analysis has demonstrated that a NOV28 nucleic acid is expressed in Kidney and Heart.

Additional utilities for NOV28 nucleic acids and polypeptides according to the invention are disclosed herein.

NOV29

A NOV29 polypeptide has been identified as a Na+/glucose transporter-like protein. Six alternative novel NOV29, NOV29a, NOV29b, NOV29c, NOV29d, NOV29e, and NOV29f, nucleic acids and encoded polypeptides are provided. The novel NOV29 nucleic acid sequences maps to the chromosome 1.

NOV29a

A NOV29 variant is the novel NOV29a (alternatively referred to herein as CG56557-01), which includes the 2147 nucleotide sequence (SEQ ID NO:104) shown in Table 29A. A NOV29a ORF begins with a Kozak consensus ATG initiation codon at nucleotides 6–68 and ends with a TGA codon at nucleotides 2118–2120. Putative untranslated regions upstream from the initiation codon and downstream from the termination codon are underlined in Table 29A, and the start and stop codons are in bold letters.

The NOV29a polypeptide (SEQ ID NO:105) encoded by SEQ ID NO:104 is 684 amino acid residues in length and is presented using the one-letter amino acid code in Table 29B. NOV29a has two SNP variants, whose variant positions for their nucleotide and amino acid sequences is numbered according to SEQ ID NOS:104 and 105, respectively. A variant sequence can include a single nucleotide polymorphism (SNP). A SNP can, in some instances, be referred to as a “cSNP” to denote that the nucleotide sequence containing the SNP originates as a cDNA. NOV29a Variant 13374708 is a G to A SNP at 774 bp of the nucleotide sequence that results in no change in the protein sequence (silent). NOV29a variant 13375611 is a T to C SNP at 1572 bp of the nucleotide sequence that results in a Ser to Pro change at amino acid 503 of protein sequence, and NOV29a variant 13375610 is a T to C SNP at 1684 bp of the nucleotide sequence that results in a Val to Ala change at amino acid 540 of protein sequence.

The Psort profile for the NOV29a predicts that this peptide is likely to be localized at the plasma membrane with a certainty of 0.8000. The Signal P predicts a likely cleavage site for a NOV29a peptide is between positions 59 and 60, i.e., at the dash in the sequence IRA-SR.

NOV29b

Alternatively, a NOV29 variant is the novel NOV29b (alternatively referred to herein as CG56557-02), which includes the 797 nucleotide sequence (SEQ ID NO:106) shown in Table 29C. NOV29b was cloned by polymerase chain reaction (PCR) using the primers: 5′ GTCAGGACTGAGACAGCTCCACAC 3′ (SEQ ID NO:308) and 5′ CTGAAGCCAGGTCTGTGGAATCAC 3′ (SEQ ID NO:309). Primers were designed based on in silico predictions of the fall length or some portion (one or more exons) of the cDNA/protein sequence of the invention. These primers were used to amplify a cDNA from a pool containing expressed human sequences derived from the following tissues: adrenal gland, bone marrow, brain—amygdala, brain—cerebellum, brain—hippocampus, brain—substantia nigra, brain thalamus, brain—whole, fetal brain, fetal kidney, fetal liver, fetal lung, heart, kidney, lymphoma Raji, mammary gland, pancreas, pituitary gland, placenta, prostate, salivary gland, skeletal muscle, small intestine, spinal cord, spleen, stomach, testis, thyroid, trachea and uterus. The PCR product derived by exon linking, covering the entire open reading frame, was cloned into the pCR2.1 vector from Invitrogen to provide clone 57808::ba252a4.698037.N15.

The NOV29b ORF begins with a Kozak consensus ATG initiation codon at nucleotides 19–21 and ends with a TGA codon at nucleotides 775–777. Putative untranslated regions upstream from the initiation codon and downstream from the termination codon are underlined in Table 29C, and the start and stop codons are in bold letters.

The NOV29b protein (SEQ ID NO:107) encoded by SEQ ID NO:106 is 252 amino acid residues in length is presented using the one-letter code in Table 29D. The Psort profile for NOV29b predicts that this sequence is likely to be localized at the plasma membrane with a certainty of 0.6000. The Signal P predicts a likely cleavage site for a NOV29b peptide is between positions 52 and 53, i.e., at the dash in the sequence IFC-KR.

NOV29c

Alternatively, a NOV29 variant is the novel NOV29c (alternatively referred to herein as CG56557-03), which includes the 2278 nucleotide sequence (SEQ ID NO:108) shown in Table 29E. The NOV29c ORF begins with a Kozak consensus sequence ATG identified at nucleotides 20–22 and ends with a TGA codon at nucleotides 2248–2250. Putative untranslated regions upstream from the initiation codon and downstream from the termination codon are underlined in Table 29E, and the start and stop codons are in bold letters.

The NOV29c protein (SEQ ID NO:109) encoded by SEQ ID NO:108 is 743 amino acid residues in length is presented using the one-letter code in Table 29F. The Psort profile for NOV29c predicts that this sequence is likely to be localized in the cytoplasm with a certainty of 0.8000. The Signal P predicts a likely cleavage site for a NOV29c peptide is between positions 52 and 53, i.e., at the dash in the sequence IRA-SR.

NOV29d

Alternatively, a NOV29 variant is the novel NOV29d (alternatively referred to herein as CG56653-04), which includes the 1969 nucleotide sequence (SEQ ID NO:110) shown in Table 29G. The NOV29d ORF begins with a Kozak consensus ATG initiation codon at nucleotides 18–20 and ends with a TGA codon at nucleotides 847–849. Putative untranslated regions upstream from the initiation codon and downstream from the termination codon are underlined in Table 29G, and the start and stop codons are in bold letters.

The NOV29d protein (SEQ ID NO:111) encoded by SEQ ID NO:110 is 276 amino acid residues in length is presented using the one-letter code in Table 29H. The Psort profile for NOV29d predicts that this sequence is likely to be localized at the plasma membrane with a certainty of 0.6000. The Signal P predicts a likely cleavage site for a NOV29d peptide is between positions 52 and 53, i.e., at the dash in the sequence IRA-SR.

NOV29e

Alternatively, a NOV29 variant is the novel NOV29e (alternatively referred to herein as CG56557-05), which includes the 2162 nucleotide sequence (SEQ ID NO:112) shown in Table 291. The NOV29e ORF begins with a Kozak consensus ATG initiation codon at nucleotides 21–23 and ends with a TAG codon at nucleotides 2133–2135. Putative untranslated regions upstream from the initiation codon and downstream from the termination codon are underlined in Table 29I, and the start and stop codons are in bold letters.

The NOV29e protein (SEQ ID NO:113) encoded by SEQ ID NO:112 is 704 amino acid residues in length is presented using the one-letter code in Table 29J. The Psort profile for NOV29e predicts that this sequence is likely to be localized at the plasma membrane with a certainty of 0.8000. The Signal P predicts a likely cleavage site for a NOV29e peptide is between positions 52 and 53, i.e., at the dash in the sequence IRA-SR.

NOV29f

Alternatively, a NOV29 variant is the novel NOV29f (alternatively referred to herein as CG56557-06), which includes the 875 nucleotide sequence (SEQ ID NO:114) shown in Table 29K. NOV25e was cloned by the polymerase chain reaction (PCR) using the primers: 5′ GTCAGGACTGAGACAGCTCCACAC 3′ (SEQ ID NO:310) and 5′ CTGAAGCCAGGTCTGTGGAATCAC 3′ (SEQ ID NO:311). Primers were designed based on in silico predictions of the full length or some portion (one or more exons) of the cDNA/protein sequence of the invention. These primers were used to amplify a cDNA from a pool containing expressed human sequences derived from the following tissues: adrenal gland, bone marrow, brain—amygdala, brain—cerebellum, brain—hippocampus, brain—substantia nigra, brain thalamus, brain—whole, fetal brain, fetal kidney, fetal liver, fetal lung, heart, kidney, lymphoma Raji, mammary gland, pancreas, pituitary gland, placenta, prostate, salivary gland, skeletal muscle, small intestine, spinal cord, spleen, stomach, testis, thyroid, trachea and uterus. The PCR product derived by exon linking, covering the entire open reading frame, was cloned into the pCR2.1 vector from Invitrogen to provide clone 57808::ba252a4.698037.N1.

The NOV29f ORF begins with a Kozak consensus ATG initiation codon at nucleotides 19–21 and ends with a TGA codon at nucleotides 847–849. Putative untranslated regions upstream from the initiation codon and downstream from the termination codon are underlined in Table 29K, and the start and stop codons are in bold letters.

Variant sequences of NOV29f are included in Example 2. A variant sequence can include a single nucleotide polymorphism (SNP).

The NOV29f protein (SEQ ID NO:115) encoded by SEQ ID NO:114 is 319 amino acid residues in length is presented using the one-letter code in Table 29L. The Psort profile for NOV29f predicts that this sequence is likely to be localized at the plasma membrane with a certainty of 0.6000. The Signal P predicts a likely cleavage site for a NOV29f peptide is between positions 52 and 53, i.e., at the dash in the sequence IRA-SR.

NOV29 Clones

Unless specifically addressed as NOV29a, NOV29b, NOV29c, NOV29d, NOV29e, or NOV29f, any reference to NOV29 is assumed to encompass all variants. Further, Patp, BLAST, and DOMAIN analyses are presented for NOV29c, the longest NOV29 polypeptide sequence.

A search against the Patp database, a proprietary database that contains sequences published in patents and patent publications, yielded several homologous proteins shown in Table 29M.

NOV29 polypeptides are ficolin-like proteins with sequence homology to the Fibrinogen protein family. In a BLAST search of public sequence databases, it was found, for example, that the NOV29c nucleic sequence of this invention has 660 of 938 bases (70%) identical to a gb:GENBANK-ID:RNU03120|acc:U03120.1 Rattus norvegicus (Sprague-Dawley sodium glucose cotransporter 1 mRNA, complete cds— Rattus norvegicus, 2627 bp). The full NOV29c polypeptide sequence was found to have 401 of 446 amino acid residues (89%) identical to, and 401 of 446 amino acid residues (91%) similar to, the 552 amino acid residue gi|9588428|emb|CAC00574.1| (AL109659) dJ1024N4.1 (novel Sodium:solute symporter family member similar to SLC5A1 (SGLT1)) from Homo sapiens.

Additional BLAST results are shown in Table 25N.

A multiple sequence alignment is given in Table 290, with the NOV29 protein of the invention being shown on line 1, in a ClustalW analysis comparing NOV29 with related protein sequences disclosed in Table 25N.

The NOV29 Clustal W alignment shown in Table 29O was modified to end at amino residue 900. The data in Table 29O includes all of the regions overlapping with the NOV29 protein sequences.

The presence of identifiable domains in the protein disclosed herein was determined by searches using algorithms such as PROSITE, Blocks, Pfam, ProDomain, Prints and then determining the Interpro number by crossing the domain match (or numbers) using the Interpro website (http:www.ebi.ac.uk/interpro/). Table 29P lists the domain description from DOMAIN analysis results against NOV29c.

Consistent with other known members of the sodium:solute symporter family (SSF), the NOV29 Na+/glucose transporter-like protein contains the sodium:solute symporter family domain and an integral membrane domain as illustrated in Table 25T (Ohashi and Erickson, J. Biol. Chem., 272: 14220–6(1997)). NOV29 nucleic acids, and the encoded polypeptides, according to the invention are useful in a variety of applications and contexts. For example, NOV29 nucleic acids and polypeptides can be used to identify proteins that are members of the sodium:solute symporter family of proteins. The NOV29 nucleic acids and polypeptides can also be used to screen for molecules, which inhibit or enhance NOV29 activity or function. Specifically, the nucleic acids and polypeptides according to the invention may be used as targets for the identification of small molecules that modulate or inhibit, e.g., cellular activation and cellular metabolism. These molecules can be used to treat, e.g., for metabolic diseases such as diabetes and hypertension, or cancer, trauma, regeneration (in vitro and in vivo), viral/bacterial/parasitic infections, diabetes, autoimmune disease, renal artery stenosis, interstitial nephritis, glomerulonephritis, polycystic kidney disease, systemic lupus erythematosus, renal tubular acidosis, IgA nephropathy, hypercalceimia, Lesch-Nyhan syndrome, cirrhosis, transplantation, infertility and other diseases, disorders and conditions of the like.

In addition, various NOV29 nucleic acids and polypeptides according to the invention are useful, inter alia, as novel members of the protein families according to the presence of domains and sequence relatedness to previously described proteins. For example, the NOV29 nucleic acids and their encoded polypeptides include structural motifs that are characteristic of proteins belonging to the SSF family such as the Na+/glucose transporter proteins involved in renal transport and metabolism. (Ohashi and Erickson, J. Biol. Chem., 272: 14220–6(1997)).

Integral membrane proteins that mediate the intake of a wide variety of molecules with the concomitant uptake of sodium ions are grouped into a number of distinct families. One of these families, known as the SSF, consists of integral membrane proteins that are predicted to comprise at least ten membrane spanning domains. Members of the SSF catalyze solute:Na+ symport (Reizer et al.,. Biochem. Biophys. Acta, 1197: 133–166(1994)) can transport sugars, amino acids, nucleosides, inositols, vitamins, urea or anions, depending on the system. Members of the SSF family have been identified in bacteria, archaea and animals, and all functionally well characterized members catalyze solute uptake via Na+ symport.

The NOV29 nucleic acids and polypeptides, antibodies and related compounds according to the invention will be useful in therapeutic and diagnostic applications in the mediation of metabolism and immune function and renal physiology. As such, the NOV29 nucleic acids and polypeptides, antibodies and related compounds according to the invention may be used to treat metabolic, immune and renal disorders, e.g., metabolic diseases such as diabetes and hypertension, or cancer, trauma, regeneration (in vitro and in vivo), viral/bacterial/parasitic infections, diabetes, autoimmune disease, renal artery stenosis, interstitial nephritis, glomerulonephritis, polycystic kidney disease, systemic lupus erythematosus, renal tubular acidosis, IgA nephropathy, hypercalceimia, Lesch-Nyhan syndrome, cirrhosis, transplantation, or infertility. The NOV29 nucleic acids and polypeptides are useful for detecting specific cell types. For example, expression analysis has demonstrated that a NOV29 nucleic acid is expressed in Kidney, Liver, Testis, Whole Organism.

Additional utilities for NOV29 nucleic acids and polypeptides according to the invention are disclosed herein.

NOV30

A NOV30 polypeptide has been identified as a Sodium-glucose cotransporter (SGLT)-like protein (also referred to as CG56398-01). The disclosed novel NOV30 nucleic acid (SEQ ID NO:116) of 2105 nucleotides is shown in Table 30A. The novel NOV30 nucleic acid sequences maps to the chromosome 16.

An ORF begins with a Kozak consensus ATG initiation codon at nucleotides 31–33 and ends with a TAA codon at nucleotides 2056–2058. A putative untranslated region and/or downstream from the termination codon is underlined in Table 30A, and the start and stop codons are in bold letters.

The NOV30 protein (SEQ ID NO:117) encoded by SEQ ID NO:116 is 675 amino acid residues in length and is presented using the one-letter amino acid code in Table 30B. Psort analysis predicts the NOV30 protein of the invention to be localized to the plasma membrane with a certainty of 0.8000. The Signal P predicts a likely cleavage site for a NOV30 peptide is between positions 50 and 51, i.e., at the dash in the sequence VKT-KR.

A search against the Patp database, a proprietary database that contains sequences published in patents and patent publications, yielded several homologous proteins shown in Table 30C.

In a BLAST search of public sequence databases, it was found, for example, that the NOV30 nucleic acid sequence of this invention has 1764 of 2068 bases (85%) identical to a gb:GENBANK-ID:RABSGCTP|acc:D16226.1 mRNA from Oryctolagus cuniculus (Rabbit mRNA for sodium-glucose cotransporter, complete cds). NOV30 polypeptide was found to have 568 of 675 amino acid residues (84%) identical to, and 624 of 675 amino acid residues (92%) similar to, the 674 amino acid residue ptnr:SPTREMBL-ACC:Q28728 protein from Oryctolagus cuniculus (ONE OF THE MEMBERS OF SODIUM-GLUCOSE COTRANSPORTER FAMILY).

NOV30 also has homology to the proteins shown in the BLASTP data in Table 30D.

A multiple sequence alignment is given in Table 30E, with the NOV30 protein being shown on line 1 in Table 30E in a ClustalW analysis, and comparing the NOV30 protein with the related protein sequences shown in Table 300D. This BLASTP data is displayed graphically in the ClustalW in Table 30E.

The presence of identifiable domains in the protein disclosed herein was determined by searches using algorithms such as PROSITE, Blocks, Pfam, ProDomain, Prints and then determining the Interpro number by crossing the domain match (or numbers) using the Interpro website (http:www.ebi.ac.uk/interpro/). Table 30F lists the domain description from DOMAIN analysis results against NOV30.

Consistent with other known members of the sodium:solute symporter family (SSF), the NOV30 Na+/glucose transporter-like protein contains the sodium:solute symporter family domain and an integral membrane domain as illustrated in Table 30F (Ohashi and Erickson, J. Biol. Chem., 272: 14220–6(1997)). NOV30 nucleic acids, and the encoded polypeptides, according to the invention are useful in a variety of applications and contexts. For example, NOV30 nucleic acids and polypeptides can be used to identify proteins that are members of the sodium:solute symporter family of proteins. The NOV30 nucleic acids and polypeptides can also be used to screen for molecules, which inhibit or enhance NOV30 activity or function.

Specifically, the nucleic acids and polypeptides according to the invention may be used as targets for the identification of small molecules that modulate or inhibit, e.g., cellular activation and cellular metabolism. These molecules can be used to treat, e.g., for metabolic diseases such as cancer, trauma, regeneration (in vitro and in vivo), viral/bacterial/parasitic infections, hyperparathyroidism, hypoparathyroidism, inflammatory bowel disease, diverticular disease, Von Hippel-Lindau (VHL) syndrome, Alzheimer's disease, stroke, tuberous sclerosis, hypercalceimia, Parkinson's disease, Huntington's disease, cerebral palsy, epilepsy, Lesch-Nyhan syndrome, multiple sclerosis, ataxia-telangiectasia, leukodystrophies, behavioral disorders, addiction, anxiety, pain, neurodegeneration, systemic lupus erythematosus, autoimmune disease, asthma, emphysema, scleroderma, allergy, ARDS, diabetes, autoimmune disease, renal artery stenosis, interstitial nephritis, glomerulonephritis, polycystic kidney disease, systemic lupus erythematosus, renal tubular acidosis, IgA nephropathy, hypercalceimia, inflammatory bowel disease, diverticular disease and other diseases, disorders and conditions of the like.

In addition, various NOV30 nucleic acids and polypeptides according to the invention are useful, inter alia, as novel members of the protein families according to the presence of domains and sequence relatedness to previously described proteins. For example, the NOV30 nucleic acids and their encoded polypeptides include structural motifs that are characteristic of proteins belonging to the SSF family such as the Na+/glucose transporter proteins involved in renal transport and metabolism. (Ohashi and Erickson, J. Biol. Chem., 272: 14220–6(1997)).

Integral membrane proteins that mediate the intake of a wide variety of molecules with the concomitant uptake of sodium ions are grouped into a number of distinct families. One of these families, known as the SSF, consists of integral membrane proteins that are predicted to comprise at least ten membrane spanning domains. Members of the SSF catalyze solute:Na+ symport (Reizer et al.,. Biochem. Biophys. Acta, 1197: 133–166(1994)) can transport sugars, amino acids, nucleosides, inositols, vitamins, urea or anions, depending on the system. Members of the SSF family have been identified in bacteria, archaea and animals, and all functionally well characterized members catalyze solute uptake via Na+ symport.

The NOV30 nucleic acids and polypeptides, antibodies and related compounds according to the invention will be useful in therapeutic and diagnostic applications in the mediation of metabolism and immune function and renal physiology. As such, the NOV30 nucleic acids and polypeptides, antibodies and related compounds according to the invention may be used to treat metabolic, immune and renal disorders, e.g., metabolic diseases such as diabetes and hypertension, cancer, trauma, regeneration (in vitro and in vivo), viral/bacterial/parasitic infections, hyperparathyroidism, hypoparathyroidism, inflammatory bowel disease, diverticular disease, Von Hippel-Lindau (VHL) syndrome, Alzheimer's disease, stroke, tuberous sclerosis, hypercalceimia, Parkinson's disease, Huntington's disease, cerebral palsy, epilepsy, Lesch-Nyhan syndrome, multiple sclerosis, ataxia-telangiectasia, leukodystrophies, behavioral disorders, addiction, anxiety, pain, neurodegeneration, systemic lupus erythematosus, autoimmune disease, asthma, emphysema, scleroderma, allergy, ARDS, diabetes, autoimmune disease, renal artery stenosis, interstitial nephritis, glomerulonephritis, polycystic kidney disease, systemic lupus erythematosus, renal tubular acidosis, IgA nephropathy, hypercalceimia, inflammatory bowel disease, diverticular disease and other diseases, disorders and conditions of the like. For example, expression analysis has demonstrated that a NOV30 nucleic acid is expressed in Kidney, Parathyroid, Brain, Hippocampus, Hypothalamus, Lung, Small Intestine, Spinal Chord, Substantia Nigra, Whole Organism.

Additional utilities for NOV30 nucleic acids and polypeptides according to the invention are disclosed herein.

NOV31

A NOV31 polypeptide has been identified as a Olfactory Receptor (GPCR)-like protein (also referred to as CG56616-01). The disclosed novel NOV31 nucleic acid (SEQ ID NO:118) of 1201 nucleotides is shown in Table 31A. An ORF begins with Kozak consensus ATG initiation codon at nucleotides 86–88 and ends with a TAA codon at nucleotides 1040–1042. A putative untranslated region and/or downstream from the termination codon is underlined in Table 31A, and the start and stop codons are in bold letters.

The NOV31 protein (SEQ ID NO:119) encoded by SEQ ID NO:118 is 318 amino acid residues in length and is presented using the one-letter amino acid code in Table 31B. NOV31 has at least 10 SNP variants, whose variant positions for its nucleotide and amino acid sequences is numbered according to SEQ ID NOS:118 and 119, respectively. A variant sequence can include a single nucleotide polymorphism (SNP). A SNP can, in some instances, be referred to as a “cSNP” to denote that the nucleotide sequence containing the SNP originates as a cDNA. Variant sequences of NOV31 are included in Example 2.

Psort analysis predicts the NOV31 protein of the invention to be localized to the plasma membrane with a certainty of 0.6000. The Signal P predicts a likely cleavage site for a NOV29b peptide is between positions 41 and 42, i.e., at the dash in the sequence LLG-NG.

A search against the Patp database, a proprietary database that contains sequences published in patents and patent publications, yielded several homologous proteins shown in Table 31C.

In a BLAST search of public sequence databases, it was found, for example, that the NOV31 nucleic acid sequence of this invention has 702 of 991 bases (70%) identical to a gb:GENBANK-ID:MMU133426|acc:AJ133426.1 mRNA from Mus musculus (or 37c gene). The full amino acid sequence of the protein of the invention was found to have 209 of 314 amino acid residues (66%) identical to, and 246 of 314 amino acid residues (78%) similar to, the 318 amino acid residue ptnr:SPTREMBL-ACC:Q9QZ21 protein from Mus musculus (OLFACTORY RECEPTOR). Also 100% similarity to Genbank_AL450426.3 sequence that is not annotated.

NOV31 also has homology to the proteins shown in the BLASTP data in Table 31D.

A multiple sequence alignment is given in Table 31 E, with the NOV31 protein being shown on line 1 in Table 31E in a ClustalW analysis, and comparing the NOV31 protein with the related protein sequences shown in Table 31D. This BLASTP data is displayed graphically in the ClustalW in Table 31E.

The presence of identifiable domains in the protein disclosed herein was determined by searches using algorithms such as PROSITE, Blocks, Pfam, ProDomain, Prints and then determining the Interpro number by crossing the domain match (or numbers) using the Interpro website (http:www.ebi.ac.uk/interpro/). The DOMAIN analysis results indicate that the NOV31 protein contains the following protein domain (as defined by Interpro): domain name 7tm — 1 7 transmembrane receptor (rhodopsin family). DOMAIN results for NOV31 were collected from the Conserved Domain Database (CDD) with Reverse Position Specific BLAST. This BLAST samples domains found in the Smart and Pfam collections.

As discussed below, the NOV31 protein of the invention contained significant homology to the 7tm — 1 domain. This indicates that the NOV31 sequence has properties similar to those of other proteins known to contain this 7tm — 1 domain and similar to the properties of these domains. The 254 amino acid domain termed 7tm — 1 (SEQ ID NO:327; Pfam Acc. No. 00001) a seven transmembrane receptor (rhodopsin family), is shown in Table 31F.

The DOMAIN results are listed in Table 31 G with the statistics and domain description. An alignment of NOV31 residues 41–296 (SEQ ID NO:119) with the full 7tm — 1 domain, residues 1–254 (SEQ ID NO:327), are shown in Table 31G. This indicates that the NOV31 sequences have properties similar to those of other proteins known to contain this domain as well as to the 254 amino acid 7tm domain (SEQ ID NO:327). For Table 31G, fully conserved single residues are indicated by the vertical line and “strong” semi-conserved residues are indicated by the “plus sign.” The “strong” group of conserved amino acid residues may be any one of the following groups of amino acids: STA, NEQK, NHQK, NDEQ, QHRK, MILV, MILF, HY, FYW.

Consistent with other known members of the GPCR family of proteins, NOV31 contains 7tm — 1 7 transmembrane receptor (rhodopsin family) domain as illustrated in Table 31G as well as homology and cellular localization, i.e. plasma membrane.

NOV31 nucleic acids, and the encoded polypeptides, according to the invention are useful in a variety of applications and contexts. For example, NOV31 nucleic acids and polypeptides can be used to identify proteins that are members of the GPCR family of proteins. The NOV31 nucleic acids and polypeptides can also be used to screen for molecules, which inhibit or enhance NOV31 activity or function. Specifically, the nucleic acids and polypeptides according to the invention may be used as targets for the identification of small molecules that modulate or inhibit, e.g., cellular signal transduction. These molecules can be used to treat, e.g., cancer, immune disorders, and endocrine disorders.

In addition, various NOV31 nucleic acids and polypeptides according to the invention are useful, inter alia, as novel members of the protein families according to the presence of domains and sequence relatedness to previously described proteins. For example, the NOV31 nucleic acids and their encoded polypeptides include 7tm — 1 7 transmembrane receptor (rhodopsin family) domain and sequence homology that are characteristic of proteins belonging to the family of GPCR such as the G protein-coupled olfactory receptor. The NOV31 protein of the invention has a high homology to the 7tm — 1 domain (PFam Acc. No. pfam00001). The 7tm — 1 domain is from the 7 transmembrane receptor family, which includes a number of different proteins, including, for example, serotonin receptors, dopamine receptors, histamine receptors, andrenergic receptors, cannabinoid receptors, angiotensin II receptors, chemokine receptors, opioid receptors, G-protein coupled receptor (GPCR) proteins, olfactory receptors (OR), and the like.

G-Protein Coupled Receptor proteins (“GPCRs”) have been identified as a large family of G protein-coupled receptors in a number of species. These receptors share a seven transmembrane domain structure with many neurotransmitter and hormone receptors, and are likely to underlie the recognition and G-protein-mediated transduction of various signals. Human GPCR generally do not contain introns and belong to four different gene subfamilies, displaying great sequence variability. These genes are dominantly expressed in olfactory epithelium. See, e.g., Ben-Arie et al., Hum. Mol. Genet. 3:229–235(1994); and, Online Mendelian Inheritance in Man (“OMIM”) entry # 164342 (http://www.ncbi.nlm.nih.gov/entrez/dispomim.cgi?).

The NOV31 nucleic acids and polypeptides, antibodies and related compounds according to the invention will be useful in therapeutic and diagnostic applications in the mediation of cellular signal transduction. As such the NOV31 nucleic acids and polypeptides, antibodies and related compounds according to the invention may be used to treat a wide range of disorders such as cancer, immune disorders, endocrine disorders and other diseases, e.g. developmental diseases; MHCII and III diseases (immune diseases); taste and scent detectability disorders; Burkitt's lymphoma; corticoneurogenic disease; signal transduction pathway disorders; metabolic pathway disorders; retinal diseases including those involving photoreception; cell growth rate disorders; cell shape disorders; metabolic disorders; feeding disorders; control of feeding; the metabolic syndrome X; wasting disorders associated with chronic diseases; obesity; potential obesity due to over-eating or metabolic disturbances; potential disorders due to starvation (lack of appetite); diabetes; noninsulin-dependent diabetes mellitus (NIDDM); infectious disease; bacterial, fungal, protozoal and viral infections (particularly infections caused by HIV-1 or HIV-2); pain; cancer (including but not limited to neoplasm; adenocarcinoma; lymphoma; prostate cancer; uterus cancer); cancer-associated cachexia; anorexia; bulimia; asthma; Parkinson's disease; acute heart failure; hypotension; hypertension; urinary retention; osteoporosis; Crohn's disease; multiple sclerosis; Albright Hereditary Ostoeodystrophy; angina pectoris; myocardial infarction; ulcers; allergies; benign prostatic hypertrophy; and psychotic and neurological disorders; including anxiety; schizophrenia; manic depression; delirium; dementia; neurodegenerative disorders; Alzheimer's disease; severe mental retardation; Dentatorubro-pallidoluysian atrophy (DRPLA); Hypophosphatemic rickets; autosomal dominant (2) Acrocallosal syndrome and dyskinesias, such as Huntington's disease or Gilles de la Tourette syndrome; immune disorders; Adrenoleukodystrophy; Congenital Adrenal Hyperplasia; Hemophilia; Hypercoagulation; Idiopathic thrombocytopenic purpura; autoimmume disease; immunodeficiencies; transplantation; Von Hippel-Lindau (VHL) syndrome; Stroke; Tuberous sclerosis; hypercalceimia; Cerebral palsy; Epilepsy; Lesch-Nyhan syndrome; Ataxia-telangiectasia; Leukodystrophies; Behavioral disorders; Addiction; Neuroprotection; Cirrhosis; Transplantation; Systemic lupus erythematosus; Emphysema; Scleroderma; ARDS; Renal artery stenosis; Interstitial nephritis; Glomerulonephritis; Polycystic kidney disease; Systemic lupus erythematosus; Renal tubular acidosis; IgA nephropathy; Cardiomyopathy; Atherosclerosis; Congenital heart defects; Aortic stenosis; Atrial septal defect (ASD); Atrioventricular (A-V) canal defect; Ductus arteriosus; Pulmonary stenosis; Subaortic stenosis; Ventricular septal defect (VSD); valve diseases; Scleroderma; fertility; Pancreatitis; Endocrine dysfunctions; Growth and reproductive disorders; Inflammatory bowel disease; Diverticular disease; Leukodystrophies; Graft vesus host; Hyperthyroidism; Endometriosis; and hematopoietic disorders.

The NOV31 nucleic acids and polypeptides are useful for detecting specific cell types. For example, expression analysis has demonstrated that a NOV31 nucleic acid is expressed in Apical microvilli of the retinal pigment epithelium, arterial (aortic), basal forebrain, brain, Burkitt lymphoma cell lines, corpus callosum, cardiac (atria and ventricle), caudate nucleus, CNS and peripheral tissue, cerebellum, cerebral cortex, colon, cortical neurogenic cells, endothelial (coronary artery and umbilical vein) cells, palate epithelia, eye, neonatal eye, frontal cortex, fetal hematopoietic cells, heart, hippocampus, hypothalamus, leukocytes, liver, fetal liver, lung, lung lymphoma cell lines, fetal lymphoid tissue, adult lymphoid tissue, Those that express MHC II and III nervous, medulla, subthalamic nucleus, ovary, pancreas, pituitary, placenta, pons, prostate, putamen, serum, skeletal muscle, small intestine, smooth muscle (coronary artery in aortic) spinal cord, spleen, stomach, taste receptor cells of the tongue, testis, thalamus, and thymus tissue.

Additional utilities for NOV31 nucleic acids and polypeptides according to the invention are disclosed herein.

NOV32

A NOV32 polypeptide has been identified as a Phosphoenolpyruvate Carboxykinase (PCK)-like protein (also referred to as 153065222). The disclosed novel NOV32 nucleic acid (SEQ ID NO:120) of 2069 nucleotides is shown in Table 32A. The cDNA coding for the NOV32 was cloned by polymerase chain reaction (PCR) using the following primers: CCTTCCATACCTCCCCGGCTC (SEQ ID NO:328) and TGTGGGAAGGTCTATGGCACATTGA (SEQ ID NO:329) on the following pools of human cDNAs: Pool 1—adrenal gland, bone marrow, brain—amygdala, brain—cerebellum, brain hippocampus, brain—substantia nigra, brain—thalamus, brain—whole, fetal brain, fetal kidney, fetal liver, fetal lung, heart, kidney, lymphoma—Raji, mammary gland, pancreas, pituitary gland, placenta, prostate, salivary gland, skeletal muscle, small intestine, spinal cord, spleen, stomach, testis, thyroid, trachea, uterus.

An ORF begins with Kozak consensus ATG initiation codon at nucleotides 67–69 and ends with a TGA codon at nucleotides 1891–1893. A putative untranslated region and/or downstream from the termination codon is underlined in Table 32A, and the start and stop codons are in bold letters.

The NOV32 protein (SEQ ID NO:121) encoded by SEQ ID NO:120 is 608 amino acid residues in length and is presented using the one-letter amino acid code in Table 32B. NOV32 has two SNP variants, whose variant positions for its nucleotide and amino acid sequences is numbered according to SEQ ID NOS:120 and 121, respectively. A variant sequence can include a single nucleotide polymorphism (SNP). A SNP can, in some instances, be referred to as a “cSNP” to denote that the nucleotide sequence containing the SNP originates as a cDNA.

NOV32 variant 13376584 is a G to A SNP at 116 bp of the nucleotide sequence that results in a Ser to Asn change at amino acid 17 of protein sequence, and variant 13376583 is a C to T SNP at 1297 bp of the nucleotide sequence that results in a Pro to Ser change at amino acid 411 of protein sequence.

Psort analysis predicts the NOV32 protein of the invention to be localized in the mitochondria with a certainty of 0.5801.

A search against the Patp database, a proprietary database that contains sequences published in patents and patent publications, yielded several homologous proteins shown in Table 32C.

In a BLAST search of public sequence databases, it was found, for example, that the NOV32 nucleic acid sequence of this invention has 1557 of 1636 bases (95%) identical to a gb:GENBANK-ID:HSPPPCK|acc:X92720.1 mRNA from Homo sapiens (mRNA for phosphoenolpyruvate carboxykinase). The full amino acid sequence of the protein of the invention was found to have 459 of 469 amino acid residues (97%) identical to, and 463 of 469 amino acid residues (98%) similar to, the 640 amino acid residue ptnr:SWISSPROT-ACC:Q16822 protein from Homo sapiens (PHOSPHOENOLPYRUVATE CARBOXYKINASE, MITOCHONDRIAL PRECURSOR [GTP] (EC 4.1.1.32) (PHOSPHOENOLPYRUVATE CARBOXYLASE) (PEPCK-M)).

NOV32 also has homology to the proteins shown in the BLASTP data in Table 32D.

A multiple sequence alignment is given in Table 32E, with the NOV32 protein being shown on line 1 in Table 32E in a ClustalW analysis, and comparing the NOV32 protein with the related protein sequences shown in Table 32D. This BLASTP data is displayed graphically in the ClustalW in Table 32E.

NOV32 Clustal W alignment shown in Table 32E was modified to end at amino residue 150. The data in Table 32E includes all of the regions overlapping with the NOV32 protein sequences.

The presence of identifiable domains in the protein disclosed herein was determined by searches using algorithms such as PROSITE, Blocks, Pfam, ProDomain, Prints and then determining the Interpro number by crossing the domain match (or numbers) using the Interpro website (http:www.ebi.ac.uk/interpro/). Table 32F lists the domain description from DOMAIN analysis results against NOV32.

Consistent with other known members of the PCK family of proteins, NOV32 contains phosphoenolpyruvate carboxykinase domains as illustrated in Table 32F. NOV32 nucleic acids, and the encoded polypeptides, according to the invention are useful in a variety of applications and contexts. For example, NOV32 nucleic acids and polypeptides can be used to identify proteins that are members of the PCK family of proteins. The NOV32 nucleic acids and polypeptides can also be used to screen for molecules, which inhibit or enhance NOV32 activity or function. Specifically, the nucleic acids and polypeptides according to the invention may be used as targets for the identification of small molecules that modulate or inhibit, e.g., gluconeogenesis. These molecules can be used to treat, e.g., hypoglycemia and other diseases, disorders and conditions of the like.

In addition, various NOV32 nucleic acids and polypeptides according to the invention are useful, inter alia, as novel members of the protein families according to the presence of domains and sequence relatedness to previously described proteins. For example, the NOV32 nucleic acids and their encoded polypeptides include structural motifs and homology that are characteristic of proteins belonging to the family of PCK proteins which.

Phosphoenolpyruvate carboxykinase (GTP) (PCK; EC 4.1.1.32) catalyzes the formation of phosphoenolpyruvate by decarboxylation of oxaloacetate while hydrolyzing GTP, a rate limiting step in gluconeogenesis (the biosynthesis of glucose). In vertebrates there are two isozymes: a cytosolic form whose activity is affected by hormones regulating this metabolic process (such as glucagon, or insulin) and a mitochondrial form. The activity is about equally distributed between cytosol and mitochondria in human liver. In contrast, PCK is essentially a cytosolic enzyme in rat liver. See also PCK1 (261680), the human cytosolic PCK enzyme. Modaressi et al. (1996) cloned and sequenced the cDNA of the mitochondrial form of hepatic PCK (Biochem J., 315 (Pt 3):807–14 (1996)). The gene encodes a 640-amino acid polypeptide. The gene has has an overall 68% DNA sequence identity and a 70% deduced amino acid sequence identity with human cytosolic PCK cDNA. Expression studies were also reported.

Deficiencies in PKC2 (PEPCK2) have been documented. In 2 unrelated children, Hommes et al. (1976) observed hypoglycemia and liver impairment, with deficiency of PEPCK in liver tissue taken immediately after death (Acta Paediatr Scand., 65(2):233–40 (1976)). Massive fatty deposition in liver and kidneys was found at autopsy. Fiser et al. (1974) also observed hypoglycemia caused by deficiency of PEPCK (Am J Obstet Gynecol., 120(7):944–50(1974)). Other enzymatic causes of hypoglycemia include deficiency of glucose-6-phosphatase (232200), fructose-1,6-diphosphatase (229700), and pyruvate carboxylase (266150). Vidnes and Sovik (1976) described a case of persistent neonatal hypoglycemia in which only the extramitochondrial (i.e., cytosolic) form of hepatic phosphoenolpyruvate carboxykinase (PCK1) was deficient (Acta Paediatr Scand., 65(3):307–12(1976)). Phosphoenolpyruvate carboxykinase can be measured in fibroblasts, which are said to contain only mitochondrial PEPCK (Clayton et al., Eur J Pediatr., 145(1–2):46–50(1986)). Clayton et al. (1986) reported this disorder in a female child who died of liver failure at 6 months and probably in her brother who died a crib death at 4 weeks (Eur J Pediatr., 145(1–2):46–50(1986)). Leonard et al. (1991) studied the next child in this family, a boy who developed a similar illness with liver failure (Eur J Pediatr., 150(3):198–9(1991)). PEPCK activity in leukocytes and fibroblasts was normal, however, leading Leonard et al. (1991) to conclude that the primary defect in this family does not reside in this enzyme (Eur J Pediatr., 150(3):198–9(1991)). Subsequent studies of a third affected child in this family by Bodnar et al. (1993) suggested that the sibs suffered from the mitochondrial DNA depletion syndrome (251880) and that this depletion is controlled by the nuclear genome (Am J Hum Genet., 53(3):663–9(1993).

The NOV32 nucleic acids and polypeptides, antibodies and related compounds according to the invention will be useful in therapeutic and diagnostic applications in regulating glucose metabolism. As such the NOV32 nucleic acids and polypeptides, antibodies and related compounds according to the invention may be used to treat metabolic disorders, e.g., hypoglycemia.

The NOV32 nucleic acids and polypeptides are useful for detecting specific cell types. For example, expression analysis has demonstrated that a NOV32 nucleic acid is expressed in Liver, Adipose, Adrenal Gland/Suprarenal gland, Bone, Bone Marrow, Brain, Brown adipose, Cartilage, Cervix, Colon, Duodenum, Heart, Kidney, Kidney Cortex, Left cerebellum, Lung, Lymphoid tissue, Mammary gland/Breast, Ovary, Pancreas, Placenta, Prostate, Retina, Skin, Small Intestine, Spinal Chord, Stomach, Substantia Nigra, Synovium/Synovial membrane, Testis, Tonsils, Uterus, Vulva, Whole Organism.

Additional utilities for NOV32 nucleic acids and polypeptides according to the invention are disclosed herein.

NOV33

A NOV33 polypeptide has been identified as a G Protein-Coupled Receptor (GPCR)-like protein (also referred to as CG56610-01). The disclosed novel NOV33 nucleic acid (SEQ ID NO:122) of 924 nucleotides is shown in Table 33A. An ORF begins with an AAA codon which codes for the amino acid lysine at nucleotides 3–5 and ends with a TGA codon at nucleotides 912–914. A putative untranslated region and/or downstream from the termination codon is underlined in Table 33A, and the start and stop codons are in bold letters.

The NOV33 protein (SEQ ID NO:123) encoded by SEQ ID NO:122 is 303 amino acid residues in length and is presented using the one-letter amino acid code in Table 33B. Psort analysis predicts the NOV33 protein of the invention to be localized at the plasma membrane with a certainty of 0.6000. The Signal P predicts a likely cleavage site for a NOV33 peptide is between positions 33 and 34, i.e., at the dash in the sequence ALS-GN.

A search against the Patp database, a proprietary database that contains sequences published in patents and patent publications, yielded several homologous proteins shown in Table 33C.

In a BLAST search of public sequence databases, it was found, for example, that the NOV33 nucleic acid sequence of this invention has 579 of 905 bases (63%) identical to a gb:GENBANK-ID:AF133300|acc:AF133300.2 mRNA from Mus musculus (MOR 3′Beta1, MOR 3′Beta2, MOR 3′Beta3, and MOR 3′Beta4 genes, complete cds; Cbx3 pseudogene, complete sequence; and MOR 3′Beta5 and MOR 3′Beta6 genes, complete cds). NOV33 polypeptide of the invention was found to have 155 of 295 amino acid residues (52%) identical to, and 208 of 295 amino acid residues (70%) similar to, the 312 amino acid residue ptnr:TREMBLNEW-ACC:AAG41678 protein from Homo sapiens (HOR5′BETA12).

NOV33 also has homology to the proteins shown in the BLASTP data in Table 33D.

A multiple sequence alignment is given in Table 33E, with the NOV33 protein being shown on line 1 in Table 33E in a ClustalW analysis, and comparing the NOV33 protein with the related protein sequences shown in Table 33D. This BLASTP data is displayed graphically in the ClustalW in Table 33E.

The NOV33 Clustal W alignment shown in Table 33E was modified to begin at amino residue 551. The data in Table 33E includes all of the regions overlapping with the NOV33 protein sequences.

The presence of identifiable domains in the protein disclosed herein was determined by searches using algorithms such as PROSITE, Blocks, Pfam, ProDomain, Prints and then determining the Interpro number by crossing the domain match (or numbers) using the Interpro website (http:www.ebi.ac.uk/interpro/). The DOMAIN analysis results indicate that the NOV33 protein contains the following protein domain (as defined by Interpro): domain name 7tm — 1 7 transmembrane receptor (rhodopsin family). DOMAIN results for NOV33 were collected from the Conserved Domain Database (CDD) with Reverse Position Specific BLAST. This BLAST samples domains found in the Smart and Pfam collections.

As discussed below, the NOV33 protein of the invention contained significant homology to the 7tm — 1 domain. This indicates that the NOV33 sequence has properties similar to those of other proteins known to contain this 7tm — 1 domain and similar to the properties of these domains. The 254 amino acid domain termed 7tm 1 (SEQ ID NO:340; Pfam Acc. No. 00001) a seven transmembrane receptor (rhodopsin family), is shown in Table 33F.

The DOMAIN results are listed in Table 33G with the statistics and domain description. An alignment of NOV33 residues 34–133 (SEQ ID NO:123) with the full 7tm — 1 domain, residues 1–254 (SEQ ID NO:340), are shown in Table 33G. This indicates that the NOV33 sequences have properties similar to those of other proteins known to contain this domain as well as to the 254 amino acid 7tm domain (SEQ ID NO:340). For Table 33G, fully conserved single residues are indicated by the vertical line and “strong” semi-conserved residues are indicated by the “plus sign.” The “strong” group of conserved amino acid residues may be any one of the following groups of amino acids: STA, NEQK, NHQK, NDEQ, QHRK, MILV, MILF, HY, FYW.

Consistent with other known members of the GPCR family of proteins, NOV33 contains 7tm 1 7 transmembrane receptor (rhodopsin family) domain as illustrated in Table 33G as well as homology and cellular localization, i.e. plasma membrane.

NOV33 nucleic acids, and the encoded polypeptides, according to the invention are useful in a variety of applications and contexts. For example, NOV33 nucleic acids and polypeptides can be used to identify proteins that are members of the GPCR family of proteins. The NOV33 nucleic acids and polypeptides can also be used to screen for molecules, which inhibit or enhance NOV33 activity or function. Specifically, the nucleic acids and polypeptides according to the invention may be used as targets for the identification of small molecules that modulate or inhibit, e.g., cellular signal transduction. These molecules can be used to treat, e.g., cancer, immune disorders, and endocrine disorders.

In addition, various NOV33 nucleic acids and polypeptides according to the invention are useful, inter alia, as novel members of the protein families according to the presence of domains and sequence relatedness to previously described proteins. For example, the NOV33 nucleic acids and their encoded polypeptides include 7tm — 1 7 transmembrane receptor (rhodopsin family) domain and sequence homology that are characteristic of proteins belonging to the family of GPCR such as the G protein-coupled olfactory receptor. The NOV33 protein of the invention has a high homology to the 7tm — 1 domain (PFam Acc. No. pfam00001). The 7tm — 1 domain is from the 7 transmembrane receptor family, which includes a number of different proteins, including, for example, serotonin receptors, dopamine receptors, histamine receptors, andrenergic receptors, cannabinoid receptors, angiotensin II receptors, chemokine receptors, opioid receptors, G-protein coupled receptor (GPCR) proteins, olfactory receptors (OR), and the like.

G-Protein Coupled Receptor proteins (“GPCRs”) have been identified as a large family of G protein-coupled receptors in a number of species. These receptors share a seven transmembrane domain structure with many neurotransmitter and hormone receptors, and are likely to underlie the recognition and G-protein-mediated transduction of various signals. Human GPCR generally do not contain introns and belong to four different gene subfamilies, displaying great sequence variability. These genes are dominantly expressed in olfactory epithelium. See, e.g., Ben-Arie et al., Hum. Mol. Genet. 3:229–235(1994); and, Online Mendelian Inheritance in Man (“OMIM”) entry # 164342 (http://www.ncbi.nhn.nih.gov/entrez/dispomim.cgi?).

The NOV33 nucleic acids and polypeptides, antibodies and related compounds according to the invention will be useful in therapeutic and diagnostic applications in the mediation of cellular signal transduction. As such the NOV33 nucleic acids and polypeptides, antibodies and related compounds according to the invention may be used to treat a wide range of disorders such as cancer, immune disorders, endocrine disorders and other diseases, e.g., developmental diseases; MHCII and III diseases (immune diseases); taste and scent detectability disorders; Burkitt's lymphoma; corticoneurogenic disease; signal transduction pathway disorders; metabolic pathway disorders; retinal diseases including those involving photoreception; cell growth rate disorders; cell shape disorders; metabolic disorders; feeding disorders; control of feeding; the metabolic syndrome X; wasting disorders associated with chronic diseases; obesity; potential obesity due to over-eating or metabolic disturbances; potential disorders due to starvation (lack of appetite); diabetes; noninsulin-dependent diabetes mellitus (NIDDM); infectious disease; bacterial, fungal, protozoal and viral infections (particularly infections caused by HIV-1 or HIV-2); pain; cancer (including but not limited to neoplasm; adenocarcinoma; lymphoma; prostate cancer; uterus cancer); cancer-associated cachexia; anorexia; bulimia; asthma; Parkinson's disease; acute heart failure; hypotension; hypertension; urinary retention; osteoporosis; Crohn's disease; multiple sclerosis; Albright Hereditary Ostoeodystrophy; angina pectoris; myocardial infarction; ulcers; allergies; benign prostatic hypertrophy; and psychotic and neurological disorders; including anxiety; schizophrenia; manic depression; delirium; dementia; neurodegenerative disorders; Alzheimer's disease; severe mental retardation; Dentatorubro-pallidoluysian atrophy (DRPLA); Hypophosphatemic rickets; autosomal dominant (2) Acrocallosal syndrome and dyskinesias, such as Huntington's disease or Gilles de la Tourette syndrome; immune disorders; Adrenoleukodystrophy; Congenital Adrenal Hyperplasia; Hemophilia; Hypercoagulation; Idiopathic thrombocytopenic purpura; autoimmume disease; immunodeficiencies; transplantation; Von Hippel-Lindau (VHL) syndrome; Stroke; Tuberous sclerosis; hypercalceimia; Cerebral palsy; Epilepsy; Lesch-Nyhan syndrome; Ataxia-telangiectasia; Leukodystrophies; Behavioral disorders; Addiction; Neuroprotection; Cirrhosis; Transplantation; Systemic lupus erythematosus; Emphysema; Scleroderma; ARDS; Renal artery stenosis; Interstitial nephritis; Glomerulonephritis; Polycystic kidney disease; Systemic lupus erythematosus; Renal tubular acidosis; IgA nephropathy; Cardiomyopathy; Atherosclerosis; Congenital heart defects; Aortic stenosis; Atrial septal defect (ASD); Atrioventricular (A-V) canal defect; Ductus arteriosus; Pulmonary stenosis; Subaortic stenosis; Ventricular septal defect (VSD); valve diseases; Scleroderma; fertility; Pancreatitis; Endocrine dysfunctions; Growth and reproductive disorders; Inflammatory bowel disease; Diverticular disease; Leukodystrophies; Graft vesus host; Hyperthyroidism; Endometriosis; and hematopoietic disorders.

The NOV33 nucleic acids and polypeptides are useful for detecting specific cell types. For example, expression analysis has demonstrated that a NOV33 nucleic acid is expressed in MHC II and III nervous, medulla, subthalamic nucleus, ovary, pancreas, pituitary, placenta, pons, prostate, putamen, serum, skeletal muscle, small intestine, smooth muscle (coronary artery in aortic) spinal cord, spleen, stomach, taste receptor cells of the tongue, testis, thalamus, and thymus tissue.

Additional utilities for NOV33 nucleic acids and polypeptides according to the invention are disclosed herein.

NOVX Nucleic Acids and Polypeptides

One aspect of the invention pertains to isolated nucleic acid molecules that encode NOVX polypeptides or biologically active portions thereof. Also included in the invention are nucleic acid fragments sufficient for use as hybridization probes to identify NOVX-encoding nucleic acids (e.g., NOVX mRNAs) and fragments for use as PCR primers for the amplification and/or mutation of NOVX nucleic acid molecules. As used herein, the term “nucleic acid molecule” is intended to include DNA molecules (e.g., cDNA or genomic DNA), RNA molecules (e.g., mRNA), analogs of the DNA or RNA generated using nucleotide analogs, and derivatives, fragments and homologs thereof. The nucleic acid molecule may be single-stranded or double-stranded, but preferably is comprised double-stranded DNA.

A NOVX nucleic acid can encode a mature NOVX polypeptide. As used herein, a “mature” form of a polypeptide or protein disclosed in the present invention is the product of a naturally occurring polypeptide or precursor form or proprotein. The naturally occurring polypeptide, precursor or proprotein includes, by way of nonlimiting example, the full-length gene product, encoded by the corresponding gene. Alternatively, it may be defined as the polypeptide, precursor or proprotein encoded by an ORF described herein. The product “mature” form arises, again by way of nonlimiting example, as a result of one or more naturally occurring processing steps as they may take place within the cell, or host cell, in which the gene product arises. Examples of such processing steps leading to a “mature” form of a polypeptide or protein include the cleavage of the N-terminal methionine residue encoded by the initiation codon of an ORF, or the proteolytic cleavage of a signal peptide or leader sequence. Thus a mature form arising from a precursor polypeptide or protein that has residues 1 to N, where residue 1 is the N-terminal methionine, would have residues 2 through N remaining after removal of the N-terminal methionine. Alternatively, a mature form arising from a precursor polypeptide or protein having residues 1 to N, in which an N-terminal signal sequence from residue 1 to residue M is cleaved, would have the residues from residue M+1 to residue N remaining. Further as used herein, a “mature” form of a polypeptide or protein may arise from a step of post-translational modification other than a proteolytic cleavage event. Such additional processes include, by way of non-limiting example, glycosylation, myristoylation or phosphorylation. In general, a mature polypeptide or protein may result from the operation of only one of these processes, or a combination of any of them.

The term “probes”, as utilized herein, refers to nucleic acid sequences of variable length, preferably between at least about 10 nucleotides (nt), 100 nt, or as many as approximately, e.g., 6,000 nt, depending upon the specific use. Probes are used in the detection of identical, similar, or complementary nucleic acid sequences. Longer length probes are generally obtained from a natural or recombinant source, are highly specific, and much slower to hybridize than shorter length oligomer probes. Probes may be single- or double-stranded and designed to have specificity in PCR, membrane-based hybridization technologies, or ELISA-like technologies.

The term “isolated” nucleic acid molecule, as utilized herein, is one, which is separated from other nucleic acid molecules which are present in the natural source of the nucleic acid. Preferably, an “isolated” nucleic acid is free of sequences which naturally flank the nucleic acid (i.e., sequences located at the 5′- and 3′-termini of the nucleic acid) in the genomic DNA of the organism from which the nucleic acid is derived. For example, in various embodiments, the isolated NOVX nucleic acid molecules can contain less than about 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb or 0.1 kb of nucleotide sequences which naturally flank the nucleic acid molecule in genomic DNA of the cell/tissue from which the nucleic acid is derived (e.g., brain, heart, liver, spleen, etc.). Moreover, an “isolated” nucleic acid molecule, such as a cDNA molecule, can be substantially free of other cellular material or culture medium when produced by recombinant techniques, or of chemical precursors or other chemicals when chemically synthesized.

A nucleic acid molecule of the invention, e.g., a nucleic acid molecule having the nucleotide sequence SEQ ID NOS:1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, and 122, or a complement of this aforementioned nucleotide sequence, can be isolated using standard molecular biology techniques and the sequence information provided herein. Using all or a portion of the nucleic acid sequence of SEQ ID NOS:1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, and 122 as a hybridization probe, NOVX molecules can be isolated using standard hybridization and cloning techniques (e.g., as described in Sambrook, et al., (eds.), M OLECULAR C LONING : A L ABORATORY M ANUAL 2 nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989; and Ausubel, et al., (eds.), C URRENT P ROTOCOLS IN M OLECULAR B IOLOGY , John Wiley & Sons, New York, N.Y., 1993.)

A nucleic acid of the invention can be amplified using cDNA, mRNA or alternatively, genomic DNA, as a template and appropriate oligonucleotide primers according to standard PCR amplification techniques. The nucleic acid so amplified can be cloned into an appropriate vector and characterized by DNA sequence analysis. Furthermore, oligonucleotides corresponding to NOVX nucleotide sequences can be prepared by standard synthetic techniques, e.g., using an automated DNA synthesizer.

As used herein, the term “oligonucleotide” refers to a series of linked nucleotide residues, which oligonucleotide has a sufficient number of nucleotide bases to be used in a PCR reaction. A short oligonucleotide sequence may be based on, or designed from, a genomic or cDNA sequence and is used to amplify, confirm, or reveal the presence of an identical, similar or complementary DNA or RNA in a particular cell or tissue. Oligonucleotides comprise portions of a nucleic acid sequence having about 10 nt, 50 nt, or 100 nt in length, preferably about 15 nt to 30 nt in length. In one embodiment of the invention, an oligonucleotide comprising a nucleic acid molecule less than 100 nt in length would further comprise at least 6 contiguous nucleotides SEQ ID NOS:1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, and 122, or a complement thereof. Oligonucleotides may be chemically synthesized and may also be used as probes.

In another embodiment, an isolated nucleic acid molecule of the invention comprises a nucleic acid molecule that is a complement of the nucleotide sequence shown in SEQ ID NOS:1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, and 122, or a portion of this nucleotide sequence (e.g., a fragment that can be used as a probe or primer or a fragment encoding a biologically-active portion of an NOVX polypeptide). A nucleic acid molecule that is complementary to the nucleotide sequence shown SEQ ID NOS:1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, and 122 is one that is sufficiently complementary to the nucleotide sequence shown SEQ ID NOS:1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, and 122 that it can hydrogen bond with little or no mismatches to the nucleotide sequence shown SEQ ID NOS:1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, and 122 thereby forming a stable duplex.

As used herein, the term “complementary” refers to Watson-Crick or Hoogsteen base pairing between nucleotides units of a nucleic acid molecule, and the term “binding” means the physical or chemical interaction between two polypeptides or compounds or associated polypeptides or compounds or combinations thereof. Binding includes ionic, non-ionic, van der Waals, hydrophobic interactions, and the like. A physical interaction can be either direct or indirect. Indirect interactions may be through or due to the effects of another polypeptide or compound. Direct binding refers to interactions that do not take place through, or due to, the effect of another polypeptide or compound, but instead are without other substantial chemical intermediates.

Fragments provided herein are defined as sequences of at least 6 (contiguous) nucleic acids or at least 4 (contiguous) amino acids, a length sufficient to allow for specific hybridization in the case of nucleic acids or for specific recognition of an epitope in the case of amino acids, respectively, and are at most some portion less than a full length sequence. Fragments may be derived from any contiguous portion of a nucleic acid or amino acid sequence of choice. Derivatives are nucleic acid sequences or amino acid sequences formed from the native compounds either directly or by modification or partial substitution. Analogs are nucleic acid sequences or amino acid sequences that have a structure similar to, but not identical to, the native compound but differs from it in respect to certain components or side chains. Analogs may be synthetic or from a different evolutionary origin and may have a similar or opposite metabolic activity compared to wild type. Homologs are nucleic acid sequences or amino acid sequences of a particular gene that are derived from different species.

Derivatives and analogs may be full length or other than full length, if the derivative or analog contains a modified nucleic acid or amino acid, as described below. Derivatives or analogs of the nucleic acids or proteins of the invention include, but are not limited to, molecules comprising regions that are substantially homologous to the nucleic acids or proteins of the invention, in various embodiments, by at least about 70%, 80%, or 95% identity (with a preferred identity of 80–95%) over a nucleic acid or amino acid sequence of identical size or when compared to an aligned sequence in which the alignment is done by a computer homology program known in the art, or whose encoding nucleic acid is capable of hybridizing to the complement of a sequence encoding the aforementioned proteins under stringent, moderately stringent, or low stringent conditions. See e.g. Ausubel, et al., C URRENT P ROTOCOLS IN M OLECULAR B IOLOGY , John Wiley & Sons, New York, N.Y., 1993, and below.

A “homologous nucleic acid sequence” or “homologous amino acid sequence,” or variations thereof, refer to sequences characterized by a homology at the nucleotide level or amino acid level as discussed above. Homologous nucleotide sequences encode those sequences coding for isoforms of NOVX polypeptides. Isoforms can be expressed in different tissues of the same organism as a result of, for example, alternative splicing of RNA. Alternatively, isoforms can be encoded by different genes. In the invention, homologous nucleotide sequences include nucleotide sequences encoding for an NOVX polypeptide of species other than humans, including, but not limited to: vertebrates, and thus can include, e.g., frog, mouse, rat, rabbit, dog, cat cow, horse, and other organisms. Homologous nucleotide sequences also include, but are not limited to, naturally occurring allelic variations and mutations of the nucleotide sequences set forth herein. A homologous nucleotide sequence does not, however, include the exact nucleotide sequence encoding human NOVX protein. Homologous nucleic acid sequences include those nucleic acid sequences that encode conservative amino acid substitutions (see below) in SEQ ID NOS:1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, and 122, as well as a polypeptide possessing NOVX biological activity. Various biological activities of the NOVX proteins are described below.

An NOVX polypeptide is encoded by the open reading frame (“ORF”) of an NOVX nucleic acid. An ORF corresponds to a nucleotide sequence that could potentially be translated into a polypeptide. A stretch of nucleic acids comprising an ORF is uninterrupted by a stop codon. An ORF that represents the coding sequence for a full protein begins with an ATG “start” codon and terminates with one of the three “stop” codons, namely, TAA, TAG, or TGA. For the purposes of this invention, an ORF may be any part of a coding sequence, with or without a start codon, a stop codon, or both. For an ORF to be considered as a good candidate for coding for a bona fide cellular protein, a minimum size requirement is often set, e.g., a stretch of DNA that would encode a protein of 50 amino acids or more.

The nucleotide sequences determined from the cloning of the human NOVX genes allows for the generation of probes and primers designed for use in identifying and/or cloning NOVX homologues in other cell types, e.g. from other tissues, as well as NOVX homologues from other vertebrates. The probe/primer typically comprises substantially purified oligonucleotide. The oligonucleotide typically comprises a region of nucleotide sequence that hybridizes under stringent conditions to at least about 12, 25, 50, 100, 150, 200, 250, 300, 350 or 400 consecutive sense strand nucleotide sequence SEQ ID NOS:1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, and 122; or an anti-sense strand nucleotide sequence of SEQ ID NOS:1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, and 122; or of a naturally occurring mutant of SEQ ID NOS:1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, and 122.

Probes based on the human NOVX nucleotide sequences can be used to detect transcripts or genomic sequences encoding the same or homologous proteins. In various embodiments, the probe further comprises a label group attached thereto, e.g. the label group can be a radioisotope, a fluorescent compound, an enzyme, or an enzyme co-factor. Such probes can be used as a part of a diagnostic test kit for identifying cells or tissues which mis-express an NOVX protein, such as by measuring a level of an NOVX-encoding nucleic acid in a sample of cells from a subject e.g., detecting NOVX mRNA levels or determining whether a genomic NOVX gene has been mutated or deleted.

“A polypeptide having a biologically-active portion of an NOVX polypeptide” refers to polypeptides exhibiting activity similar, but not necessarily identical to, an activity of a polypeptide of the invention, including mature forms, as measured in a particular biological assay, with or without dose dependency. A nucleic acid fragment encoding a “biologically active portion of NOVX” can be prepared by isolating a portion SEQ ID NOS:1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, and 122, that encodes a polypeptide having an NOVX biological activity (the biological activities of the NOVX proteins are described below), expressing the encoded portion of NOVX protein (e.g., by recombinant expression in vitro) and assessing the activity of the encoded portion of NOVX.

NOVX Nucleic Acid and Polypeptide Variants

The invention further encompasses nucleic acid molecules that differ from the nucleotide sequences shown in SEQ ID NOS:1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, and 122 due to degeneracy of the genetic code and thus encode the same NOVX proteins as that encoded by the nucleotide sequences shown in SEQ ID NOS:1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, and 122. In another embodiment, an isolated nucleic acid molecule of the invention has a nucleotide sequence encoding a protein having an amino acid sequence shown in SEQ ID NOS:2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, and 123.

In addition to the human NOVX nucleotide sequences shown in SEQ ID NOS:1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, and 122, it will be appreciated by those skilled in the art that DNA sequence polymorphisms that lead to changes in the amino acid sequences of the NOVX polypeptides may exist within a population (e.g., the human population). Such genetic polymorphism in the NOVX genes may exist among individuals within a population due to natural allelic variation. As used herein, the terms “gene” and “recombinant gene” refer to nucleic acid molecules comprising an open reading frame (ORF) encoding an NOVX protein, preferably a vertebrate NOVX protein. Such natural allelic variations can typically result in 1–5% variance in the nucleotide sequence of the NOVX genes. Any and all such nucleotide variations and resulting amino acid polymorphisms in the NOVX polypeptides, which are the result of natural allelic variation and that do not alter the functional activity of the NOVX polypeptides, are intended to be within the scope of the invention.

Moreover, nucleic acid molecules encoding NOVX proteins from other species, and thus that have a nucleotide sequence that differs from the human SEQ ID NOS:1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, and 122 are intended to be within the scope of the invention. Nucleic acid molecules corresponding to natural allelic variants and homologues of the NOVX cDNAs of the invention can be isolated based on their homology to the human NOVX nucleic acids disclosed herein using the human cDNAs, or a portion thereof, as a hybridization probe according to standard hybridization techniques under stringent hybridization conditions.

Accordingly, in another embodiment, an isolated nucleic acid molecule of the invention is at least 6 nucleotides in length and hybridizes under stringent conditions to the nucleic acid molecule comprising the nucleotide sequence of SEQ ID NOS:1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, and 122. In another embodiment, the nucleic acid is at least 10, 25, 50, 100, 250, 500, 750, 1000, 1500, or 2000 or more nucleotides in length. In yet another embodiment, an isolated nucleic acid molecule of the invention hybridizes to the coding region. As used herein, the term “hybridizes under stringent conditions” is intended to describe conditions for hybridization and washing under which nucleotide sequences at least 60% homologous to each other typically remain hybridized to each other.

Homologs (i.e., nucleic acids encoding NOVX proteins derived from species other than human) or other related sequences (e.g., paralogs) can be obtained by low, moderate or high stringency hybridization with all or a portion of the particular human sequence as a probe using methods well known in the art for nucleic acid hybridization and cloning.

As used herein, the phrase “stringent hybridization conditions” refers to conditions under which a probe, primer or oligonucleotide will hybridize to its target sequence, but to no other sequences. Stringent conditions are sequence-dependent and will be different in different circumstances. Longer sequences hybridize specifically at higher temperatures than shorter sequences. Generally, stringent conditions are selected to be about 5° C. lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength and pH. The Tm is the temperature (under defined ionic strength, pH and nucleic acid concentration) at which 50% of the probes complementary to the target sequence hybridize to the target sequence at equilibrium. Since the target sequences are generally present at excess, at Tm, 50% of the probes are occupied at equilibrium. Typically, stringent conditions will be those in which the salt concentration is less than about 1.0 M sodium ion, typically about 0.01 to 1.0 M sodium ion (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30° C. for short probes, primers or oligonucleotides (e.g., 10 nt to 50 nt) and at least about 60° C. for longer probes, primers and oligonucleotides. Stringent conditions may also be achieved with the addition of destabilizing agents, such as formamide.

Stringent conditions are known to those skilled in the art and can be found in Ausubel, et al., (eds.), C URRENT P ROTOCOLS IN M OLECULAR B IOLOGY , John Wiley & Sons, N.Y. (1989), 6.3.1–6.3.6. Preferably, the conditions are such that sequences at least about 65%, 70%, 75%, 85%, 90%, 95%, 98%, or 99% homologous to each other typically remain hybridized to each other. A non-limiting example of stringent hybridization conditions are hybridization in a high salt buffer comprising 6×SSC, 50 mM Tris-HCl (pH 7.5), 1 mM EDTA, 0.02% PVP, 0.02% Ficoll, 0.02% BSA, and 500 mg/ml denatured salmon sperm DNA at 65° C., followed by one or more washes in 0.2×SSC, 0.01% BSA at 50° C. An isolated nucleic acid molecule of the invention that hybridizes under stringent conditions to the sequences SEQ ID NOS:1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, and 122, corresponds to a naturally-occurring nucleic acid molecule. As used herein, a “naturally-occurring” nucleic acid molecule refers to an RNA or DNA molecule having a nucleotide sequence that occurs in nature (e.g., encodes a natural protein).

In a second embodiment, a nucleic acid sequence that is hybridizable to the nucleic acid molecule comprising the nucleotide sequence of SEQ ID NOS:1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, and 122, or fragments, analogs or derivatives thereof, under conditions of moderate stringency is provided. A non-limiting example of moderate stringency hybridization conditions are hybridization in 6×SSC, 5× Denhardt's solution, 0.5% SDS and 100 mg/ml denatured salmon sperm DNA at 55° C., followed by one or more washes in 1×SSC, 0.1% SDS at 37° C. Other conditions of moderate stringency that may be used are well-known within the art. See, e.g., Ausubel, et al. (eds.), 1993, C URRENT P ROTOCOLS IN M OLECULAR B IOLOGY , John Wiley & Sons, NY, and Kriegler, 1990; G ENE T RANSFER AND E XPRESSION , A L ABORATORY M ANUAL , Stockton Press, NY.

In a third embodiment, a nucleic acid that is hybridizable to the nucleic acid molecule comprising the nucleotide sequences SEQ ID NOS:1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, and 122, or fragments, analogs or derivatives thereof, under conditions of low stringency, is provided. A non-limiting example of low stringency hybridization conditions are hybridization in 35% formamide, 5×SSC, 50 mM Tris-HCl (pH 7.5), 5 mM EDTA, 0.02% PVP, 0.02% Ficoll, 0.2% BSA, 100 mg/ml denatured salmon sperm DNA, 10% (wt/vol) dextran sulfate at 40° C., followed by one or more washes in 2×SSC, 25 mM Tris-HCl (pH 7.4), 5 mM EDTA, and 0.1% SDS at 50° C. Other conditions of low stringency that may be used are well known in the art (e.g., as employed for cross-species hybridizations). See, e.g., Ausubel, et al. (eds.), 1993, C URRENT P ROTOCOLS IN M OLECULAR B IOLOGY , John Wiley & Sons, NY, and Kriegler, 1990, G ENE T RANSFER AND E XPRESSION , A L ABORATORY M ANUAL , Stockton Press, NY; Shilo and Weinberg, 1981 . Proc Natl Acad Sci USA 78: 6789–6792.

Conservative Mutations

In addition to naturally-occurring allelic variants of NOVX sequences that may exist in the population, the skilled artisan will further appreciate that changes can be introduced by mutation into the nucleotide sequences SEQ ID NOS:1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, and 122, thereby leading to changes in the amino acid sequences of the encoded NOVX proteins, without altering the functional ability of said NOVX proteins. For example, nucleotide substitutions leading to amino acid substitutions at “non-essential” amino acid residues can be made in the sequence SEQ ID NOS:2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, and 123. A “non-essential” amino acid residue is a residue that can be altered from the wild-type sequences of the NOVX proteins without altering their biological activity, whereas an “essential” amino acid residue is required for such biological activity. For example, amino acid residues that are conserved among the NOVX proteins of the invention are predicted to be particularly non-amenable to alteration. Amino acids for which conservative substitutions can be made are well-known within the art.

Another aspect of the invention pertains to nucleic acid molecules encoding NOVX proteins that contain changes in amino acid residues that are not essential for activity. Such NOVX proteins differ in amino acid sequence from SEQ ID NOS:1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, and 122 yet retain biological activity. In one embodiment, the isolated nucleic acid molecule comprises a nucleotide sequence encoding a protein, wherein the protein comprises an amino acid sequence at least about 45% homologous to the amino acid sequences SEQ ID NOS:2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, and 123. Preferably, the protein encoded by the nucleic acid molecule is at least about 60% homologous to SEQ ID NOS:2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, and 123; more preferably at least about 70% homologous SEQ ID NOS:2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, and 123; still more preferably at least about 80% homologous to SEQ ID NOS:2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, and 123; even more preferably at least about 90% homologous to SEQ ID NOS:2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, and 123; and most preferably at least about 95% homologous to SEQ ID NOS:2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, and 123.

An isolated nucleic acid molecule encoding an NOVX protein homologous to the protein of SEQ ID NOS:2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, and 123 can be created by introducing one or more nucleotide substitutions, additions or deletions into the nucleotide sequence of SEQ ID NOS:1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, and 122, such that one or more amino acid substitutions, additions or deletions are introduced into the encoded protein.

Mutations can be introduced into SEQ ID NOS:1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, and 122 by standard techniques, such as site-directed mutagenesis and PCR-mediated mutagenesis. Preferably, conservative amino acid substitutions are made at one or more predicted, non-essential amino acid residues. A “conservative amino acid substitution” is one in which the amino acid residue is replaced with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined within the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Thus, a predicted non-essential amino acid residue in the NOVX protein is replaced with another amino acid residue from the same side chain family. Alternatively, in another embodiment, mutations can be introduced randomly along all or part of an NOVX coding sequence, such as by saturation mutagenesis, and the resultant mutants can be screened for NOVX biological activity to identify mutants that retain activity. Following mutagenesis SEQ ID NOS:1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, and 122, the encoded protein can be expressed by any recombinant technology known in the art and the activity of the protein can be determined.

The relatedness of amino acid families may also be determined based on side chain interactions. Substituted amino acids may be fully conserved “strong” residues or fully conserved “weak” residues. The “strong” group of conserved amino acid residues may be any one of the following groups: STA, NEQK, NHQK, NDEQ, QHRK, MILV, MILF, HY, FYW, wherein the single letter amino acid codes are grouped by those amino acids that may be substituted for each other. Likewise, the “weak” group of conserved residues may be any one of the following: CSA, ATV, SAG, STNK, STPA, SGND, SNDEQK, NDEQHK, NEQHRK, VLIM, HFY, wherein the letters within each group represent the single letter amino acid code.

In one embodiment, a mutant NOVX protein can be assayed for (i) the ability to form protein:protein interactions with other NOVX proteins, other cell-surface proteins, or biologically-active portions thereof, (ii) complex formation between a mutant NOVX protein and an NOVX ligand; or (iii) the ability of a mutant NOVX protein to bind to an intracellular target protein or biologically-active portion thereof; (e.g. avidin proteins).

In yet another embodiment, a mutant NOVX protein can be assayed for the ability to regulate a specific biological function (e.g., regulation of insulin release).

Antisense Nucleic Acids

Another aspect of the invention pertains to isolated antisense nucleic acid molecules that are hybridizable to or complementary to the nucleic acid molecule comprising the nucleotide sequence of SEQ ID NOS:1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, and 122, or fragments, analogs or derivatives thereof. An “antisense” nucleic acid comprises a nucleotide sequence that is complementary to a “sense” nucleic acid encoding a protein (e.g., complementary to the coding strand of a double-stranded cDNA molecule or complementary to an mRNA sequence). In specific aspects, antisense nucleic acid molecules are provided that comprise a sequence complementary to at least about 10, 25, 50, 100, 250 or 500 nucleotides or an entire NOVX coding strand, or to only a portion thereof. Nucleic acid molecules encoding fragments, homologs, derivatives and analogs of an NOVX protein of SEQ ID NOS:2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, and 123, or antisense nucleic acids complementary to an NOVX nucleic acid sequence of SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, and 122, are additionally provided.

In one embodiment, an antisense nucleic acid molecule is antisense to a “coding region” of the coding strand of a nucleotide sequence encoding an NOVX protein. The term “coding region” refers to the region of the nucleotide sequence comprising codons which are translated into amino acid residues. In another embodiment, the antisense nucleic acid molecule is antisense to a “noncoding region” of the coding strand of a nucleotide sequence encoding the NOVX protein. The term “noncoding region” refers to 5′ and 3′ sequences which flank the coding region that are not translated into amino acids (i.e., also referred to as 5′ and 3′ untranslated regions).

Given the coding strand sequences encoding the NOVX protein disclosed herein, antisense nucleic acids of the invention can be designed according to the rules of Watson and Crick or Hoogsteen base pairing. The antisense nucleic acid molecule can be complementary to the entire coding region of NOVX mRNA, but more preferably is an oligonucleotide that is antisense to only a portion of the coding or noncoding region of NOVX mRNA. For example, the antisense oligonucleotide can be complementary to the region surrounding the translation start site of NOVX mRNA. An antisense oligonucleotide can be, for example, about 5, 10, 15, 20, 25, 30, 35, 40, 45 or 50 nucleotides in length. An antisense nucleic acid of the invention can be constructed using chemical synthesis or enzymatic ligation reactions using procedures known in the art. For example, an antisense nucleic acid (e.g., an antisense oligonucleotide) can be chemically synthesized using naturally-occurring nucleotides or variously modified nucleotides designed to increase the biological stability of the molecules or to increase the physical stability of the duplex formed between the antisense and sense nucleic acids (e.g., phosphorothioate derivatives and acridine substituted nucleotides can be used).

Examples of modified nucleotides that can be used to generate the antisense nucleic acid include: 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxylmethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N-6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N-6-adenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-mannosylqueosine, 5′-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N-6-isopentenyladenine, uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methylester, uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl) uracil, (acp3)w, and 2,6-diaminopurine. Alternatively, the antisense nucleic acid can be produced biologically using an expression vector into which a nucleic acid has been subcloned in an antisense orientation (i.e., RNA transcribed from the inserted nucleic acid will be of an antisense orientation to a target nucleic acid of interest, described further in the following subsection).

The antisense nucleic acid molecules of the invention are typically administered to a subject or generated in situ such that they hybridize with or bind to cellular mRNA and/or genomic DNA encoding an NOVX protein to thereby inhibit expression of the protein (e.g., by inhibiting transcription and/or translation). The hybridization can be by conventional nucleotide complementarity to form a stable duplex, or, for example, in the case of an antisense nucleic acid molecule that binds to DNA duplexes, through specific interactions in the major groove of the double helix. An example of a route of administration of antisense nucleic acid molecules of the invention includes direct injection at a tissue site. Alternatively, antisense nucleic acid molecules can be modified to target selected cells and then administered systemically. For example, for systemic administration, antisense molecules can be modified such that they specifically bind to receptors or antigens expressed on a selected cell surface (e.g., by linking the antisense nucleic acid molecules to peptides or antibodies that bind to cell surface receptors or antigens). The antisense nucleic acid molecules can also be delivered to cells using the vectors described herein. To achieve sufficient nucleic acid molecules, vector constructs in which the antisense nucleic acid molecule is placed under the control of a strong pol II or pol III promoter are preferred.

In yet another embodiment, the antisense nucleic acid molecule of the invention is an α-anomeric nucleic acid molecule. An c-anomeric nucleic acid molecule forms specific double-stranded hybrids with complementary RNA in which, contrary to the usual β-units, the strands run parallel to each other. See, e.g., Gaultier, et al., 1987 . Nucl. Acids Res. 15: 6625–6641. The antisense nucleic acid molecule can also comprise a 2′-o-methylribonucleotide (See, e.g., Inoue, et al. 1987 . Nucl. Acids Res. 15: 6131–6148) or a chimeric RNA-DNA analogue (See, e.g., Inoue, et al., 1987 . FEBS Lett. 215: 327–330).

Ribozymes and PNA Moieties

Nucleic acid modifications include, by way of non-limiting example, modified bases, and nucleic acids whose sugar phosphate backbones are modified or derivatized. These modifications are carried out at least in part to enhance the chemical stability of the modified nucleic acid, such that they may be used, for example, as antisense binding nucleic acids in therapeutic applications in a subject.

In one embodiment, an antisense nucleic acid of the invention is a ribozyme. Ribozymes are catalytic RNA molecules with ribonuclease activity that are capable of cleaving a single-stranded nucleic acid, such as an mRNA, to which they have a complementary region. Thus, ribozymes (e.g., hammerhead ribozymes as described in Haselhoff and Gerlach 1988 . Nature 334: 585–591) can be used to catalytically cleave NOVX mRNA transcripts to thereby inhibit translation of NOVX mRNA. A ribozyme having specificity for an NOVX-encoding nucleic acid can be designed based upon the nucleotide sequence of an NOVX cDNA disclosed herein (i.e., SEQ ID NOS:1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, and 122). For example, a derivative of a Tetrahymena L-19 IVS RNA can be constructed in which the nucleotide sequence of the active site is complementary to the nucleotide sequence to be cleaved in an NOVX-encoding mRNA. See, e.g., U.S. Pat. No. 4,987,071 to Cech, et al. and U.S. Pat. No. 5,116,742 to Cech, et al. NOVX mRNA can also be used to select a catalytic RNA having a specific ribonuclease activity from a pool of RNA molecules. See, e.g., Bartel et al., (1993) Science 261:1411–1418.

Alternatively, NOVX gene expression can be inhibited by targeting nucleotide sequences complementary to the regulatory region of the NOVX nucleic acid (e.g., the NOVX promoter and/or enhancers) to form triple helical structures that prevent transcription of the NOVX gene in target cells. See, e.g., Helene, 1991 . Anticancer Drug Des. 6: 569–84; Helene, et al. 1992 . Ann. N.Y. Acad. Sci. 660: 27–36; Maher, 1992 . Bioassays 14: 807–15.

In various embodiments, the NOVX nucleic acids can be modified at the base moiety, sugar moiety or phosphate backbone to improve, e.g., the stability, hybridization, or solubility of the molecule. For example, the deoxyribose phosphate backbone of the nucleic acids can be modified to generate peptide nucleic acids. See, e.g., Hyrup, et al., 1996 . Bioorg Med Chem 4: 5–23. As used herein, the terms “peptide nucleic acids” or “PNAs” refer to nucleic acid mimics (e.g., DNA mimics) in which the deoxyribose phosphate backbone is replaced by a pseudopeptide backbone and only the four natural nucleobases are retained. The neutral backbone of PNAs has been shown to allow for specific hybridization to DNA and RNA under conditions of low ionic strength. The synthesis of PNA oligomers can be performed using standard solid phase peptide synthesis protocols as described in Hyrup, et al., 1996. supra; Perry-O'Keefe, et al., 1996 . Proc. Natl. Acad. Sci. USA 93: 14670–14675.

PNAs of NOVX can be used in therapeutic and diagnostic applications. For example, PNAs can be used as antisense or antigene agents for sequence-specific modulation of gene expression by, e.g., inducing transcription or translation arrest or inhibiting replication. PNAs of NOVX can also be used, for example, in the analysis of single base pair mutations in a gene (e.g., PNA directed PCR clamping; as artificial restriction enzymes when used in combination with other enzymes, e.g., S 1 nucleases (See, Hyrup, et al., 1996.supra); or as probes or primers for DNA sequence and hybridization (See, Hyrup, et al., 1996, supra; Perry-O'Keefe, et al., 1996. supra).

In another embodiment, PNAs of NOVX can be modified, e.g., to enhance their stability or cellular uptake, by attaching lipophilic or other helper groups to PNA, by the formation of PNA-DNA chimeras, or by the use of liposomes or other techniques of drug delivery known in the art. For example, PNA-DNA chimeras of NOVX can be generated that may combine the advantageous properties of PNA and DNA. Such chimeras allow DNA recognition enzymes (e.g., RNase H and DNA polymerases) to interact with the DNA portion while the PNA portion would provide high binding affinity and specificity. PNA-DNA chimeras can be linked using linkers of appropriate lengths selected in terms of base stacking, number of bonds between the nucleobases, and orientation (see, Hyrup, et al., 1996. supra). The synthesis of PNA-DNA chimeras can be performed as described in Hyrup, et al., 1996. supra and Finn, et al., 1996 . Nucl Acids Res 24: 3357–3363. For example, a DNA chain can be synthesized on a solid support using standard phosphoramidite coupling chemistry, and modified nucleoside analogs, e.g., 5′-(4-methoxytrityl)amino-5′-deoxy-thymidine phosphoramidite, can be used between the PNA and the 5′ end of DNA. See, e.g., Mag, et al., 1989 . Nucl Acid Res 17: 5973–5988. PNA monomers are then coupled in a stepwise manner to produce a chimeric molecule with a 5′ PNA segment and a 3′ DNA segment. See, e.g., Finn, et al., 1996. supra. Alternatively, chimeric molecules can be synthesized with a 5′ DNA segment and a 3′ PNA segment. See, e.g., Petersen, et al., 1975 . Bioorg. Med. Chem. Lett. 5: 1119–11124.

In other embodiments, the oligonucleotide may include other appended groups such as peptides (e.g., for targeting host cell receptors in vivo), or agents facilitating transport across the cell membrane (see, e.g., Letsinger, et al., 1989 . Proc. Natl. Acad. Sci. U.S.A. 86: 6553–6556; Lemaitre, et al., 1987 . Proc. Natl. Acad. Sci. 84: 648–652; PCT Publication No. WO88/09810) or the blood-brain barrier (see, e.g., PCT Publication No. WO 89/10134). In addition, oligonucleotides can be modified with hybridization triggered cleavage agents (see, e.g. Krol, et al., 1988 . BioTechniques 6:958–976) or intercalating agents (see, e.g., Zon, 1988 . Pharm. Res. 5: 539–549). To this end, the oligonucleotide may be conjugated to another molecule, e.g. a peptide, a hybridization triggered cross-linking agent, a transport agent, a hybridization-triggered cleavage agent, and the like.

NOVX Polypeptides

A polypeptide according to the invention includes a polypeptide including the amino acid sequence of NOVX polypeptides whose sequences are provided in SEQ ID NOS:2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, and 123. The invention also includes a mutant or variant protein any of whose residues may be changed from the corresponding residues shown in SEQ ID NOS:2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, and 123 while still encoding a protein that maintains its NOVX activities and physiological functions, or a functional fragment thereof.

In general, an NOVX variant that preserves NOVX-like function includes any variant in which residues at a particular position in the sequence have been substituted by other amino acids, and further include the possibility of inserting an additional residue or residues between two residues of the parent protein as well as the possibility of deleting one or more residues from the parent sequence. Any amino acid substitution, insertion, or deletion is encompassed by the invention. In favorable circumstances, the substitution is a conservative substitution as defined above.

One aspect of the invention pertains to isolated NOVX proteins, and biologically-active portions thereof, or derivatives, fragments, analogs or homologs thereof. Also provided are polypeptide fragments suitable for use as immunogens to raise anti-NOVX antibodies. In one embodiment, native NOVX proteins can be isolated from cells or tissue sources by an appropriate purification scheme using standard protein purification techniques. In another embodiment, NOVX proteins are produced by recombinant DNA techniques. Alternative to recombinant expression, an NOVX protein or polypeptide can be synthesized chemically using standard peptide synthesis techniques.

An “isolated” or “purified” polypeptide or protein or biologically-active portion thereof is substantially free of cellular material or other contaminating proteins from the cell or tissue source from which the NOVX protein is derived, or substantially free from chemical precursors or other chemicals when chemically synthesized. The language “substantially free of cellular material” includes preparations of NOVX proteins in which the protein is separated from cellular components of the cells from which it is isolated or recombinantly-produced. In one embodiment, the language “substantially free of cellular material” includes preparations of NOVX proteins having less than about 30% (by dry weight) of non-NOVX proteins (also referred to herein as a “contaminating protein”), more preferably less than about 20% of non-NOVX proteins, still more preferably less than about 10% of non-NOVX proteins, and most preferably less than about 5% of non-NOVX proteins. When the NOVX protein or biologically-active portion thereof is recombinantly-produced, it is also preferably substantially free of culture medium, i.e., culture medium represents less than about 20%, more preferably less than about 10%, and most preferably less than about 5% of the volume of the NOVX protein preparation.

The language “substantially free of chemical precursors or other chemicals” includes preparations of NOVX proteins in which the protein is separated from chemical precursors or other chemicals that are involved in the synthesis of the protein. In one embodiment, the language “substantially free of chemical precursors or other chemicals” includes preparations of NOVX proteins having less than about 30% (by dry weight) of chemical precursors or non-NOVX chemicals, more preferably less than about 20% chemical precursors or non-NOVX chemicals, still more preferably less than about 10% chemical precursors or non-NOVX chemicals, and most preferably less than about 5% chemical precursors or non-NOVX chemicals.

Biologically-active portions of NOVX proteins include peptides comprising amino acid sequences sufficiently homologous to or derived from the amino acid sequences of the NOVX proteins (e.g., the amino acid sequence shown in SEQ ID NOS:2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, and 123) that include fewer amino acids than the full-length NOVX proteins, and exhibit at least one activity of an NOVX protein. Typically, biologically-active portions comprise a domain or motif with at least one activity of the NOVX protein. A biologically-active portion of an NOVX protein can be a polypeptide which is, for example, 10, 25, 50, 100 or more amino acid residues in length.

Moreover, other biologically-active portions, in which other regions of the protein are deleted, can be prepared by recombinant techniques and evaluated for one or more of the functional activities of a native NOVX protein.

In an embodiment, the NOVX protein has an amino acid sequence shown SEQ ID NOS:2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, and 123. In other embodiments, the NOVX protein is substantially homologous to SEQ ID NOS:2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, and 123, and retains the functional activity of the protein of SEQ ID NOS:2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, and 123, yet differs in amino acid sequence due to natural allelic variation or mutagenesis, as described in detail, below. Accordingly, in another embodiment, the NOVX protein is a protein that comprises an amino acid sequence at least about 45% homologous to the amino acid sequence SEQ ID NOS:2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, and 123, and retains the functional activity of the NOVX proteins of SEQ ID NOS:2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, and 123.

Determining Homology Between Two or More Sequences

To determine the percent homology of two amino acid sequences or of two nucleic acids, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in the sequence of a first amino acid or nucleic acid sequence for optimal alignment with a second amino or nucleic acid sequence). The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are homologous at that position (i.e., as used herein amino acid or nucleic acid “homology” is equivalent to amino acid or nucleic acid “identity”).

The nucleic acid sequence homology may be determined as the degree of identity between two sequences. The homology may be determined using computer programs known in the art, such as GAP software provided in the GCG program package. See, Needleman and Wunsch, 1970 . J Mol Biol 48: 443–453. Using GCG GAP software with the following settings for nucleic acid sequence comparison: GAP creation penalty of 5.0 and GAP extension penalty of 0.3, the coding region of the analogous nucleic acid sequences referred to above exhibits a degree of identity preferably of at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99%, with the CDS (encoding) part of the DNA sequence shown in SEQ ID NOS:1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, and 122. The term “sequence identity” refers to the degree to which two polynucleotide or polypeptide sequences are identical on a residue-by-residue basis over a particular region of comparison. The term “percentage of sequence identity” is calculated by comparing two optimally aligned sequences over that region of comparison, determining the number of positions at which the identical nucleic acid base (e.g. A, T, C, G, U, or I, in the case of nucleic acids) occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the region of comparison (i.e., the window size), and multiplying the result by 100 to yield the percentage of sequence identity.

The term “substantial identity” as used herein denotes a characteristic of a polynucleotide sequence, wherein the polynucleotide comprises a sequence that has at least 80 percent sequence identity, preferably at least 85 percent identity and often 90 to 95 percent sequence identity, more usually at least 99 percent sequence identity as compared to a reference sequence over a comparison region.

Chimeric and Fusion Proteins

The invention also provides NOVX chimeric or fusion proteins. As used herein, an NOVX “chimeric protein” or “fusion protein” comprises an NOVX polypeptide operatively-linked to a non-NOVX polypeptide. An “NOVX polypeptide” refers to a polypeptide having an amino acid sequence corresponding to an NOVX protein SEQ ID NOS:2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, and 123, whereas a “non-NOVX polypeptide” refers to a polypeptide having an amino acid sequence corresponding to a protein that is not substantially homologous to the NOVX protein, e.g., a protein that is different from the NOVX protein and that is derived from the same or a different organism. Within an NOVX fusion protein the NOVX polypeptide can correspond to all or a portion of an NOVX protein. In one embodiment, an NOVX fusion protein comprises at least one biologically-active portion of an NOVX protein. In another embodiment, an NOVX fusion protein comprises at least two biologically-active portions of an NOVX protein. In yet another embodiment, an NOVX fusion protein comprises at least three biologically-active portions of an NOVX protein. Within the fusion protein, the term “operatively-linked” is intended to indicate that the NOVX polypeptide and the non-NOVX polypeptide are fused in-frame with one another. The non-NOVX polypeptide can be fused to the N-terminus or C-terminus of the NOVX polypeptide.

In one embodiment, the fusion protein is a GST-NOVX fusion protein in which the NOVX sequences are fused to the C-terminus of the GST (glutathione S-transferase) sequences. Such fusion proteins can facilitate the purification of recombinant NOVX polypeptides.

In another embodiment, the fusion protein is an NOVX protein containing a heterologous signal sequence at its N-terminus. In certain host cells (e.g., mammalian host cells), expression and/or secretion of NOVX can be increased through use of a heterologous signal sequence.

In yet another embodiment, the fusion protein is an NOVX-immunoglobulin fusion protein in which the NOVX sequences are fused to sequences derived from a member of the immunoglobulin protein family. The NOVX-immunoglobulin fusion proteins of the invention can be incorporated into pharmaceutical compositions and administered to a subject to inhibit an interaction between an NOVX ligand and an NOVX protein on the surface of a cell, to thereby suppress NOVX-mediated signal transduction in vivo. The NOVX-immunoglobulin fusion proteins can be used to affect the bioavailability of an NOVX cognate ligand. Inhibition of the NOVX ligand/NOVX interaction may be useful therapeutically for both the treatment of proliferative and differentiative disorders, as well as modulating (e.g. promoting or inhibiting) cell survival. Moreover, the NOVX-immunoglobulin fusion proteins of the invention can be used as immunogens to produce anti-NOVX antibodies in a subject, to purify NOVX ligands, and in screening assays to identify molecules that inhibit the interaction of NOVX with an NOVX ligand.

An NOVX chimeric or fusion protein of the invention can be produced by standard recombinant DNA techniques. For example, DNA fragments coding for the different polypeptide sequences are ligated together in-frame in accordance with conventional techniques, e.g., by employing blunt-ended or stagger-ended termini for ligation, restriction enzyme digestion to provide for appropriate termini, filling-in of cohesive ends as appropriate, alkaline phosphatase treatment to avoid undesirable joining, and enzymatic ligation. In another embodiment, the fusion gene can be synthesized by conventional techniques including automated DNA synthesizers. Alternatively, PCR amplification of gene fragments can be carried out using anchor primers that give rise to complementary overhangs between two consecutive gene fragments that can subsequently be annealed and reamplified to generate a chimeric gene sequence (see, e.g., Ausubel, et al. (eds.) CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, 1992). Moreover, many expression vectors are commercially available that already encode a fusion moiety (e.g., a GST polypeptide). An NOVX-encoding nucleic acid can be cloned into such an expression vector such that the fusion moiety is linked in-frame to the NOVX protein.

NOVX Agonists and Antagonists

The invention also pertains to variants of the NOVX proteins that function as either NOVX agonists (i.e., mimetics) or as NOVX antagonists. Variants of the NOVX protein can be generated by mutagenesis (e.g., discrete point mutation or truncation of the NOVX protein). An agonist of the NOVX protein can retain substantially the same, or a subset of, the biological activities of the naturally occurring form of the NOVX protein. An antagonist of the NOVX protein can inhibit one or more of the activities of the naturally occurring form of the NOVX protein by, for example, competitively binding to a downstream or upstream member of a cellular signaling cascade which includes the NOVX protein. Thus, specific biological effects can be elicited by treatment with a variant of limited function. In one embodiment, treatment of a subject with a variant having a subset of the biological activities of the naturally occurring form of the protein has fewer side effects in a subject relative to treatment with the naturally occurring form of the NOVX proteins.

Variants of the NOVX proteins that function as either NOVX agonists (i.e., mimetics) or as NOVX antagonists can be identified by screening combinatorial libraries of mutants (e.g., truncation mutants) of the NOVX proteins for NOVX protein agonist or antagonist activity. In one embodiment, a variegated library of NOVX variants is generated by combinatorial mutagenesis at the nucleic acid level and is encoded by a variegated gene library. A variegated library of NOVX variants can be produced by, for example, enzymatically ligating a mixture of synthetic oligonucleotides into gene sequences such that a degenerate set of potential NOVX sequences is expressible as individual polypeptides, or alternatively, as a set of larger fusion proteins (e.g., for phage display) containing the set of NOVX sequences therein. There are a variety of methods which can be used to produce libraries of potential NOVX variants from a degenerate oligonucleotide sequence. Chemical synthesis of a degenerate gene sequence can be performed in an automatic DNA synthesizer, and the synthetic gene then ligated into an appropriate expression vector. Use of a degenerate set of genes allows for the provision, in one mixture, of all of the sequences encoding the desired set of potential NOVX sequences. Methods for synthesizing degenerate oligonucleotides are well-known within the art. See, e.g., Narang, 1983 . Tetrahedron 39: 3; Itakura, et al., 1984 . Annu. Rev. Biochem. 53: 323; Itakura, et al., 1984 . Science 198: 1056; Ike, et al., 1983 . Nucl. Acids Res. 11: 477.

Polypeptide Libraries

In addition, libraries of fragments of the NOVX protein coding sequences can be used to generate a variegated population of NOVX fragments for screening and subsequent selection of variants of an NOVX protein. In one embodiment, a library of coding sequence fragments can be generated by treating a double stranded PCR fragment of an NOVX coding sequence with a nuclease under conditions wherein nicking occurs only about once per molecule, denaturing the double stranded DNA, renaturing the DNA to form double-stranded DNA that can include sense/antisense pairs from different nicked products, removing single stranded portions from reformed duplexes by treatment with S 1 nuclease, and ligating the resulting fragment library into an expression vector. By this method, expression libraries can be derived which encodes N-terminal and internal fragments of various sizes of the NOVX proteins.

Various techniques are known in the art for screening gene products of combinatorial libraries made by point mutations or truncation, and for screening cDNA libraries for gene products having a selected property. Such techniques are adaptable for rapid screening of the gene libraries generated by the combinatorial mutagenesis of NOVX proteins. The most widely used techniques, which are amenable to high throughput analysis, for screening large gene libraries typically include cloning the gene library into replicable expression vectors, transforming appropriate cells with the resulting library of vectors, and expressing the combinatorial genes under conditions in which detection of a desired activity facilitates isolation of the vector encoding the gene whose product was detected. Recursive ensemble mutagenesis (REM), a new technique that enhances the frequency of functional mutants in the libraries, can be used in combination with the screening assays to identify NOVX variants. See, e.g., Arkin and Yourvan, 1992 . Proc. Natl. Acad. Sci. USA 89: 7811–7815; Delgrave, et al., 1993 . Protein Engineering 6:327–331.

Anti-NOVX Antibodies

The term “antibody” as used herein refers to immunoglobulin molecules and immunologically active portions of immunoglobulin (Ig) molecules, i.e., molecules that contain an antigen binding site that specifically binds (immunoreacts with) an antigen. Such antibodies include, but are not limited to, polyclonal, monoclonal, chimeric, single chain, F ab , F ab′ and F (ab′)2 fragments, and an F ab expression library. In general, antibody molecules obtained from humans relates to any of the classes IgG, IgM, IgA, IgE and IgD, which differ from one another by the nature of the heavy chain present in the molecule. Certain classes have subclasses as well, such as IgG 1 , IgG 2 , and others. Furthermore, in humans, the light chain may be a kappa chain or a lambda chain. Reference herein to antibodies includes a reference to all such classes, subclasses and types of human antibody species.

An isolated protein of the invention intended to serve as an antigen, or a portion or fragment thereof, can be used as an immunogen to generate antibodies that immunospecifically bind the antigen, using standard techniques for polyclonal and monoclonal antibody preparation. The full-length protein can be used or, alternatively, the invention provides antigenic peptide fragments of the antigen for use as immunogens. An antigenic peptide fragment comprises at least 6 amino acid residues of the amino acid sequence of the full length protein, such as an amino acid sequence shown in SEQ ID NOS:2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, and 123, and encompasses an epitope thereof such that an antibody raised against the peptide forms a specific immune complex with the full length protein or with any fragment that contains the epitope. Preferably, the antigenic peptide comprises at least 10 amino acid residues, or at least 15 amino acid residues, or at least 20 amino acid residues, or at least 30 amino acid residues. Preferred epitopes encompassed by the antigenic peptide are regions of the protein that are located on its surface; commonly these are hydrophilic regions.

In certain embodiments of the invention, at least one epitope encompassed by the antigenic peptide is a region of SECX that is located on the surface of the protein, e.g., a hydrophilic region. A hydrophobicity analysis of the human SECX protein sequence will indicate which regions of a SECX polypeptide are particularly hydrophilic and, therefore, are likely to encode surface residues useful for targeting antibody production. As a means for targeting antibody production, hydropathy plots showing regions of hydrophilicity and hydrophobicity may be generated by any method well known in the art, including, for example, the Kyte Doolittle or the Hopp Woods methods, either with or without Fourier transformation. See, e.g., Hopp and Woods, 1981 , Proc. Nat. Acad. Sci. USA 78: 3824–3828; Kyte and Doolittle 1982 , J. Mol. Biol. 157: 105–142, each incorporated herein by reference in their entirety. Antibodies that are specific for one or more domains within an antigenic protein, or derivatives, fragments, analogs or homologs thereof, are also provided herein.

A protein of the invention, or a derivative, fragment, analog, homolog or ortholog thereof, may be utilized as an immunogen in the generation of antibodies that immunospecifically bind these protein components.

Various procedures known within the art may be used for the production of polyclonal or monoclonal antibodies directed against a protein of the invention, or against derivatives, fragments, analogs homologs or orthologs thereof (see, for example, Antibodies: A Laboratory Manual, Harlow E, and Lane D, 1988, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., incorporated herein by reference). Some of these antibodies are discussed below.

1. Polyclonal Antibodies

For the production of polyclonal antibodies, various suitable host animals (e.g., rabbit, goat, mouse or other mammal) may be immunized by one or more injections with the native protein, a synthetic variant thereof, or a derivative of the foregoing. An appropriate immunogenic preparation can contain, for example, the naturally occurring immunogenic protein, a chemically synthesized polypeptide representing the immunogenic protein, or a recombinantly expressed immunogenic protein. Furthermore, the protein may be conjugated to a second protein known to be immunogenic in the mammal being immunized. Examples of such immunogenic proteins include but are not limited to keyhole limpet hemocyanin, serum albumin, bovine thyroglobulin, and soybean trypsin inhibitor. The preparation can further include an adjuvant. Various adjuvants used to increase the immunological response include, but are not limited to, Freund's (complete and incomplete), mineral gels (e.g., aluminum hydroxide), surface active substances (e.g., lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, dinitrophenol, etc.), adjuvants usable in humans such as Bacille Calmette-Guerin and Corynebacterium parvum , or similar immunostimulatory agents. Additional examples of adjuvants which can be employed include MPL-TDM adjuvant (monophosphoryl Lipid A, synthetic trehalose dicorynomycolate).

The polyclonal antibody molecules directed against the immunogenic protein can be isolated from the mammal (e.g., from the blood) and further purified by well known techniques, such as affinity chromatography using protein A or protein G, which provide primarily the IgG fraction of immune serum. Subsequently, or alternatively, the specific antigen which is the target of the immunoglobulin sought, or an epitope thereof, may be immobilized on a column to purify the immune specific antibody by immunoaffinity chromatography. Purification of immunoglobulins is discussed, for example, by D. Wilkinson (The Scientist, published by The Scientist, Inc., Philadelphia Pa., Vol. 14, No. 8 (Apr. 17, 2000), pp. 25–28).

2. Monoclonal Antibodies

The term “monoclonal antibody” (MAb) or “monoclonal antibody composition”, as used herein, refers to a population of antibody molecules that contain only one molecular species of antibody molecule consisting of a unique light chain gene product and a unique heavy chain gene product. In particular, the complementarity determining regions (CDRs) of the monoclonal antibody are identical in all the molecules of the population. MAbs thus contain an antigen binding site capable of immunoreacting with a particular epitope of the antigen characterized by a unique binding affinity for it.

Monoclonal antibodies can be prepared using hybridoma methods, such as those described by Kohler and Milstein, Nature, 256:495 (1975). In a hybridoma method, a mouse, hamster, or other appropriate host animal, is typically immunized with an immunizing agent to elicit lymphocytes that produce or are capable of producing antibodies that will specifically bind to the immunizing agent. Alternatively, the lymphocytes can be immunized in vitro.

The immunizing agent will typically include the protein antigen, a fragment thereof or a fusion protein thereof. Generally, either peripheral blood lymphocytes are used if cells of human origin are desired, or spleen cells or lymph node cells are used if non-human mammalian sources are desired. The lymphocytes are then fused with an immortalized cell line using a suitable fusing agent, such as polyethylene glycol, to form a hybridoma cell [Goding, Monoclonal Antibodies: Principles and Practice , Academic Press, (1986) pp. 59–103]. Immortalized cell lines are usually transformed mammalian cells, particularly myeloma cells of rodent, bovine and human origin. Usually, rat or mouse myeloma cell lines are employed. The hybridoma cells can be cultured in a suitable culture medium that preferably contains one or more substances that inhibit the growth or survival of the unfused, immortalized cells. For example, if the parental cells lack the enzyme hypoxanthine guanine phosphoribosyl transferase (HGPRT or HPRT), the culture medium for the hybridomas typically will include hypoxanthine, aminopterin, and thymidine (“HAT medium”), which substances prevent the growth of HGPRT-deficient cells.

Preferred immortalized cell lines are those that fuse efficiently, support stable high level expression of antibody by the selected antibody-producing cells, and are sensitive to a medium such as HAT medium. More preferred immortalized cell lines are murine myeloma lines, which can be obtained, for instance, from the Salk Institute Cell Distribution Center, San Diego, Calif. and the American Type Culture Collection, Manassas, Va. Human myeloma and mouse-human heteromyeloma cell lines also have been described for the production of human monoclonal antibodies [Kozbor, J. Immunol., 133:3001 (1984); Brodeur et al., Monoclonal Antibody Production Techniques and Applications , Marcel Dekker, Inc., New York, (1987) pp. 51–63].

The culture medium in which the hybridoma cells are cultured can then be assayed for the presence of monoclonal antibodies directed against the antigen. Preferably, the binding specificity of monoclonal antibodies produced by the hybridoma cells is determined by immunoprecipitation or by an in vitro binding assay, such as radioimmunoassay (RIA) or enzyme-linked immunoabsorbent assay (ELISA). Such techniques and assays are known in the art. The binding affinity of the monoclonal antibody can, for example, be determined by the Scatchard analysis of Munson and Pollard, Anal. Biochem. 107:220 (1980). It is an objective, especially important in therapeutic applications of monoclonal antibodies, to identify antibodies having a high degree of specificity and a high binding affinity for the target antigen.

After the desired hybridoma cells are identified, the clones can be subcloned by limiting dilution procedures and grown by standard methods (Goding, 1986). Suitable culture media for this purpose include, for example, Dulbecco's Modified Eagle's Medium and RPMI-1640 medium. Alternatively, the hybridoma cells can be grown in vivo as ascites in a mammal.

The monoclonal antibodies secreted by the subclones can be isolated or purified from the culture medium or ascites fluid by conventional immunoglobulin purification procedures such as, for example, protein A-Sepharose, hydroxylapatite chromatography, gel electrophoresis, dialysis, or affinity chromatography.

The monoclonal antibodies can also be made by recombinant DNA methods, such as those described in U.S. Pat. No. 4,816,567. DNA encoding the monoclonal antibodies of the invention can be readily isolated and sequenced using conventional procedures (e.g., by using oligonucleotide probes that are capable of binding specifically to genes encoding the heavy and light chains of murine antibodies). The hybridoma cells of the invention serve as a preferred source of such DNA. Once isolated, the DNA can be placed into expression vectors, which are then transfected into host cells such as simian COS cells, Chinese hamster ovary (CHO) cells, or myeloma cells that do not otherwise produce immunoglobulin protein, to obtain the synthesis of monoclonal antibodies in the recombinant host cells. The DNA also can be modified, for example, by substituting the coding sequence for human heavy and light chain constant domains in place of the homologous murine sequences (U.S. Pat. No. 4,816,567; Morrison, Nature 368 812–13 (1994)) or by covalently joining to the immunoglobulin coding sequence all or part of the coding sequence for a non-immunoglobulin polypeptide. Such a non-immunoglobulin polypeptide can be substituted for the constant domains of an antibody of the invention, or can be substituted for the variable domains of one antigen-combining site of an antibody of the invention to create a chimeric bivalent antibody.

3. Humanized Antibodies

The antibodies directed against the protein antigens of the invention can further comprise humanized antibodies or human antibodies. These antibodies are suitable for administration to humans without engendering an immune response by the human against the administered immunoglobulin. Humanized forms of antibodies are chimeric immunoglobulins, immunoglobulin chains or fragments thereof (such as Fv, Fab, Fab′, F(ab′) 2 or other antigen-binding subsequences of antibodies) that are principally comprised of the sequence of a human immunoglobulin, and contain minimal sequence derived from a non-human immunoglobulin. Humanization can be performed following the method of Winter and co-workers (Jones et al., Nature, 321:522–525(1986); Riechmann et al., Nature, 332:323–327(1988); Verhoeyen et al., Science, 239:1534–1536(1988)), by substituting rodent CDRs or CDR sequences for the corresponding sequences of a human antibody. (See also U.S. Pat. No. 5,225,539.) In some instances, Fv framework residues of the human immunoglobulin are replaced by corresponding non-human residues. Humanized antibodies can also comprise residues which are found neither in the recipient antibody nor in the imported CDR or framework sequences. In general, the humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the CDR regions correspond to those of a non-human immunoglobulin and all or substantially all of the framework regions are those of a human immunoglobulin consensus sequence. The humanized antibody optimally also will comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin (Jones et al., 1986; Riechmann et al., 1988; and Presta, Curr. Op. Struct. Biol., 2:593–596(1992)).

4. Human Antibodies

Fully human antibodies essentially relate to antibody molecules in which the entire sequence of both the light chain and the heavy chain, including the CDRs, arise from human genes. Such antibodies are termed “human antibodies”, or “fully human antibodies” herein. Human monoclonal antibodies can be prepared by the trioma technique; the human B-cell hybridoma technique (see Kozbor, et al., 1983 Immunol Today 4: 72) and the EBV hybridoma technique to produce human monoclonal antibodies (see Cole, et al., 1985 In: M ONOCLONAL A NTIBODIES AND C ANCER T HERAPY , Alan R. Liss, Inc., pp. 77–96). Human monoclonal antibodies may be utilized in the practice of the present invention and may be produced by using human hybridomas (see Cote, et al., 1983. Proc Natl Acad Sci USA 80: 2026–2030) or by transforming human B-cells with Epstein Barr Virus in vitro (see Cole, et al., 1985 In: M ONOCLONAL A NTIBODIES AND C ANCER T HERAPY , Alan R. Liss, Inc., pp. 77–96).

In addition, human antibodies can also be produced using additional techniques, including phage display libraries (Hoogenboom and Winter, J. Mol. Biol., 227:381 (1991); Marks et al., J. Mol. Biol., 222:581 (1991)). Similarly, human antibodies can be made by introducing human immunoglobulin loci into transgenic animals, e.g., mice in which the endogenous immunoglobulin genes have been partially or completely inactivated. Upon challenge, human antibody production is observed, which closely resembles that seen in humans in all respects, including gene rearrangement, assembly, and antibody repertoire. This approach is described, for example, in U.S. Pat. Nos. 5,545,807; 5,545,806; 5,569,825; 5,625,126; 5,633,425; 5,661,016, and in Marks et al. (Bio/Technology 10, 779–783 (1992)); Lonberg et al. ( Nature 368 856–859 (1994)); Morrison ( Nature 368, 812–13 (1994)); Fishwild et al, ( Nature Biotechnology 14, 845–51 (1996)); Neuberger ( Nature Biotechnology 14, 826 (1996)); and Lonberg and Huszar ( Intern. Rev. Immunol. 13 65–93 (1995)).

Human antibodies may additionally be produced using transgenic nonhuman animals which are modified so as to produce fully human antibodies rather than the animal's endogenous antibodies in response to challenge by an antigen. (See PCT publication WO94/02602). The endogenous genes encoding the heavy and light immunoglobulin chains in the nonhuman host have been incapacitated, and active loci encoding human heavy and light chain immunoglobulins are inserted into the host's genome. The human genes are incorporated, for example, using yeast artificial chromosomes containing the requisite human DNA segments. An animal which provides all the desired modifications is then obtained as progeny by crossbreeding intermediate transgenic animals containing fewer than the full complement of the modifications. The preferred embodiment of such a nonhuman animal is a mouse, and is termed the Xenomouse™ as disclosed in PCT publications WO 96/33735 and WO 96/34096. This animal produces B cells which secrete fully human immunoglobulins. The antibodies can be obtained directly from the animal after immunization with an immunogen of interest, as, for example, a preparation of a polyclonal antibody, or alternatively from immortalized B cells derived from the animal, such as hybridomas producing monoclonal antibodies. Additionally, the genes encoding the immunoglobulins with human variable regions can be recovered and expressed to obtain the antibodies directly, or can be further modified to obtain analogs of antibodies such as, for example, single chain Fv molecules.

An example of a method of producing a nonhuman host, exemplified as a mouse, lacking expression of an endogenous immunoglobulin heavy chain is disclosed in U.S. Pat. No. 5,939,598. It can be obtained by a method including deleting the J segment genes from at least one endogenous heavy chain locus in an embryonic stem cell to prevent rearrangement of the locus and to prevent formation of a transcript of a rearranged immunoglobulin heavy chain locus, the deletion being effected by a targeting vector containing a gene encoding a selectable marker; and producing from the embryonic stem cell a transgenic mouse whose somatic and germ cells contain the gene encoding the selectable marker.

A method for producing an antibody of interest, such as a human antibody, is disclosed in U.S. Pat. No. 5,916,771. It includes introducing an expression vector that contains a nucleotide sequence encoding a heavy chain into one mammalian host cell in culture, introducing an expression vector containing a nucleotide sequence encoding a light chain into another mammalian host cell, and fusing the two cells to form a hybrid cell. The hybrid cell expresses an antibody containing the heavy chain and the light chain.

In a further improvement on this procedure, a method for identifying a clinically relevant epitope on an immunogen, and a correlative method for selecting an antibody that binds immunospecifically to the relevant epitope with high affinity, are disclosed in PCT publication WO 99/53049.

5. F ab Fragments and Single Chain Antibodies

According to the invention, techniques can be adapted for the production of single-chain antibodies specific to an antigenic protein of the invention (see e.g., U.S. Pat. No. 4,946,778). In addition, methods can be adapted for the construction of F ab expression libraries (see e.g., Huse, et al., 1989 Science 246: 1275–1281) to allow rapid and effective identification of monoclonal F ab fragments with the desired specificity for a protein or derivatives, fragments, analogs or homologs thereof. Antibody fragments that contain the idiotypes to a protein antigen may be produced by techniques known in the art including, but not limited to: (i) an F (ab′)2 fragment produced by pepsin digestion of an antibody molecule; (ii) an F ab fragment generated by reducing the disulfide bridges of an F (ab′)2 fragment; (iii) an F ab fragment generated by the treatment of the antibody molecule with papain and a reducing agent and (iv) F v fragments.

6. Bispecific Antibodies

Bispecific antibodies are monoclonal, preferably human or humanized, antibodies that have binding specificities for at least two different antigens. In the present case, one of the binding specificities is for an antigenic protein of the invention. The second binding target is any other antigen, and advantageously is a cell-surface protein or receptor or receptor subunit.

Methods for making bispecific antibodies are known in the art. Traditionally, the recombinant production of bispecific antibodies is based on the co-expression of two immunoglobulin heavy-chain/light-chain pairs, where the two heavy chains have different specificities (Milstein and Cuello, Nature, 305:537–539(1983)). Because of the random assortment of immunoglobulin heavy and light chains, these hybridomas (quadromas) produce a potential mixture of ten different antibody molecules, of which only one has the correct bispecific structure. The purification of the correct molecule is usually accomplished by affinity chromatography steps. Similar procedures are disclosed in WO 93/08829, published 13 May 1993, and in Traunecker et al., EMBO J. 10:3655–3659(1991).

Antibody variable domains with the desired binding specificities (antibody-antigen combining sites) can be fused to immunoglobulin constant domain sequences. The fusion preferably is with an immunoglobulin heavy-chain constant domain, comprising at least part of the hinge, CH2, and CH3 regions. It is preferred to have the first heavy-chain constant region (CH1) containing the site necessary for light-chain binding present in at least one of the fusions. DNAs encoding the immunoglobulin heavy-chain fusions and, if desired, the immunoglobulin light chain, are inserted into separate expression vectors, and are co-transfected into a suitable host organism. For further details of generating bispecific antibodies see, for example, Suresh et al., Methods in Enzymology, 121:210 (1986).

According to another approach described in WO 96/27011, the interface between a pair of antibody molecules can be engineered to maximize the percentage of heterodimers which are recovered from recombinant cell culture. The preferred interface comprises at least a part of the CH3 region of an antibody constant domain. In this method, one or more small amino acid side chains from the interface of the first antibody molecule are replaced with larger side chains (e.g. tyrosine or tryptophan). Compensatory “cavities” of identical or similar size to the large side chain(s) are created on the interface of the second antibody molecule by replacing large amino acid side chains with smaller ones (e.g. alanine or threonine). This provides a mechanism for increasing the yield of the heterodimer over other unwanted end-products such as homodimers.

Bispecific antibodies can be prepared as full length antibodies or antibody fragments (e.g. F(ab′) 2 bispecific antibodies). Techniques for generating bispecific antibodies from antibody fragments have been described in the literature. For example, bispecific antibodies can be prepared using chemical linkage. Brennan et al., Science 229:81 (1985) describe a procedure wherein intact antibodies are proteolytically cleaved to generate F(ab′) 2 fragments. These fragments are reduced in the presence of the dithiol complexing agent sodium arsenite to stabilize vicinal dithiols and prevent intermolecular disulfide formation. The Fab′ fragments generated are then converted to thionitrobenzoate (TNB) derivatives. One of the Fab′-TNB derivatives is then reconverted to the Fab′-thiol by reduction with mercaptoethylamine and is mixed with an equimolar amount of the other Fab′-TNB derivative to form the bispecific antibody. The bispecific antibodies produced can be used as agents for the selective immobilization of enzymes.

Additionally, Fab′ fragments can be directly recovered from E. coli and chemically coupled to form bispecific antibodies. Shalaby et al., J. Exp. Med. 175:217–225(1992) describe the production of a fully humanized bispecific antibody F(ab′) 2 molecule. Each Fab′ fragment was separately secreted from E. coli and subjected to directed chemical coupling in vitro to form the bispecific antibody. The bispecific antibody thus formed was able to bind to cells overexpressing the ErbB2 receptor and normal human T cells, as well as trigger the lytic activity of human cytotoxic lymphocytes against human breast tumor targets.

Various techniques for making and isolating bispecific antibody fragments directly from recombinant cell culture have also been described. For example, bispecific antibodies have been produced using leucine zippers. Kostelny et al., J. Immunol. 148(5):1547–1553(1992). The leucine zipper peptides from the Fos and Jun proteins were linked to the Fab′ portions of two different antibodies by gene fusion. The antibody homodimers were reduced at the hinge region to form monomers and then re-oxidized to form the antibody heterodimers. This method can also be utilized for the production of antibody homodimers. The “diabody” technology described by Hollinger et al., Proc. Natl. Acad. Sci. USA 90:6444–6448(1993) has provided an alternative mechanism for making bispecific antibody fragments. The fragments comprise a heavy-chain variable domain (V H ) connected to a light-chain variable domain (V L ) by a linker which is too short to allow pairing between the two domains on the same chain. Accordingly, the V H and V L domains of one fragment are forced to pair with the complementary V L and V H domains of another fragment, thereby forming two antigen-binding sites. Another strategy for making bispecific antibody fragments by the use of single-chain Fv (sFv) dimers has also been reported. See, Gruber et al., J. Immunol. 152:5368 (1994).

Antibodies with more than two valencies are contemplated. For example, trispecific antibodies can be prepared. Tutt et al., J. Immunol. 147:60 (1991).

Exemplary bispecific antibodies can bind to two different epitopes, at least one of which originates in the protein antigen of the invention. Alternatively, an anti-antigenic arm of an immunoglobulin molecule can be combined with an arm which binds to a triggering molecule on a leukocyte such as a T-cell receptor molecule (e.g. CD2, CD3, CD28, or B7), or Fc receptors for IgG (FcγR), such as FcγRI (CD64), FcγII (CD32) and FcγRIII (CD16) so as to focus cellular defense mechanisms to the cell expressing the particular antigen. Bispecific antibodies can also be used to direct cytotoxic agents to cells which express a particular antigen. These antibodies possess an antigen-binding arm and an arm which binds a cytotoxic agent or a radionuclide chelator, such as EOTUBE, DPTA, DOTA, or TETA. Another bispecific antibody of interest binds the protein antigen described herein and further binds tissue factor (TF).

7. Heteroconjugate Antibodies

Heteroconjugate antibodies are also within the scope of the present invention. Heteroconjugate antibodies are composed of two covalently joined antibodies. Such antibodies have, for example, been proposed to target immune system cells to unwanted cells (U.S. Pat. No. 4,676,980), and for treatment of HIV infection (WO 91/00360; WO 92/200373; EP 03089). It is contemplated that the antibodies can be prepared in vitro using known methods in synthetic protein chemistry, including those involving crosslinking agents. For example, immunotoxins can be constructed using a disulfide exchange reaction or by forming a thioether bond. Examples of suitable reagents for this purpose include iminothiolate and methyl-4mercaptobutyrimidate and those disclosed, for example, in U.S. Pat. No. 4,676,980.

8. Effector Function Engineering

It can be desirable to modify the antibody of the invention with respect to effector function, so as to enhance, e.g., the effectiveness of the antibody in treating cancer. For example, cysteine residue(s) can be introduced into the Fc region, thereby allowing interchain disulfide bond formation in this region. The homodimeric antibody thus generated can have improved internalization capability and/or increased complement-mediated cell killing and antibody-dependent cellular cytotoxicity (ADCC). See Caron et al., J. Exp Med., 176: 1191–1195 (1992) and Shopes, J. Immunol., 148: 2918–2922(1992). Homodimeric antibodies with enhanced anti-tumor activity can also be prepared using heterobifunctional cross-linkers as described in Wolff et al. Cancer Research, 53: 2560–2565(1993). Alternatively, an antibody can be engineered that has dual Fc regions and can thereby have enhanced complement lysis and ADCC capabilities. See Stevenson et al., Anti - Cancer Drug Design, 3: 219–230(1989).

9. Immunoconjugates

The invention also pertains to immunoconjugates comprising an antibody conjugated to a cytotoxic agent such as a chemotherapeutic agent, toxin (e.g., an enzymatically active toxin of bacterial, fungal, plant, or animal origin, or fragments thereof), or a radioactive isotope (i.e., a radioconjugate).

Chemotherapeutic agents useful in the generation of such immunoconjugates have been described above. Enzymatically active toxins and fragments thereof that can be used include diphtheria A chain, nonbinding active fragments of diphtheria toxin, exotoxin A chain (from Pseudomonas aeruginosa ), ricin A chain, abrin A chain, modeccin A chain, alpha-sarcin, Aleurites fordii proteins, dianthin proteins, Phytolaca americana proteins (PAPI, PAPII, and PAP-S), momordica charantia inhibitor, curcin, crotin, sapaonaria officinalis inhibitor, gelonin, mitogellin, restrictocin, phenomycin, enomycin, and the tricothecenes. A variety of radionuclides are available for the production of radioconjugated antibodies. Examples include 212 Bi, 131 I, 131 In, 90 Y, and 186 Re.

Conjugates of the antibody and cytotoxic agent are made using a variety of bifunctional protein-coupling agents such as N-succinimidyl-3-(2-pyridyldithiol) propionate (SPDP), iminothiolane (IT), bifunctional derivatives of imidoesters (such as dimethyl adipimidate HCL), active esters (such as disuccinimidyl suberate), aldehydes (such as glutareldehyde), bis-azido compounds (such as bis (p-azidobenzoyl) hexanediamine), bis-diazonium derivatives (such as bis-(p-diazoniumbenzoyl)-ethylenediamine), diisocyanates (such as tolyene 2, 6-diisocyanate), and bis-active fluorine compounds (such as 1, 5-difluoro-2, 4-dinitrobenzene). For example, a ricin immunotoxin can be prepared as described in Vitetta et al., Science, 238: 1098 (1987). Carbon-14-labeled 1-isothiocyanatobenzyl-3-methyldiethylene triaminepentaacetic acid (MX-DTPA) is an exemplary chelating agent for conjugation of radionucleotide to the antibody. See WO94/11026.

In another embodiment, the antibody can be conjugated to a “receptor” (such streptavidin) for utilization in tumor pretargeting wherein the antibody-receptor conjugate is administered to the patient, followed by removal of unbound conjugate from the circulation using a clearing agent and then administration of a “ligand” (e.g., avidin) that is in turn conjugated to a cytotoxic agent.

10. Immunoliposomes

The antibodies disclosed herein can also be formulated as immunoliposomes. Liposomes containing the antibody are prepared by methods known in the art, such as described in Epstein et al., Proc. Natl. Acad. Sci. USA 82: 3688 (1985); Hwang et al., Proc. Natl. Acad. Sci. USA, 77: 4030 (1980); and U.S. Pat. Nos. 4,485,045 and 4,544,545. Liposomes with enhanced circulation time are disclosed in U.S. Pat. No. 5,013,556.

Particularly useful liposomes can be generated by the reverse-phase evaporation method with a lipid composition comprising phosphatidylcholine, cholesterol, and PEG-derivatized phosphatidylethanolamine (PEG-PE). Liposomes are extruded through filters of defined pore size to yield liposomes with the desired diameter. Fab′ fragments of the antibody of the present invention can be conjugated to the liposomes as described in Martin et al., J. Biol. Chem. 257: 286–288 (1982) via a disulfide-interchange reaction. A chemotherapeutic agent (such as Doxorubicin) is optionally contained within the liposome. See Gabizon et al., J. National Cancer Inst., 81(19): 1484 (1989).

11. Diagnostic Applications of Antibodies Directed Against the Proteins of the Invention

Antibodies directed against a protein of the invention may be used in methods known within the art relating to the localization and/or quantitation of the protein (e.g., for use in measuring levels of the protein within appropriate physiological samples, for use in diagnostic methods, for use in imaging the protein, and the like). In a given embodiment, antibodies against the proteins, or derivatives, fragments, analogs or homologs thereof, that contain the antigen binding domain, are utilized as pharmacologically-active compounds (see below).

An antibody specific for a protein of the invention can be used to isolate the protein by standard techniques, such as immunoaffinity chromatography or immunoprecipitation. Such an antibody can facilitate the purification of the natural protein antigen from cells and of recombinantly produced antigen expressed in host cells. Moreover, such an antibody can be used to detect the antigenic protein (e.g., in a cellular lysate or cell supernatant) in order to evaluate the abundance and pattern of expression of the antigenic protein. Antibodies directed against the protein can be used diagnostically to monitor protein levels in tissue as part of a clinical testing procedure, e.g., to, for example, determine the efficacy of a given treatment regimen. Detection can be facilitated by coupling (i.e., physically linking) the antibody to a detectable substance. Examples of detectable substances include various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, and radioactive materials. Examples of suitable enzymes include horseradish peroxidase, alkaline phosphatase, O-galactosidase, or acetylcholinesterase; examples of suitable prosthetic group complexes include streptavidin/biotin and avidin/biotin; examples of suitable fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride or phycoerythrin; an example of a luminescent material includes luminol; examples of bioluminescent materials include luciferase, luciferin, and aequorin, and examples of suitable radioactive material include 125 I, 131 I, 35 S or 3 H.

12. Antibody Therapeutics

Antibodies of the invention, including polyclonal, monoclonal, humanized and fully human antibodies, may used as therapeutic agents. Such agents will generally be employed to treat or prevent a disease or pathology in a subject. An antibody preparation, preferably one having high specificity and high affinity for its target antigen, is administered to the subject and will generally have an effect due to its binding with the target. Such an effect may be one of two kinds, depending on the specific nature of the interaction between the given antibody molecule and the target antigen in question. In the first instance, administration of the antibody may abrogate or inhibit the binding of the target with an endogenous ligand to which it naturally binds. In this case, the antibody binds to the target and masks a binding site of the naturally occurring ligand, wherein the ligand serves as an effector molecule. Thus the receptor mediates a signal transduction pathway for which ligand is responsible.

Alternatively, the effect may be one in which the antibody elicits a physiological result by virtue of binding to an effector binding site on the target molecule. In this case the target, a receptor having an endogenous ligand which may be absent or defective in the disease or pathology, binds the antibody as a surrogate effector ligand, initiating a receptor-based signal transduction event by the receptor.

A therapeutically effective amount of an antibody of the invention relates generally to the amount needed to achieve a therapeutic objective. As noted above, this may be a binding interaction between the antibody and its target antigen that, in certain cases, interferes with the functioning of the target, and in other cases, promotes a physiological response. The amount required to be administered will furthermore depend on the binding affinity of the antibody for its specific antigen, and will also depend on the rate at which an administered antibody is depleted from the free volume other subject to which it is administered. Common ranges for therapeutically effective dosing of an antibody or antibody fragment of the invention may be, by way of nonlimiting example, from about 0.1 mg/kg body weight to about 50 mg/kg body weight. Common dosing frequencies may range, for example, from twice daily to once a week.

13. Pharmaceutical Compositions of Antibodies

Antibodies specifically binding a protein of the invention, as well as other molecules identified by the screening assays disclosed herein, can be administered for the treatment of various disorders in the form of pharmaceutical compositions. Principles and considerations involved in preparing such compositions, as well as guidance in the choice of components are provided, for example, in Remington: The Science And Practice Of Pharmacy 19th ed. (Alfonso R. Gennaro, et al., editors) Mack Pub. Co., Easton, Pa.: 1995; Drug Absorption Enhancement: Concepts, Possibilities, Limitations, And Trends, Harwood Academic Publishers, Langhorne, Pa., 1994; and Peptide And Protein Drug Delivery (Advances In Parenteral Sciences, Vol. 4), 1991, M. Dekker, New York.

If the antigenic protein is intracellular and whole antibodies are used as inhibitors, internalizing antibodies are preferred. However, liposomes can also be used to deliver the antibody, or an antibody fragment, into cells. Where antibody fragments are used, the smallest inhibitory fragment that specifically binds to the binding domain of the target protein is preferred. For example, based upon the variable-region sequences of an antibody, peptide molecules can be designed that retain the ability to bind the target protein sequence. Such peptides can be synthesized chemically and/or produced by recombinant DNA technology. See, e.g., Marasco et al., Proc. Natl. Acad. Sci. USA, 90: 7889–7893 (1993). The formulation herein can also contain more than one active compound as necessary for the particular indication being treated, preferably those with complementary activities that do not adversely affect each other. Alternatively, or in addition, the composition can comprise an agent that enhances its function, such as, for example, a cytotoxic agent, cytokine, chemotherapeutic agent, or growth-inhibitory agent. Such molecules are suitably present in combination in amounts that are effective for the purpose intended.

The active ingredients can also be entrapped in microcapsules prepared, for example, by coacervation techniques or by interfacial polymerization, for example, hydroxymethylcellulose or gelatin-microcapsules and poly-(methylmethacrylate) microcapsules, respectively, in colloidal drug delivery systems (for example, liposomes, albumin microspheres, microemulsions, nanoparticles, and nanocapsules) or in macroemulsions.

The formulations to be used for in vivo administration must be sterile. This is readily accomplished by filtration through sterile filtration membranes.

Sustained-release preparations can be prepared. Suitable examples of sustained-release preparations include semipermeable matrices of solid hydrophobic polymers containing the antibody, which matrices are in the form of shaped articles, e.g., films, or microcapsules. Examples of sustained-release matrices include polyesters, hydrogels (for example, poly(2-hydroxyethyl-methacrylate), or poly(vinylalcohol)), polylactides (U.S. Pat. No. 3,773,919), copolymers of L-glutamic acid and γ ethyl-L-glutamate, non-degradable ethylene-vinyl acetate, degradable lactic acid-glycolic acid copolymers such as the LUPRON DEPOT™ (injectable microspheres composed of lactic acid-glycolic acid copolymer and leuprolide acetate), and poly-D-(−)-3-hydroxybutyric acid. While polymers such as ethylene-vinyl acetate and lactic acid-glycolic acid enable release of molecules for over 100 days, certain hydrogels release proteins for shorter time periods.

ELISA Assay

An agent for detecting an analyte protein is an antibody capable of binding to an analyte protein, preferably an antibody with a detectable label. Antibodies can be polyclonal, or more preferably, monoclonal. An intact antibody, or a fragment thereof (e.g., F ab or F (ab)2 ) can be used. The term “labeled”, with regard to the probe or antibody, is intended to encompass direct labeling of the probe or antibody by coupling (i.e., physically linking) a detectable substance to the probe or antibody, as well as indirect labeling of the probe or antibody by reactivity with another reagent that is directly labeled. Examples of indirect labeling include detection of a primary antibody using a fluorescently-labeled secondary antibody and end-labeling of a DNA probe with biotin such that it can be detected with fluorescently-labeled streptavidin. The term “biological sample” is intended to include tissues, cells and biological fluids isolated from a subject, as well as tissues, cells and fluids present within a subject. Included within the usage of the term “biological sample”, therefore, is blood and a fraction or component of blood including blood serum, blood plasma, or lymph. That is, the detection method of the invention can be used to detect an analyte mRNA, protein, or genomic DNA in a biological sample in vitro as well as in vivo. For example, in vitro techniques for detection of an analyte mRNA include Northern hybridizations and in situ hybridizations. In vitro techniques for detection of an analyte protein include enzyme linked immunosorbent assays (ELISAs), Western blots, immunoprecipitations, and immunofluorescence. In vitro techniques for detection of an analyte genomic DNA include Southern hybridizations. Procedures for conducting immunoassays are described, for example in “ELISA: Theory and Practice: Methods in Molecular Biology”, Vol. 42, J. R. Crowther (Ed.) Human Press, Totowa, N.J., 1995; “Immunoassay”, E. Diamandis and T. Christopoulus, Academic Press, Inc., San Diego, Calif., 1996; and “Practice and Thory of Enzyme Immunoassays”, P. Tijssen, Elsevier Science Publishers, Amsterdam, 1985. Furthermore, in vivo techniques for detection of an analyte protein include introducing into a subject a labeled anti-an analyte protein antibody. For example, the antibody can be labeled with a radioactive marker whose presence and location in a subject can be detected by standard imaging techniques.

NOVX Recombinant Expression Vectors and Host Cells

Another aspect of the invention pertains to vectors, preferably expression vectors, containing a nucleic acid encoding an NOVX protein, or derivatives, fragments, analogs or homologs thereof. As used herein, the term “vector” refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. One type of vector is a “plasmid”, which refers to a circular double stranded DNA loop into which additional DNA segments can be ligated. Another type of vector is a viral vector, wherein additional DNA segments can be ligated into the viral genome. Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other vectors (e.g., non-episomal mammalian vectors) are integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome. Moreover, certain vectors are capable of directing the expression of genes to which they are operatively-linked. Such vectors are referred to herein as “expression vectors”. In general, expression vectors of utility in recombinant DNA techniques are often in the form of plasmids. In the present specification, “plasmid” and “vector” can be used interchangeably as the plasmid is the most commonly used form of vector. However, the invention is intended to include such other forms of expression vectors, such as viral vectors (e.g., replication defective retroviruses, adenoviruses and adeno-associated viruses), which serve equivalent functions.

The recombinant expression vectors of the invention comprise a nucleic acid of the invention in a form suitable for expression of the nucleic acid in a host cell, which means that the recombinant expression vectors include one or more regulatory sequences, selected on the basis of the host cells to be used for expression, that is operatively-linked to the nucleic acid sequence to be expressed. Within a recombinant expression vector, “operably-linked” is intended to mean that the nucleotide sequence of interest is linked to the regulatory sequence(s) in a manner that allows for expression of the nucleotide sequence (e.g., in an in vitro transcription/translation system or in a host cell when the vector is introduced into the host cell).

The term “regulatory sequence” is intended to includes promoters, enhancers and other expression control elements (e.g., polyadenylation signals). Such regulatory sequences are described, for example, in Goeddel, G ENE E XPRESSION T ECHNOLOGY : M ETHODS IN E NZYMOLOGY 185, Academic Press, San Diego, Calif. (1990). Regulatory sequences include those that direct constitutive expression of a nucleotide sequence in many types of host cell and those that direct expression of the nucleotide sequence only in certain host cells (e.g., tissue-specific regulatory sequences). It will be appreciated by those skilled in the art that the design of the expression vector can depend on such factors as the choice of the host cell to be transformed, the level of expression of protein desired, etc. The expression vectors of the invention can be introduced into host cells to thereby produce proteins or peptides, including fusion proteins or peptides, encoded by nucleic acids as described herein (e.g., NOVX proteins, mutant forms of NOVX proteins, fusion proteins, etc.).

The recombinant expression vectors of the invention can be designed for expression of NOVX proteins in prokaryotic or eukaryotic cells. For example, NOVX proteins can be expressed in bacterial cells such as Escherichia coli , insect cells (using baculovirus expression vectors) yeast cells or mammalian cells. Suitable host cells are discussed further in Goeddel, G ENE E XPRESSION T ECHNOLOGY : M ETHODS IN E NZYMOLOGY 185, Academic Press, San Diego, Calif. (1990). Alternatively, the recombinant expression vector can be transcribed and translated in vitro, for example using T7 promoter regulatory sequences and T7 polymerase.

Expression of proteins in prokaryotes is most often carried out in Escherichia coli with vectors containing constitutive or inducible promoters directing the expression of either fusion or non-fusion proteins. Fusion vectors add a number of amino acids to a protein encoded therein, usually to the amino terminus of the recombinant protein. Such fusion vectors typically serve three purposes: (i) to increase expression of recombinant protein; (ii) to increase the solubility of the recombinant protein; and (iii) to aid in the purification of the recombinant protein by acting as a ligand in affinity purification. Often, in fusion expression vectors, a proteolytic cleavage site is introduced at the junction of the fusion moiety and the recombinant protein to enable separation of the recombinant protein from the fusion moiety subsequent to purification of the fusion protein. Such enzymes, and their cognate recognition sequences, include Factor Xa, thrombin and enterokinase. Typical fusion expression vectors include pGEX (Pharmacia Biotech Inc; Smith and Johnson, 1988 . Gene 67: 31–40), pMAL (New England Biolabs, Beverly, Mass.) and pRIT5 (Pharmacia, Piscataway, N.J.) that fuse glutathione S-transferase (GST), maltose E binding protein, or protein A, respectively, to the target recombinant protein.

Examples of suitable inducible non-fusion E. coli expression vectors include pTrc (Amrann et al., (1988) Gene 69:301–315) and pET 11d (Studier et al., G ENE E XPRESSION T ECHNOLOGY : M ETHODS IN E NZYMOLOGY 185, Academic Press, San Diego, Calif. (1990) 60–89).

One strategy to maximize recombinant protein expression in E. coli is to express the protein in a host bacteria with an impaired capacity to proteolytically cleave the recombinant protein. See, e.g., Gottesman, G ENE E XPRESSION T ECHNOLOGY : M ETHODS IN E NZYMOLOGY 185, Academic Press, San Diego, Calif. (1990) 119–128. Another strategy is to alter the nucleic acid sequence of the nucleic acid to be inserted into an expression vector so that the individual codons for each amino acid are those preferentially utilized in E. coli (see, e.g., Wada, et al., 1992 . Nucl. Acids Res. 20: 2111–2118). Such alteration of nucleic acid sequences of the invention can be carried out by standard DNA synthesis techniques.

In another embodiment, the NOVX expression vector is a yeast expression vector. Examples of vectors for expression in yeast Saccharomyces cerivisae include pYepSec1 (Baldari, et al., 1987 . EMBO J. 6: 229–234), pMFa (Kuijan and Herskowitz, 1982 . Cell 30: 933–943), pJRY88 (Schultz et al., 1987 . Gene 54: 113–123), pYES2 (Invitrogen Corporation, San Diego, Calif.), and picZ (InVitrogen Corp, San Diego, Calif.).

Alternatively, NOVX can be expressed in insect cells using baculovirus expression vectors. Baculovirus vectors available for expression of proteins in cultured insect cells (e.g., SF9 cells) include the pAc series (Smith, et al., 1983 . Mol. Cell. Biol. 3: 2156–2165) and the pVL series (Lucklow and Summers, 1989 . Virology 170: 31–39).

In yet another embodiment, a nucleic acid of the invention is expressed in mammalian cells using a mammalian expression vector. Examples of mammalian expression vectors include pCDM8 (Seed, 1987 . Nature 329: 840) and pMT2PC (Kaufman, et al., 1987 . EMBO J. 6: 187–195). When used in mammalian cells, the expression vector's control functions are often provided by viral regulatory elements. For example, commonly used promoters are derived from polyoma, adenovirus 2, cytomegalovirus, and simian virus 40. For other suitable expression systems for both prokaryotic and eukaryotic cells see, e.g., Chapters 16 and 17 of Sambrook, et al., M OLECULAR C LONING : A L ABORATORY M ANUAL. 2nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989.

In another embodiment, the recombinant mammalian expression vector is capable of directing expression of the nucleic acid preferentially in a particular cell type (e.g., tissue-specific regulatory elements are used to express the nucleic acid). Tissue-specific regulatory elements are known in the art. Non-limiting examples of suitable tissue-specific promoters include the albumin promoter (liver-specific; Pinkert, et al., 1987 . Genes Dev. 1: 268–277), lymphoid-specific promoters (Calame and Eaton, 1988 . Adv. Immunol. 43: 235–275), in particular promoters of T cell receptors (Winoto and Baltimore, 1989 . EMBO J. 8: 729–733) and immunoglobulins (Baneiji, et al., 1983 . Cell 33: 729–740; Queen and Baltimore, 1983 . Cell 33: 741–748), neuron-specific promoters (e.g., the neurofilament promoter; Byrne and Ruddle, 1989 . Proc. Natl. Acad. Sci. USA 86: 5473–5477), pancreas-specific promoters (Edlund, et al., 1985 . Science 230: 912–916), and mammary gland-specific promoters (e.g., milk whey promoter; U.S. Pat. No. 4,873,316 and European Application Publication No. 264,166). Developmentally-regulated promoters are also encompassed, e.g., the murine hox promoters (Kessel and Gruss, 1990 . Science 249: 374–379) and the □-fetoprotein promoter (Campes and Tilghman, 1989 . Genes Dev. 3: 537–546).

The invention further provides a recombinant expression vector comprising a DNA molecule of the invention cloned into the expression vector in an antisense orientation. That is, the DNA molecule is operatively-linked to a regulatory sequence in a manner that allows for expression (by transcription of the DNA molecule) of an RNA molecule that is antisense to NOVX mRNA. Regulatory sequences operatively linked to a nucleic acid cloned in the antisense orientation can be chosen that direct the continuous expression of the antisense RNA molecule in a variety of cell types, for instance viral promoters and/or enhancers, or regulatory sequences can be chosen that direct constitutive, tissue specific or cell type specific expression of antisense RNA. The antisense expression vector can be in the form of a recombinant plasmid, phagemid or attenuated virus in which antisense nucleic acids are produced under the control of a high efficiency regulatory region, the activity of which can be determined by the cell type into which the vector is introduced. For a discussion of the regulation of gene expression using antisense genes see, e.g., Weintraub, et al., “Antisense RNA as a molecular tool for genetic analysis,” Reviews - Trends in Genetics, Vol. 1(1) 1986.

Another aspect of the invention pertains to host cells into which a recombinant expression vector of the invention has been introduced. The terms “host cell” and “recombinant host cell” are used interchangeably herein. It is understood that such terms refer not only to the particular subject cell but also to the progeny or potential progeny of such a cell. Because certain modifications may occur in succeeding generations due to either mutation or environmental influences, such progeny may not, in fact, be identical to the parent cell, but are still included within the scope of the term as used herein.

A host cell can be any prokaryotic or eukaryotic cell. For example, NOVX protein can be expressed in bacterial cells such as E. coli , insect cells, yeast or mammalian cells (such as Chinese hamster ovary cells (CHO) or COS cells). Other suitable host cells are known to those skilled in the art.

Vector DNA can be introduced into prokaryotic or eukaryotic cells via conventional transformation or transfection techniques. As used herein, the terms “transformation” and “transfection” are intended to refer to a variety of art-recognized techniques for introducing foreign nucleic acid (e.g., DNA) into a host cell, including calcium phosphate or calcium chloride co-precipitation, DEAE-dextran-mediated transfection, lipofection, or electroporation. Suitable methods for transforming or transfecting host cells can be found in Sambrook, et al. (M OLECULAR C LONING : A L ABORATORY M ANUAL. 2nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989), and other laboratory manuals.

For stable transfection of mammalian cells, it is known that, depending upon the expression vector and transfection technique used, only a small fraction of cells may integrate the foreign DNA into their genome. In order to identify and select these integrants, a gene that encodes a selectable marker (e.g., resistance to antibiotics) is generally introduced into the host cells along with the gene of interest. Various selectable markers include those that confer resistance to drugs, such as G418, hygromycin and methotrexate. Nucleic acid encoding a selectable marker can be introduced into a host cell on the same vector as that encoding NOVX or can be introduced on a separate vector. Cells stably transfected with the introduced nucleic acid can be identified by drug selection (e.g., cells that have incorporated the selectable marker gene will survive, while the other cells die).

A host cell of the invention, such as a prokaryotic or eukaryotic host cell in culture, can be used to produce (i.e., express) NOVX protein. Accordingly, the invention further provides methods for producing NOVX protein using the host cells of the invention. In one embodiment, the method comprises culturing the host cell of invention (into which a recombinant expression vector encoding NOVX protein has been introduced) in a suitable medium such that NOVX protein is produced. In another embodiment, the method further comprises isolating NOVX protein from the medium or the host cell.

Transgenic NOVX Animals

The host cells of the invention can also be used to produce non-human transgenic animals. For example, in one embodiment, a host cell of the invention is a fertilized oocyte or an embryonic stem cell into which NOVX protein-coding sequences have been introduced. Such host cells can then be used to create non-human transgenic animals in which exogenous NOVX sequences have been introduced into their genome or homologous recombinant animals in which endogenous NOVX sequences have been altered. Such animals are useful for studying the function and/or activity of NOVX protein and for identifying and/or evaluating modulators of NOVX protein activity. As used herein, a “transgenic animal” is a non-human animal, preferably a mammal, more preferably a rodent such as a rat or mouse, in which one or more of the cells of the animal includes a transgene. Other examples of transgenic animals include non-human primates, sheep, dogs, cows, goats, chickens, amphibians, etc. A transgene is exogenous DNA that is integrated into the genome of a cell from which a transgenic animal develops and that remains in the genome of the mature animal, thereby directing the expression of an encoded gene product in one or more cell types or tissues of the transgenic animal. As used herein, a “homologous recombinant animal” is a non-human animal, preferably a mammal, more preferably a mouse, in which an endogenous NOVX gene has been altered by homologous recombination between the endogenous gene and an exogenous DNA molecule introduced into a cell of the animal, e.g., an embryonic cell of the animal, prior to development of the animal.

A transgenic animal of the invention can be created by introducing NOVX-encoding nucleic acid into the male pronuclei of a fertilized oocyte (e.g., by microinjection, retroviral infection) and allowing the oocyte to develop in a pseudopregnant female foster animal. The human NOVX cDNA sequences SEQ ID NOS:1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, and 122 can be introduced as a transgene into the genome of a non-human animal. Alternatively, a non-human homologue of the human NOVX gene, such as a mouse NOVX gene, can be isolated based on hybridization to the human NOVX cDNA (described further supra) and used as a transgene. Intronic sequences and polyadenylation signals can also be included in the transgene to increase the efficiency of expression of the transgene. A tissue-specific regulatory sequence(s) can be operably-linked to the NOVX transgene to direct expression of NOVX protein to particular cells. Methods for generating transgenic animals via embryo manipulation and microinjection, particularly animals such as mice, have become conventional in the art and are described, for example, in U.S. Pat. Nos. 4,736,866; 4,870,009; and 4,873,191; and Hogan, 1986. In: M ANIPULATING THE M OUSE E MBRYO , Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. Similar methods are used for production of other transgenic animals. A transgenic founder animal can be identified based upon the presence of the NOVX transgene in its genome and/or expression of NOVX mRNA in tissues or cells of the animals. A transgenic founder animal can then be used to breed additional animals carrying the transgene. Moreover, transgenic animals carrying a transgene-encoding NOVX protein can further be bred to other transgenic animals carrying other transgenes.

To create a homologous recombinant animal, a vector is prepared which contains at least a portion of an NOVX gene into which a deletion, addition or substitution has been introduced to thereby alter, e.g., functionally disrupt, the NOVX gene. The NOVX gene can be a human gene (e.g., the cDNA of SEQ ID NOS:1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, and 122), but more preferably, is a non-human homologue of a human NOVX gene. For example, a mouse homologue of human NOVX gene of SEQ ID NOS:1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, and 122 can be used to construct a homologous recombination vector suitable for altering an endogenous NOVX gene in the mouse genome. In one embodiment, the vector is designed such that, upon homologous recombination, the endogenous NOVX gene is functionally disrupted (i.e., no longer encodes a functional protein; also referred to as a “knock out” vector).

Alternatively, the vector can be designed such that, upon homologous recombination, the endogenous NOVX gene is mutated or otherwise altered but still encodes functional protein (e.g., the upstream regulatory region can be altered to thereby alter the expression of the endogenous NOVX protein). In the homologous recombination vector, the altered portion of the NOVX gene is flanked at its 5′- and 3′-termini by additional nucleic acid of the NOVX gene to allow for homologous recombination to occur between the exogenous NOVX gene carried by the vector and an endogenous NOVX gene in an embryonic stem cell. The additional flanking NOVX nucleic acid is of sufficient length for successful homologous recombination with the endogenous gene. Typically, several kilobases of flanking DNA (both at the 5′- and 3′-termini) are included in the vector. See, e.g., Thomas, et al., 1987 . Cell 51: 503 for a description of homologous recombination vectors. The vector is ten introduced into an embryonic stem cell line (e.g., by electroporation) and cells in which the introduced NOVX gene has homologously-recombined with the endogenous NOVX gene are selected. See, e.g. Li, et al., 1992 . Cell 69: 915.

The selected cells are then injected into a blastocyst of an animal (e.g., a mouse) to form aggregation chimeras. See, e.g., Bradley, 1987. In: T ERATOCARCINOMAS AND E MBRYONIC S TEM C ELLS : A P RACTICAL A PPROACH , Robertson, ed. IRL, Oxford, pp. 113–152. A chimeric embryo can then be implanted into a suitable pseudopregnant female foster animal and the embryo brought to term. Progeny harboring the homologously-recombined DNA in their germ cells can be used to breed animals in which all cells of the animal contain the homologously-recombined DNA by germline transmission of the transgene. Methods for constructing homologous recombination vectors and homologous recombinant animals are described further in Bradley, 1991 . Curr. Opin. Biotechnol. 2: 823–829; PCT International Publication Nos.: WO 90/11354; WO 91/01140; WO 92/0968; and WO 93/04169.

In another embodiment, transgenic non-humans animals can be produced that contain selected systems that allow for regulated expression of the transgene. One example of such a system is the cre/loxP recombinase system of bacteriophage P1. For a description of the cre/loxP recombinase system, See, e.g., Lakso, et al., 1992 . Proc. Natl. Acad. Sci. USA 89: 6232–6236. Another example of a recombinase system is the FLP recombinase system of Saccharomyces cerevisiae . See, O'Gorman, et al., 1991 . Science 251:1351–1355. If a cre/loxP recombinase system is used to regulate expression of the transgene, animals containing transgenes encoding both the Cre recombinase and a selected protein are required. Such animals can be provided through the construction of “double” transgenic animals, e.g., by mating two transgenic animals, one containing a transgene encoding a selected protein and the other containing a transgene encoding a recombinase.

Clones of the non-human transgenic animals described herein can also be produced according to the methods described in Wilmut, et al., 1997 . Nature 385: 810–813. In brief, a cell (e.g., a somatic cell) from the transgenic animal can be isolated and induced to exit the growth cycle and enter G 0 phase. The quiescent cell can then be fused, e.g., through the use of electrical pulses, to an enucleated oocyte from an animal of the same species from which the quiescent cell is isolated. The reconstructed oocyte is then cultured such that it develops to morula or blastocyte and then transferred to pseudopregnant female foster animal. The offspring borne of this female foster animal will be a clone of the animal from which the cell (e.g., the somatic cell) is isolated.

Pharmaceutical Compositions

The NOVX nucleic acid molecules, NOVX proteins, and anti-NOVX antibodies (also referred to herein as “active compounds”) of the invention, and derivatives, fragments, analogs and homologs thereof, can be incorporated into pharmaceutical compositions suitable for administration. Such compositions typically comprise the nucleic acid molecule, protein, or antibody and a pharmaceutically acceptable carrier. As used herein, “pharmaceutically acceptable carrier” is intended to include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration. Suitable carriers are described in the most recent edition of Remington's Pharmaceutical Sciences, a standard reference text in the field, which is incorporated herein by reference. Preferred examples of such carriers or diluents include, but are not limited to, water, saline, finger's solutions, dextrose solution, and 5% human serum albumin. Liposomes and non-aqueous vehicles such as fixed oils may also be used. The use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, use thereof in the compositions is contemplated. Supplementary active compounds can also be incorporated into the compositions.

A pharmaceutical composition of the invention is formulated to be compatible with its intended route of administration. Examples of routes of administration include parenteral, e.g., intravenous, intradermal, subcutaneous, oral (e.g., inhalation), transdermal (i.e., topical), transmucosal, and rectal administration. Solutions or suspensions used for parenteral, intradermal, or subcutaneous application can include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid (EDTA); buffers such as acetates, citrates or phosphates, and agents for the adjustment of tonicity such as sodium chloride or dextrose. The pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. The parenteral preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic.

Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor EL™(BASF, Parsippany, N.J.) or phosphate buffered saline (PBS). In all cases, the composition must be sterile and should be fluid to the extent that easy syringeability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as manitol, sorbitol, sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.

Sterile injectable solutions can be prepared by incorporating the active compound (e.g., an NOVX protein or anti-NOVX antibody) in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle that contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, methods of preparation are vacuum drying and freeze-drying that yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.

Oral compositions generally include an inert diluent or an edible carrier. They can be enclosed in gelatin capsules or compressed into tablets. For the purpose of oral therapeutic administration, the active compound can be incorporated with excipients and used in the form of tablets, troches, or capsules. Oral compositions can also be prepared using a fluid carrier for use as a mouthwash, wherein the compound in the fluid carrier is applied orally and swished and expectorated or swallowed. Pharmaceutically compatible binding agents, and/or adjuvant materials can be included as part of the composition. The tablets, pills, capsules, troches and the like can contain any of the following ingredients, or compounds of a similar nature: a binder such as microcrystalline cellulose, gum tragacanth or gelatin; an excipient such as starch or lactose, a disintegrating agent such as alginic acid, Primogel, or corn starch; a lubricant such as magnesium stearate or Sterotes; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate, or orange flavoring.

For administration by inhalation, the compounds are delivered in the form of an aerosol spray from pressured container or dispenser which contains a suitable propellant, e.g., a gas such as carbon dioxide, or a nebulizer.

Systemic administration can also be by transmucosal or transdermal means. For transmucosal or transdermal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art, and include, for example, for transmucosal administration, detergents, bile salts, and fusidic acid derivatives. Transmucosal administration can be accomplished through the use of nasal sprays or suppositories. For transdermal administration, the active compounds are formulated into ointments, salves, gels, or creams as generally known in the art.

The compounds can also be prepared in the form of suppositories (e.g., with conventional suppository bases such as cocoa butter and other glycerides) or retention enemas for rectal delivery.

In one embodiment, the active compounds are prepared with carriers that will protect the compound against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for preparation of such formulations will be apparent to those skilled in the art. The materials can also be obtained commercially from Alza Corporation and Nova Pharmaceuticals, Inc. Liposomal suspensions (including liposomes targeted to infected cells with monoclonal antibodies to viral antigens) can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Pat. No. 4,522,811.

It is especially advantageous to formulate oral or parenteral compositions in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form as used herein refers to physically discrete units suited as unitary dosages for the subject to be treated; each unit containing a predetermined quantity of active compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier. The specification for the dosage unit forms of the invention are dictated by and directly dependent on the unique characteristics of the active compound and the particular therapeutic effect to be achieved, and the limitations inherent in the art of compounding such an active compound for the treatment of individuals.

The nucleic acid molecules of the invention can be inserted into vectors and used as gene therapy vectors. Gene therapy vectors can be delivered to a subject by, for example, intravenous injection, local administration (see, e.g., U.S. Pat. No. 5,328,470) or by stereotactic injection (see, e.g., Chen, et al., 1994 . Proc. Natl. Acad. Sci. USA 91: 3054–3057). The pharmaceutical preparation of the gene therapy vector can include the gene therapy vector in an acceptable diluent, or can comprise a slow release matrix in which the gene delivery vehicle is imbedded. Alternatively, where the complete gene delivery vector can be produced intact from recombinant cells, e.g., retroviral vectors, the pharmaceutical preparation can include one or more cells that produce the gene delivery system.

The pharmaceutical compositions can be included in a container, pack, or dispenser together with instructions for administration.

Screening and Detection Methods

The isolated nucleic acid molecules of the invention can be used to express NOVX protein (e.g., via a recombinant expression vector in a host cell in gene therapy applications), to detect NOVX mRNA (e.g., in a biological sample) or a genetic lesion in an NOVX gene, and to modulate NOVX activity, as described further, below. In addition, the NOVX proteins can be used to screen drugs or compounds that modulate the NOVX protein activity or expression as well as to treat disorders characterized by insufficient or excessive production of NOVX protein or production of NOVX protein forms that have decreased or aberrant activity compared to NOVX wild-type protein (e.g.; diabetes (regulates insulin release); obesity (binds and transport lipids); metabolic disturbances associated with obesity, the metabolic syndrome X as well as anorexia and wasting disorders associated with chronic diseases and various cancers, and infectious disease (possesses anti-microbial activity) and the various dyslipidemias. In addition, the anti-NOVX antibodies of the invention can be used to detect and isolate NOVX proteins and modulate NOVX activity. In yet a further aspect, the invention can be used in methods to influence appetite, absorption of nutrients and the disposition of metabolic substrates in both a positive and negative fashion.

The invention further pertains to novel agents identified by the screening assays described herein and uses thereof for treatments as described, supra.

Screening Assays

The invention provides a method (also referred to herein as a “screening assay”) for identifying modulators, i.e., candidate or test compounds or agents (e.g., peptides, peptidomimetics, small molecules or other drugs) that bind to NOVX proteins or have a stimulatory or inhibitory effect on, e.g., NOVX protein expression or NOVX protein activity. The invention also includes compounds identified in the screening assays described herein.

In one embodiment, the invention provides assays for screening candidate or test compounds which bind to or modulate the activity of the membrane-bound form of an NOVX protein or polypeptide or biologically-active portion thereof. The test compounds of the invention can be obtained using any of the numerous approaches in combinatorial library methods known in the art, including: biological libraries; spatially addressable parallel solid phase or solution phase libraries; synthetic library methods requiring deconvolution; the “one-bead one-compound” library method; and synthetic library methods using affinity chromatography selection. The biological library approach is limited to peptide libraries, while the other four approaches are applicable to peptide, non-peptide oligomer or small molecule libraries of compounds. See, e.g., Lam, 1997 . Anticancer Drug Design 12: 145.

A “small molecule” as used herein, is meant to refer to a composition that has a molecular weight of less than about 5 kD and most preferably less than about 4 kD. Small molecules can be, e.g., nucleic acids, peptides, polypeptides, peptidomimetics, carbohydrates, lipids or other organic or inorganic molecules. Libraries of chemical and/or biological mixtures, such as fungal, bacterial, or algal extracts, are known in the art and can be screened with any of the assays of the invention.

Examples of methods for the synthesis of molecular libraries can be found in the art, for example in: DeWitt, et al., 1993 . Proc. Natl. Acad. Sci. U.S.A. 90: 6909; Erb, et al., 1994 . Proc. Natl. Acad. Sci. U.S.A. 91: 11422; Zuckermann, et al., 1994 . J. Med. Chem. 37: 2678; Cho, et al., 1993 . Science 261: 1303; Carrell, et al., 1994 . Angew. Chem. Int. Ed. Engl. 33: 2059; Carell, et al., 1994 . Angew. Chem. Int. Ed. Engl. 33: 2061; and Gallop, et al., 1994 . J. Med. Chem. 37: 1233.

Libraries of compounds may be presented in solution (e.g., Houghten, 1992 . Biotechniques 13: 412–421), or on beads (Lam, 1991 . Nature 354: 82–84), on chips (Fodor, 1993 . Nature 364: 555–556), bacteria (Ladner, U.S. Pat. No. 5,223,409), spores (Ladner, U.S. Pat. No. 5,233,409), plasmids (Cull, et al., 1992 . Proc. Natl. Acad. Sci. USA 89: 1865–1869) or on phage (Scott and Smith, 1990 . Science 249: 386–390; Devlin, 1990 . Science 249: 404–406; Cwirla, et al., 1990 . Proc. Natl. Acad. Sci. U.S.A. 87: 6378–6382; Felici, 1991 . J. Mol. Biol. 222: 301–310; Ladner, U.S. Pat. No. 5,233,409.).

In one embodiment, an assay is a cell-based assay in which a cell which expresses a membrane-bound form of NOVX protein, or a biologically-active portion thereof, on the cell surface is contacted with a test compound and the ability of the test compound to bind to an NOVX protein determined. The cell, for example, can of mammalian origin or a yeast cell. Determining the ability of the test compound to bind to the NOVX protein can be accomplished, for example, by coupling the test compound with a radioisotope or enzymatic label such that binding of the test compound to the NOVX protein or biologically-active portion thereof can be determined by detecting the labeled compound in a complex. For example, test compounds can be labeled with 125 I, 35 S, 14 C, or 3 H, either directly or indirectly, and the radioisotope detected by direct counting of radioemission or by scintillation counting. Alternatively, test compounds can be enzymatically-labeled with, for example, horseradish peroxidase, alkaline phosphatase, or luciferase, and the enzymatic label detected by determination of conversion of an appropriate substrate to product. In one embodiment, the assay comprises contacting a cell which expresses a membrane-bound form of NOVX protein, or a biologically-active portion thereof, on the cell surface with a known compound which binds NOVX to form an assay mixture, contacting the assay mixture with a test compound, and determining the ability of the test compound to interact with an NOVX protein, wherein determining the ability of the test compound to interact with an NOVX protein comprises determining the ability of the test compound to preferentially bind to NOVX protein or a biologically-active portion thereof as compared to the known compound.

In another embodiment, an assay is a cell-based assay comprising contacting a cell expressing a membrane-bound form of NOVX protein, or a biologically-active portion thereof, on the cell surface with a test compound and determining the ability of the test compound to modulate (e.g., stimulate or inhibit) the activity of the NOVX protein or biologically-active portion thereof. Determining the ability of the test compound to modulate the activity of NOVX or a biologically-active portion thereof can be accomplished, for example, by determining the ability of the NOVX protein to bind to or interact with an NOVX target molecule. As used herein, a “target molecule” is a molecule with which an NOVX protein binds or interacts in nature, for example, a molecule on the surface of a cell which expresses an NOVX interacting protein, a molecule on the surface of a second cell, a molecule in the extracellular milieu, a molecule associated with the internal surface of a cell membrane or a cytoplasmic molecule. An NOVX target molecule can be a non-NOVX molecule or an NOVX protein or polypeptide of the invention. In one embodiment, an NOVX target molecule is a component of a signal transduction pathway that facilitates transduction of an extracellular signal (e.g. a signal generated by binding of a compound to a membrane-bound NOVX molecule) through the cell membrane and into the cell. The target, for example, can be a second intercellular protein that has catalytic activity or a protein that facilitates the association of downstream signaling molecules with NOVX.

Determining the ability of the NOVX protein to bind to or interact with an NOVX target molecule can be accomplished by one of the methods described above for determining direct binding. In one embodiment, determining the ability of the NOVX protein to bind to or interact with an NOVX target molecule can be accomplished by determining the activity of the target molecule. For example, the activity of the target molecule can be determined by detecting induction of a cellular second messenger of the target (i.e. intracellular Ca 2 +, diacylglycerol, IP 3 , etc.), detecting catalytic/enzymatic activity of the target an appropriate substrate, detecting the induction of a reporter gene (comprising an NOVX-responsive regulatory element operatively linked to a nucleic acid encoding a detectable marker, e.g., luciferase), or detecting a cellular response, for example, cell survival, cellular differentiation, or cell proliferation.

In yet another embodiment, an assay of the invention is a cell-free assay comprising contacting an NOVX protein or biologically-active portion thereof with a test compound and determining the ability of the test compound to bind to the NOVX protein or biologically-active portion thereof. Binding of the test compound to the NOVX protein can be determined either directly or indirectly as described above. In one such embodiment, the assay comprises contacting the NOVX protein or biologically-active portion thereof with a known compound which binds NOVX to form an assay mixture, contacting the assay mixture with a test compound, and determining the ability of the test compound to interact with an NOVX protein, wherein determining the ability of the test compound to interact with an NOVX protein comprises determining the ability of the test compound to preferentially bind to NOVX or biologically-active portion thereof as compared to the known compound.

In still another embodiment, an assay is a cell-free assay comprising contacting NOVX protein or biologically-active portion thereof with a test compound and determining the ability of the test compound to modulate (e.g. stimulate or inhibit) the activity of the NOVX protein or biologically-active portion thereof. Determining the ability of the test compound to modulate the activity of NOVX can be accomplished, for example, by determining the ability of the NOVX protein to bind to an NOVX target molecule by one of the methods described above for determining direct binding. In an alternative embodiment, determining the ability of the test compound to modulate the activity of NOVX protein can be accomplished by determining the ability of the NOVX protein further modulate an NOVX target molecule. For example, the catalytic/enzymatic activity of the target molecule on an appropriate substrate can be determined as described, supra.

In yet another embodiment, the cell-free assay comprises contacting the NOVX protein or biologically-active portion thereof with a known compound which binds NOVX protein to form an assay mixture, contacting the assay mixture with a test compound, and determining the ability of the test compound to interact with an NOVX protein, wherein determining the ability of the test compound to interact with an NOVX protein comprises determining the ability of the NOVX protein to preferentially bind to or modulate the activity of an NOVX target molecule.

The cell-free assays of the invention are amenable to use of both the soluble form or the membrane-bound form of NOVX protein. In the case of cell-free assays comprising the membrane-bound form of NOVX protein, it may be desirable to utilize a solubilizing agent such that the membrane-bound form of NOVX protein is maintained in solution. Examples of such solubilizing agents include non-ionic detergents such as n-octylglucoside, n-dodecylglucoside, n-dodecylmaltoside, octanoyl-N-methylglucamide, decanoyl-N-methylglucamide, Triton® X-100, Triton® X-114, Thesit®, Isotridecypoly(ethylene glycol ether) n , N-dodecyl-N,N-dimethyl-3-ammonio-1-propane sulfonate, 3-(3-cholamidopropyl) dimethylamminiol-1-propane sulfonate (CHAPS), or 3-(3-cholamidopropyl)dimethylamminiol-2-hydroxy-1-propane sulfonate (CHAPSO).

In more than one embodiment of the above assay methods of the invention, it may be desirable to immobilize either NOVX protein or its target molecule to facilitate separation of complexed from uncomplexed forms of one or both of the proteins, as well as to accommodate automation of the assay. Binding of a test compound to NOVX protein, or interaction of NOVX protein with a target molecule in the presence and absence of a candidate compound, can be accomplished in any vessel suitable for containing the reactants. Examples of such vessels include microtiter plates, test tubes, and micro-centrifuge tubes. In one embodiment, a fusion protein can be provided that adds a domain that allows one or both of the proteins to be bound to a matrix. For example, GST-NOVX fusion proteins or GST-target fusion proteins can be adsorbed onto glutathione sepharose beads (Sigma Chemical, St. Louis, Mo.) or glutathione derivatized microtiter plates, that are then combined with the test compound or the test compound and either the non-adsorbed target protein or NOVX protein, and the mixture is incubated under conditions conducive to complex formation (e.g., at physiological conditions for salt and pH). Following incubation, the beads or microtiter plate wells are washed to remove any unbound components, the matrix immobilized in the case of beads, complex determined either directly or indirectly, for example, as described, supra. Alternatively, the complexes can be dissociated from the matrix, and the level of NOVX protein binding or activity determined using standard techniques.

Other techniques for immobilizing proteins on matrices can also be used in the screening assays of the invention. For example, either the NOVX protein or its target molecule can be immobilized utilizing conjugation of biotin and streptavidin. Biotinylated NOVX protein or target molecules can be prepared from biotin-NHS (N-hydroxy-succinimide) using techniques well-known within the art (e.g., biotinylation kit, Pierce Chemicals, Rockford, Ill.), and immobilized in the wells of streptavidin-coated 96 well plates (Pierce Chemical). Alternatively, antibodies reactive with NOVX protein or target molecules, but which do not interfere with binding of the NOVX protein to its target molecule, can be derivatized to the wells of the plate, and unbound target or NOVX protein trapped in the wells by antibody conjugation. Methods for detecting such complexes, in addition to those described above for the GST-immobilized complexes, include immunodetection of complexes using antibodies reactive with the NOVX protein or target molecule, as well as enzyme-linked assays that rely on detecting an enzymatic activity associated with the NOVX protein or target molecule.

In another embodiment, modulators of NOVX protein expression are identified in a method wherein a cell is contacted with a candidate compound and the expression of NOVX mRNA or protein in the cell is determined. The level of expression of NOVX mRNA or protein in the presence of the candidate compound is compared to the level of expression of NOVX mRNA or protein in the absence of the candidate compound. The candidate compound can then be identified as a modulator of NOVX mRNA or protein expression based upon this comparison. For example, when expression of NOVX mRNA or protein is greater (i.e., statistically significantly greater) in the presence of the candidate compound than in its absence, the candidate compound is identified as a stimulator of NOVX mRNA or protein expression. Alternatively, when expression of NOVX mRNA or protein is less (statistically significantly less) in the presence of the candidate compound than in its absence, the candidate compound is identified as an inhibitor of NOVX mRNA or protein expression. The level of NOVX mRNA or protein expression in the cells can be determined by methods described herein for detecting NOVX mRNA or protein.

In yet another aspect of the invention, the NOVX proteins can be used as “bait proteins” in a two-hybrid assay or three hybrid assay (see, e.g., U.S. Pat. No. 5,283,317; Zervos, et al., 1993 . Cell 72: 223–232; Madura, et al., 1993 . J. Biol. Chem. 268: 12046–12054; Bartel, et al., 1993 . Biotechniques 14: 920–924; Iwabuchi, et al., 1993 . Oncogene 8: 1693–1696; and Brent WO 94/10300), to identify other proteins that bind to or interact with NOVX (“NOVX-binding proteins” or “NOVX-bp”) and modulate NOVX activity. Such NOVX-binding proteins are also likely to be involved in the propagation of signals by the NOVX proteins as, for example, upstream or downstream elements of the NOVX pathway.

The two-hybrid system is based on the modular nature of most transcription factors, which consist of separable DNA-binding and activation domains. Briefly, the assay utilizes two different DNA constructs. In one construct, the gene that codes for NOVX is fused to a gene encoding the DNA binding domain of a known transcription factor (e.g., GAL-4). In the other construct, a DNA sequence, from a library of DNA sequences, that encodes an unidentified protein (“prey” or “sample”) is fused to a gene that codes for the activation domain of the known transcription factor. If the “bait” and the “prey” proteins are able to interact, in vivo, forming an NOVX-dependent complex, the DNA-binding and activation domains of the transcription factor are brought into close proximity. This proximity allows transcription of a reporter gene (e.g., LacZ) that is operably linked to a transcriptional regulatory site responsive to the transcription factor. Expression of the reporter gene can be detected and cell colonies containing the functional transcription factor can be isolated and used to obtain the cloned gene that encodes the protein which interacts with NOVX.

The invention further pertains to novel agents identified by the aforementioned screening assays and uses thereof for treatments as described herein.

Detection Assays

Portions or fragments of the cDNA sequences identified herein (and the corresponding complete gene sequences) can be used in numerous ways as polynucleotide reagents. By way of example, and not of limitation, these sequences can be used to: (i) map their respective genes on a chromosome; and, thus, locate gene regions associated with genetic disease; (ii) identify an individual from a minute biological sample (tissue typing); and (iii) aid in forensic identification of a biological sample. Some of these applications are described in the subsections, below.

Chromosome Mapping

Once the sequence (or a portion of the sequence) of a gene has been isolated, this sequence can be used to map the location of the gene on a chromosome. This process is called chromosome mapping. Accordingly, portions or fragments of the NOVX sequences, SEQ ID NOS:1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, and 122, or fragments or derivatives thereof, can be used to map the location of the NOVX genes, respectively, on a chromosome. The mapping of the NOVX sequences to chromosomes is an important first step in correlating these sequences with genes associated with disease.

Briefly, NOVX genes can be mapped to chromosomes by preparing PCR primers (preferably 15–25 bp in length) from the NOVX sequences. Computer analysis of the NOVX, sequences can be used to rapidly select primers that do not span more than one exon in the genomic DNA, thus complicating the amplification process. These primers can then be used for PCR screening of somatic cell hybrids containing individual human chromosomes. Only those hybrids containing the human gene corresponding to the NOVX sequences will yield an amplified fragment.

Somatic cell hybrids are prepared by fusing somatic cells from different mammals (e.g., human and mouse cells). As hybrids of human and mouse cells grow and divide, they gradually lose human chromosomes in random order, but retain the mouse chromosomes. By using media in which mouse cells cannot grow, because they lack a particular enzyme, but in which human cells can, the one human chromosome that contains the gene encoding the needed enzyme will be retained. By using various media, panels of hybrid cell lines can be established. Each cell line in a panel contains either a single human chromosome or a small number of human chromosomes, and a full set of mouse chromosomes, allowing easy mapping of individual genes to specific human chromosomes. See, e.g., D'Eustachio, et al., 1983 . Science 220: 919–924. Somatic cell hybrids containing only fragments of human chromosomes can also be produced by using human chromosomes with translocations and deletions.

PCR mapping of somatic cell hybrids is a rapid procedure for assigning a particular sequence to a particular chromosome. Three or more sequences can be assigned per day using a single thermal cycler. Using the NOVX sequences to design oligonucleotide primers, sub-localization can be achieved with panels of fragments from specific chromosomes.

Fluorescence in situ hybridization (FISH) of a DNA sequence to a metaphase chromosomal spread can further be used to provide a precise chromosomal location in one step. Chromosome spreads can be made using cells whose division has been blocked in metaphase by a chemical like colcemid that disrupts the mitotic spindle. The chromosomes can be treated briefly with trypsin, and then stained with Giemsa. A pattern of light and dark bands develops on each chromosome, so that the chromosomes can be identified individually. The FISH technique can be used with a DNA sequence as short as 500 or 600 bases. However, clones larger than 1,000 bases have a higher likelihood of binding to a unique chromosomal location with sufficient signal intensity for simple detection. Preferably 1,000 bases, and more preferably 2,000 bases, will suffice to get good results at a reasonable amount of time. For a review of this technique, see, Verma, et al., H UMAN C HROMOSOMES : A M ANUAL OF B ASIC T ECHNIQUES (Pergamon Press, New York 1988).

Reagents for chromosome mapping can be used individually to mark a single chromosome or a single site on that chromosome, or panels of reagents can be used for marking multiple sites and/or multiple chromosomes. Reagents corresponding to noncoding regions of the genes actually are preferred for mapping purposes. Coding sequences are more likely to be conserved within gene families, thus increasing the chance of cross hybridizations during chromosomal mapping.

Once a sequence has been mapped to a precise chromosomal location, the physical position of the sequence on the chromosome can be correlated with genetic map data. Such data are found, e.g., in McKusick, M ENDELIAN I NHERITANCE IN M AN , available on-line through Johns Hopkins University Welch Medical Library). The relationship between genes and disease, mapped to the same chromosomal region, can then be identified through linkage analysis (co-inheritance of physically adjacent genes), described in, e.g., Egeland, et al., 1987 . Nature, 325: 783–787.

Moreover, differences in the DNA sequences between individuals affected and unaffected with a disease associated with the NOVX gene, can be determined. If a mutation is observed in some or all of the affected individuals but not in any unaffected individuals, then the mutation is likely to be the causative agent of the particular disease. Comparison of affected and unaffected individuals generally involves first looking for structural alterations in the chromosomes, such as deletions or translocations that are visible from chromosome spreads or detectable using PCR based on that DNA sequence. Ultimately, complete sequencing of genes from several individuals can be performed to confirm the presence of a mutation and to distinguish mutations from polymorphisms.

Tissue Typing

The NOVX sequences of the invention can also be used to identify individuals from minute biological samples. In this technique, an individual's genomic DNA is digested with one or more restriction enzymes, and probed on a Southern blot to yield unique bands for identification. The sequences of the invention are useful as additional DNA markers for RFLP (“restriction fragment length polymorphisms,” described in U.S. Pat. No. 5,272,057).

Furthermore, the sequences of the invention can be used to provide an alternative technique that determines the actual base-by-base DNA sequence of selected portions of an individual's genome. Thus, the NOVX sequences described herein can be used to prepare two PCR primers from the 5′- and 3′-termini of the sequences. These primers can then be used to amplify an individual's DNA and subsequently sequence it.

Panels of corresponding DNA sequences from individuals, prepared in this manner, can provide unique individual identifications, as each individual will have a unique set of such DNA sequences due to allelic differences. The sequences of the invention can be used to obtain such identification sequences from individuals and from tissue. The NOVX sequences of the invention uniquely represent portions of the human genome. Allelic variation occurs to some degree in the coding regions of these sequences, and to a greater degree in the noncoding regions. It is estimated that allelic variation between individual humans occurs with a frequency of about once per each 500 bases. Much of the allelic variation is due to single nucleotide polymorphisms (SNPs), which include restriction fragment length polymorphisms (RFLPs).

Each of the sequences described herein can, to some degree, be used as a standard against which DNA from an individual can be compared for identification purposes. Because greater numbers of polymorphisms occur in the noncoding regions, fewer sequences are necessary to differentiate individuals. The noncoding sequences can comfortably provide positive individual identification with a panel of perhaps 10 to 1,000 primers that each yield a noncoding amplified sequence of 100 bases. If predicted coding sequences, such as those in SEQ ID NOS:1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, and 122 are used, a more appropriate number of primers for positive individual identification would be 500–2,000.

Predictive Medicine

The invention also pertains to the field of predictive medicine in which diagnostic assays, prognostic assays, pharmacogenomics, and monitoring clinical trials are used for prognostic (predictive) purposes to thereby treat an individual prophylactically. Accordingly, one aspect of the invention relates to diagnostic assays for determining NOVX protein and/or nucleic acid expression as well as NOVX activity, in the context of a biological sample (e.g., blood, serum, cells, tissue) to thereby determine whether an individual is afflicted with a disease or disorder, or is at risk of developing a disorder, associated with aberrant NOVX expression or activity. The disorders include metabolic disorders, diabetes, obesity, infectious disease, anorexia, cancer-associated cachexia, cancer, neurodegenerative disorders, Alzheimer's Disease, Parkinson's Disorder, immune disorders, and hematopoietic disorders, and the various dyslipidemias, metabolic disturbances associated with obesity, the metabolic syndrome X and wasting disorders associated with chronic diseases and various cancers. The invention also provides for prognostic (or predictive) assays for determining whether an individual is at risk of developing a disorder associated with NOVX protein, nucleic acid expression or activity. For example, mutations in an NOVX gene can be assayed in a biological sample. Such assays can be used for prognostic or predictive purpose to thereby prophylactically treat an individual prior to the onset of a disorder characterized by or associated with NOVX protein, nucleic acid expression, or biological activity.

Another aspect of the invention provides methods for determining NOVX protein, nucleic acid expression or activity in an individual to thereby select appropriate therapeutic or prophylactic agents for that individual (referred to herein as “pharmacogenomics”). Pharmacogenomics allows for the selection of agents (e.g., drugs) for therapeutic or prophylactic treatment of an individual based on the genotype of the individual (e.g., the genotype of the individual examined to determine the ability of the individual to respond to a particular agent.)

Yet another aspect of the invention pertains to monitoring the influence of agents (e.g., drugs, compounds) on the expression or activity of NOVX in clinical trials.

These and other agents are described in further detail in the following sections.

Diagnostic Assays

An exemplary method for detecting the presence or absence of NOVX in a biological sample involves obtaining a biological sample from a test subject and contacting the biological sample with a compound or an agent capable of detecting NOVX protein or nucleic acid (e.g., mRNA, genomic DNA) that encodes NOVX protein such that the presence of NOVX is detected in the biological sample. An agent for detecting NOVX mRNA or genomic DNA is a labeled nucleic acid probe capable of hybridizing to NOVX mRNA or genomic DNA. The nucleic acid probe can be, for example, a full-length NOVX nucleic acid, such as the nucleic acid of SEQ ID NOS:1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, and 37, or a portion thereof, such as an oligonucleotide of at least 15, 30, 50, 100, 250 or 500 nucleotides in length and sufficient to specifically hybridize under stringent conditions to NOVX mRNA or genomic DNA. Other suitable probes for use in the diagnostic assays of the invention are described herein.

An agent for detecting NOVX protein is an antibody capable of binding to NOVX protein, preferably an antibody with a detectable label. Antibodies can be polyclonal, or more preferably, monoclonal. An intact antibody, or a fragment thereof (e.g., Fab or F(ab′) 2 ) can be used. The term “labeled”, with regard to the probe or antibody, is intend