Osteoprotegerin

This is a continuation-in-part application of U.S. Ser. No. 08/577,788 filed Dec. 22, 1995 pending.

The invention relates generally to polypeptides involved in the regulation of bone metabolism. More particularly, the invention relates to a novel polypeptide, termed osteoprotegerin, which is a member of the tumor necrosis factor receptor superfamily. The polypeptide is used to treat bone diseases characterized by increased bone loss such as osteoporosis.

Polypeptide growth factors and cytokines are secreted factors which signal a wide variety of changes in cell growth, differentiation, and metabolism, by specifically binding to discrete, surface bound receptors. As a class of proteins, receptors vary in their structure and mode of signal transduction. They are characterized by having an extracellular domain that is involved in ligand binding, and cytoplasmic domain which transmits an appropriate intracellular signal. Receptor expression patterns ultimately determine which cells will respond to a given ligand, while the structure of a given receptor dictates the cellular response induced by ligand binding. Receptors have been shown to transmit intracellular signals via their cytoplasmic domains by activating protein tyrosine, or protein serine/threonine phosphorylation (e.g., platelet derived growth factor receptor (PDGFR) or transforming growth factor-β receptor-I (TGFβR-I), by stimulating G-protein activation (e.g., β-adrenergic receptor), and by modulating associations with cytoplasmic signal transducing proteins (e.g., TNFR-1 and Fas/APO) (Heldin, Cell 80, 213-223 (1995)).

The tumor necrosis factor receptor (TNFR) superfamily is a group of type I transmembrane proteins which share a conserved cysteine-rich motif which is repeated three to six times in the extracellular domain (Smith, et al. Cell 76, 953-962 (1994)). Collectively, these repeat units form the ligand binding domains of these receptors (Chen et al., Chemistry 270, 2874-2878 (1995)). The ligands for these receptors are a structurally related group of proteins homologous to TNFα. (Goeddel et al. Cold Spring Harbor Symp. Quart. Biol. 51, 597-609 (1986); Nagata et al. Science 267, 1449-1456 (1995)). TNFα binds to distinct, but closely related receptors, TNFR-1 and TNFR-2. TNFα produces a variety of biological responses in receptor bearing cells, including, proliferation, differentiation, and cytotoxicity and apoptosis (Beutler et al. Ann. Rev. Biochem. 57, 505-518 (1988)).

TNFα is believed to mediate acute and chronic inflammatory responses (Beutler et al. Ann. Rev. Biochem. 57, 505-508 (1988)). Systemic delivery of TNFα induces toxic shock and widespread tissue necrosis. Because of this, TNFα may be responsible for the severe morbidity and mortality associated with a variety of infectious diseases, including sepsis. Mutations in FasL, the ligand for the TNFR-related receptor Fas/APO (Suda et al. Cell 75, 1169-1178 (1993)), is associated with autoimmunity (Fisher et al. Cell 81, 935-946 (1995)), while overproduction of FasL may be implicated in drug-induced hepatitis. Thus, ligands to the various TNFR-related proteins often mediate the serious effects of many disease states, which suggests that agents that neutralize the activity of these ligands would have therapeutic value. Soluble TNFR-1 receptors, and antibodies that bind TNFα, have been tested for their ability to neutralize systemic TNFα (Loetscher et al. Cancer Cells 3(6), 221-226 (1991)). A naturally occuring form of a secreted TNFR-1 mRNA was recently cloned, and its product tested for its ability to neutralize TNFα activity in vitro and in vivo (Kohno et al. PNAS USA 87, 8331-8335 (1990)). The ability of this protein to neutralize TNFα suggests that soluble TNF receptors function to bind and clear TNF thereby blocking the cytotoxic effects on TNFR-bearing cells.

An object of the invention to identify new members of the TNFR super family. It is anticipated that new family members may be transmembrane proteins or soluble forms thereof comprising extracellular domains and lacking transmembrane and cytoplasmic domains. We have identified a new member of the TNFR superfamily which encodes a secreted protein that is closely related to TNFR-2. By analogy to soluble TNFR-1, the TNFR-2 related protein may negatively regulate the activity of its ligand, and thus may be useful in the treatment of certain human diseases.

A novel member of the tumor necrosis factor receptor (TNFR) superfamily has been identified from a fetal rat intestinal cDNA library. A full-length cDNA clone was obtained and sequenced. Expression of the rat cDNA in a transgenic mouse revealed a marked increase in bones density, particularly in long bones, pelvic bone and vertebrae. The polypeptide encoded by the cDNA is termed osteoprotegerin (OPG) and plays a role in promoting bone accumulation.

The invention provides for nucleic acids encoding a polypeptide having at least one of the biological activities of OPG. Nucleic acids which hybridize to nucleic acids encoding mouse, rat or human OPG as shown in FIGS. 2B, 9 A and 9 B are also provided. Preferably, OPG is mammalian OPG and more preferably is human OPG. Recombinant vectors and host cells expressing OPG are also encompassed as are methods of producing recombinant OPG. Antibodies or fragments thereof which specifically bind the polypeptide are also disclosed.

Methods of treating bone diseases are also provided by the invention. The polypeptides are useful for preventing bone resorption and may be used to treat any condition resulting in bone loss such as osteoporosis, hypercalcemia, Paget's disease of bone, and bone loss due to rheumatoid arthritis or osteomyelitis, and the like. Bone diseases may also be treated with anti-sense or gene therapy using nucleic acids of the invention. Pharmaceutical compositions comprising OPG nucleic acids and polypeptides are also encompassed.

FIG. 1. A. FASTA analysis of novel EST LORF. Shown is the deduced FRI-1 amino acid (SEQ ID NO: 119) sequence aligned to the human TNFR-2 (SEQ ID NO: 120) sequence. B. Profile analysis of the novel EST LORF shown is the deduced FRI-1 amino acid sequence (SEQ ID NO: 143) aligned to the TNFR-profile (SEQ ID NO: 144).

FIG. 2 . Structure and sequence of full length rat OPG gene, a novel member of the TNFR superfamily. A. Map of pMOB-B1.1 insert. Box indicates position of LORF within the cDNA sequence (bold line). Black box indicates signal peptide, and gray ellipses indicate position of cysteine-rich repeat sequences. B-C. Nucleic acid and protein sequence of the Rat OPG cDNA (SEQ ID NOS: 123 and 124). The predicted signal peptide is underlined, and potential sites of N-linked glycosylation are indicated in bold, underlined letters. D-E. Pileup sequence comparison (Wisconsin GCG Package, Version 8.1) of OPG with other members of the TNFR superfamily (fas (SEQ ID NO: 131)); (tnfrl (SEQ ID NO: 132)); (sfv-ts (SEQ ID NO: 133)); (tnfr2 (SEQ ID NO: 134)); (cd40 (SEQ ID NO: 135)); (osteo (SEQ ID NO: 136)); (ngfr (SEQ ID NO: 137)); (ox40 (SEQ ID NO: 138)); and (41bb (SEQ ID NO: 139)).

FIGS. 3 . A-I. PepPlot analysis (Wisconsin GCG Package, Version 8.1) of the predicted rat OPG protein sequence.

FIG. 4 . mRNA expression patterns for the OPG cDNA in human tissues. A. Northern blots were probed with a 32P-labeled rat cDNA insert (left two panels), or B. with the human cDNA insert (right panel).

FIG. 5 . Creation of transgenic mice expressing the OPG cDNA in hepatocytes. Northern blot expression of HE-OPG transgene in mouse liver.

FIG. 6 . Increase in bone density in OPG transgenic mice. A-F. Control Mice. Panel G-J, OPG expressing mice. At necropsy, all animals were radiographed and photographs prepared. In A, the radiographs of the control animals and the one transgenic non-expressor (#28) are shown. Note that the bones have a clearly defined cortex and a lucent central marrow cavity. In contrast, the OPG (B) animals have a poorly defined cortex and increased density in the marrow zone.

FIG. 7 . Increase in trabecular bone in OPG transgenic mice. Representative photomicrographs of bones from control animals. In (A) and (B), low (4×, 10×) power images of the femurs are shown (Masson Trichrome stain). Stains for tartrate resistant acid phosphatase (TRAP) demonstrate osteoclasts (see arrows) both resorbing cartilage (C) and trabecular bone (D). Note the flattened appearance of osteoclasts on trabecular bone. Representative photomicrographs of bones from OPG-expressing animals. In (E) and (F), low (4×, 10×) power images of the femurs are shown (Masson Trichrome stain). The clear region is the growth plate cartilage, blue stained area is bone, and the red area is marrow. Note that in contrast to the controls, the trabecular bone has not been resorbed resulting in the absence of the usual marrow cavity. Also, the resulting trabeculae have a variegated appearance with blue and clear areas. The clear areas are remnants of growth plate cartilage that have never been remodelled. Based on TRAP stains, these animals do have osteoclasts (see arrows) at the growth plate G, which may be reduced in number. However, the surfaces of the trabeculae away from the growth plate are virtually devoid of osteoclasts (H), a finding that stands in direct contrast with the control animals (H).

FIG. 8 . HE-OPG expressors do not have a defect in monocyte-macrophage development. One cause for osteopetrosis in mice is defective M-CSF production due to a point mutation in the M-CSF gene. This results in a marked deficit of circulating and tissue based macrophages. The peripheral blood of OPG expressors contained monocytes as assessed by H1E analysis. To affirm the presence of tissue macrophages, immnohistochemistry was performed using F480 antibodies, which recognize a cell surface antigen on murine macrophages. Panels A and C show low power (4×) photomicrographs of the spleens from normal and CR1 overexpressors. Note that both animals have numerous F480 positive cells. Monocyte-macrophages were also present in the marrow of normal (B) and HE-OPG overexpressors (D) (40×).

FIG. 9 . Structure and sequence of mouse and human OPG cDNA clones. A-B. Mouse cDNA and protein sequence. (SEQ ID NOS: 125 and 126) Human cDNA and protein sequence (SEQ ID NOS: 127 and 128). The predicted signal peptides are underlined, and potential sites of N-linked glycosylation are indicated in bold. E-F. Sequence alignment and comparison of rat, mouse and human OPG amino acid sequences (SEQ ID NOS: 126, 124 and 128).

FIG. 10 . Comparison of conserved sequences in extracellular domain of TNFR-1 and human OPG. PrettyPlot (Wisconsin GCG Package, Version 8.1) of the TNFR1 and OPG alignment described in example 6. Top line, human TNFR1 sequences encoding domains 1-4 (SEQ ID NO: 129). Bottom line, human OPG sequences encoding domains 1-4 (SEQ ID NO: 130). Conserved residues are highlighted by rectangular boxes.

FIG. 11 . Three-dimensional representation of human OPG. Side-view of the Molescript display of the predicted 3-dimensional structure of human OPG residues 25 through 163, (wide line), co-crystallized with human TNFβ (thin line). As a reference for orientation, the bold arrows along the OPG polypeptide backbone are pointing in the N-terminal to C-terminal direction. The location of individual cysteine residue side chains are inserted along the polypeptide backbone to help demonstrate the separate cysteine-rich domains. The TNFβ molecule is aligned as described by Banner et al. (1993).

FIGS. 12A-B. Structure of OPG cysteine-rich domains. Alignment of the human (top line) (SEQ ID NO: 141) and mouse (bottom line) (SEQ ID NO: 142) OPG amino acid sequences highlighting the predicted domain structure of OPG. The polypeptide is divided into two halves; the N-terminus, and C-terminus. The N-terminal half is predicted to contain four cysteine rich domains (labeled 1-4). The predicted intrachain disulfide bonds are indicated by bold lines, labeled “SS1”, “SS2”, or “SS3”. Tyrosine 28 and histidine 75 (underlined) are predicted to form an ionic interaction. Those amino acids predicted to interact with an OPG ligand are indicated by bold dots above the appropriate residue. The cysteine residues located in the C-terminal half of OPG are indicated by rectangular boxes.

FIG. 13 . Expression and secretion of full length and truncated mouse OPG-Fc fusion proteins. A. Map indicating points of fusion to the human IgG1 Fc domain are indicated by arrowheads. B. Silver stain of and SDS-polyacrylamide gel of conditioned media obtained from Fl.Fc (Full length OPG fused to Fc at Leucine 401) and CT.Fc (Carboxy-terminal truncated OPG fused to Fc at threonine 180) fusion protein expression vectors. Lane 1, parent pCEP4 expression vector cell line; Lane 2, Fl.Fc vector cell line; Lane 3, CT.Fc vector cell line. C. Western blot of conditioned media obtained from Fl.Fc and CT.Fc fusion protein expression vectors probed with anti-human IgG1 Fc domain (Pierce). Lane 1, parent pCEP4 expression vector cell line; Lane 2, Fl.Fc vector cell line; Lane 3, CT.Fc vector cell line.

FIG. 14 . Expression of human OPG in E. coli . A. Construction of a bacterial expression vector. The LORF of the human OPG gene was amplified by PCR, then joined to a oligonucleotide linker fragment (top line) (SEQ ID NO: 140) and (bottom line) (SEQ ID NO: 122), and ligated into pAMG21 vector DNA. The resulting vector is capable of expressing OPG residues 32-401 linked to a N-terminal methionine residue. B SDS-PAGE analysis of uninduced and induced bacterial harboring the pAMG21-human OPG-32-401 plasmid. Lane 1, MW standards; lane 2, uninduced bacteria; lane 3, 30° C. induction; lane 4, 37° C. induction; lane 5, whole cell lysate from 37° C. induction; lane 6, soluble fraction of whole cell lysate; lane 7, insoluble fraction of whole cell lysate; lane 8, purified inclusion bodies obtained from whole cell lysate.

FIG. 15 . Analysis of recombinant murine OPG produced in CHO cells by SDS-PAGE and western blotting. An equal amount of CHO conditioned media was applied to each lane shown, and was prepared by treatment with either reducing sample buffer (left lane), or non-reducing sample buffer (right lane). After electrophoresis, the resolved proteins were transferred to a nylon membrane, then probed with anti-OPG antibodies. The relative positions of the 55 kd monomeric and 100 kd dimeric forms of OPG are indicated by arrowheads.

FIG. 16 . Pulse-chase analysis of recombinant murine OPG produced in CHO cells. CHO cells were pulse-labeled with 35 S-methionine/cysteine, then chased for the indicated time. Metabolically labeled cultures were separated into both conditioned media and cells, and detergent extracts were prepared from each, clarified, then immunoprecipitated with anti-OPG antibodies. The immunoprecipitates were the resolved by SDS-PAGE, and exposed to film. A. Top left and right panels; samples analyzed under non-reducing conditions. B. Lower left and right panels; samples analyzed under reducing conditions. Top and bottom left panels; Cell extracts. Top and bottom right panels; Conditioned media extracts. The relative mobility of the 55 kd monomeric and 100 kd dimeric forms of OPG are indicated by arrowheads.

FIG. 17 . Expression of OPG in the CTLL-2 cell line. Serum-free conditioned media from CTLL-2 cells and CHO-mu OPG [1-401] transfected cells was prepared, concentrated, then analyzed by non-reducing SDS-PAGE and western blotting. Left lane; CTLL-2 conditioned media. Right lane; CHO-muOPG conditioned media. The relative mobility of the 55 kd monomeric and 100 kd dimeric forms of OPG are indicated by arrowheads.

FIG. 18 . Detection of OPG expression in serum samples and liver extracts obtained from control and OPG transgenic mice. Transgenic mice were constructed as described in Example 4. OPG expression was visualized after SDS-PAGE followed by Western blotting using anti-OPG antibodies.

FIGS. 19A-G. Effects of huOPG [22-401]-Fc fusion protein on osteoclast formation in vitro. The osteoclast forming assay was performed as described in Example 11A in the absence (control) or presence of the indicated amounts of huOPG [22-401]-Fc fusion. Osteoclast formation was visualized by histochemical staining for tartrate acid phophatase (TRAP).

FIG. 20 . Decrease in osteoclast culture TRAP activity with increasing amounts of OPG. Indicated concentrations of huOPG [22-401]-Fc fusion protein were added to osteoclast forming assay and TRAP activity quantitated as described in Example 11A.

FIG. 21 . Effect of OPG on a terminal stage of osteoclast differentiation. huOPG [22-401]-Fc fusion was added to the osteoclast forming assay during the intermediate stage of osteoclast maturation (days 5-6; OPG-CTL) or during the terminal stage of osteoclast maturation (days 7-15; CTL-OPG). TRAP activity was quantitated and compared with the activity observed in the absence of OPG (CTL-CTL) in the presence of OPG throughout (OPG-OPG).

FIG. 22 . Effects of IL-1β, IL-1α and OPG on blood ionized calcium in mice. Levels of blood ionized calcium were monitored after injection of IL-1β alone, IL-1α alone, IL-1β plus muOPG [22-401]-Fc, IL-1α plus MuOPG [22-401]-Fc, and muOPG [22-401]-Fc alone. Control mice received injections of phosphate buffered saline (PBS) only IL-1β experiment shown in A; IL-1α experiment shown in B.

FIGS. 23A-D. Effects of OPG on calvarial osteoclasts in control and IL1-treated mice. Histological methods for analyzing mice calvarial bone samples are described in Example 11B. Arrows indicate osteoclasts present in day 2-treated mice.

FIG. 24 . Radiographic analysis of bone accumulation in marrow cavity of normal mice. Mice were injected subcutaneously with saline (A) or muOPG [22-401]-Fc fusion (5 mg/kg/d) for 14 days (B) and bone density determined as described in Example 11C.

FIG. 25 . Histomorphometric analysis of bone accumulation in marrow cavity of normal mice. Injection experiments and bone histology performed as described in Example 11C.

FIG. 26 . Histology analysis of bone accumulation in marrow cavity of normal mice. Injection experiments and bone histology performed as descrbed in Example 11C. A. Saline inhecton B. Injection of MuOPG [22-401]-Fc fusion.

A novel member of the tumor necrosis factor receptor (TNFR) superfamily was identified as an expressed sequence tag (EST) isolated from a fetal rat intestinal cDNA library. The structures of the full-length rat cDNA clones and the corresponding mouse and human cDNA clones were determined as described in Examples 1 and 6. The rat, mouse and human genes are shown in FIGS. 2B, 9 A and 9 B, respectively. All three sequences showed strong similarity to the extraceullular domains of TNFR family members. None of the full-length cDNA clones isolated encoded transmembrane and cytoplasmic domains that would be expected for membrane-bound receptors, suggesting that these cDNAs encode soluble, secreted proteins rather than cell surface receptors. A portion of the human gene spanning nucleotides 1200-1353 shown in FIG. 9B was deposited in the Genebank database on Nov. 22, 1995 under accession no. 17188769.

The tissue distribution of the rat and human mRNA was determined as described in Example 2. In rat, mRNA expression was detected in kidney, liver, placenta and heart with the highest expression in the kidney. Expression in skeletal muscle and pancreas was also detected. In humans, expression was detected in the same tissues along with lymph node, thymus, spleen and appendix.

The rat cDNA was expressed in transgenic mice (Example 3) using the liver-specific ApoE promoter expression system. Analysis of expressors showed a marked increase in bone density, particularly in long bones (femurs), vertebrae and flat bones (pelvis). Histological analysis of stained sections of bone showed severe osteopetrosis (see Example 4) indicating a marked imbalance between bone formation and resorption which has led to a marked accumulation of bone and cartilage. A decrease in the number of trabecular osteoclasts in the bones of OPG expresser animals indicate that a significant portion of the activity of the TNFR-related protein may be to prevent bone resorption, a process mediated by osteoclasts. In view of the activity in transgenic expressors, the TNFR-related proteins described herein are termed OPGs.

Using the rat cDNA sequence, mouse and human cDNA clones were isolated (Example 5). Expression of mouse OPG in 293 cells and human OPG in E. coli is described in Examples 7 and 8. Mouse OPG was produced as an Fc fusion which was purified by Protein A affinity chromatography. Also described in Example 7 is the expression of full-length and truncated human and mouse OPG polypeptides in CHO and 293 cells either as fusion polypeptides to the Fc region of human IgG1 or as unfused polypeptides. The expression of full-length and truncated human and mouse OPGs in E. coli either as Fc fusion polypeptides or as unfused polypeptides is described in Example 8. Purification of recombinantly produced mammalian and bacterial OPG is described in Example 10.

The biological activity of OPG was determined using an in vitro osteoclast maturation assay, an in vivo model of interleukin-1 (IL-1) induced hypercalcemia, and injection studies of bone density in normal mice (see Example 11). The following OPG recombinant proteins produced in CHO or 293 cells demonstrated activity in the in E. coli osteoclast maturation assay: muOPG [22-185]-Fc, muOPG [22-194]-Fc, muOPG [22-401]Fc, muOPG [22-401], huOPG [22-201]-Fc, huOPG [22-401]-Fc. muOPG [22-180]-Fc produced in CHO cells and huOPG met[32-401] produced in E. coli did not demonstrate activity in the in vitro assay.

OPG from several sources was produced as a dimer and to some extent as a higher multimer. Rat OPG [22-401] produced in transgenic mice, muOPG [22-401] and huOPG [22-401] produced as a recombinant polypeptide in CHO cells, and OPG expressed as a naturally occurring product from a cytotoxic T cell line were predominantly dimers and trimers when analyzed on nonreducing SDS gels (see Example 9). Truncated OPG polypeptides having deletions in the region of amino acids 186-401 (e.g., OPG [1-185] and OPG [1-194]) were predominantly monomeric suggesting that the region 186-401 may be involved in self-association of OPG polypeptides. However, huOPG met[32-401] produced in E. coli was largely monomeric.

OPG may be important in regulating bone resorption. The protein appears to act as a soluble receptor of the TNF family and may prevent a receptor-ligand interaction involved in the osteolytic pathway. One aspect of the regulation appears to be a reduction in the number of osteoclasts.

Nucleic Acids

The invention provides for an isolated nucleic acid encoding a polypeptide having at least one of the biological activities of OPG. As described herein, the biological activities of OPG include, but are not limited to, any activity involving bone metabolism and in particular, include increasing bone density. The nucleic acids of the invention are selected from the following:

a) the nucleic acid sequences as shown in FIGS. 2B, 9 A and 9 B or complementary strands thereof;

b) the nucleic acids which hybridize under stringent conditions with the polypeptide-encoding region in FIGS. 2B, 9 A and 9 B; and

c) nucleic acids which hybridize under stringent conditions with nucleotides 148 through 337 inclusive as shown in FIG. 1 A.

d) the nucleic acid sequences which are degenerate to the sequences in (a) and (b).

The invention provides for nucleic acids which encode rat, mouse and human OPG as well as nucleic acid sequences hybridizing thereto which encode a polypeptide having at least one of the biological activities of OPG. Also provided for are nucleic acids which hybridize to a rat OPG EST encompassing nucleotides 148-337 as shown in FIG. 1 A. The conditions for hybridization are generally of high stringency such as 5×SSC, 50% formamide and 42° C. described in Example 1 of the specification. Equivalent stringency to these conditions may be readily obtained by adjusting salt and organic solvent concentrations and temperature. The nucleic acids in (b) encompass sequences encoding OPG-related polypeptides which do not undergo detectable hybridization with other known members of the TNF receptor superfamily. In a preferred embodiment, the nucleic acids are as shown in FIGS. 2B, 9 A and 9 B.

The length of hybridizing nucleic acids of the invention may be variable since hybridization may occur in part or all of the polypeptide-encoding regions as shown in FIGS. 2B, 9 A and 9 B, and may also occur in adjacent noncoding regions. Therefore, hybridizing nucleic acids may be truncations or extensions of the sequences shown in FIGS. 2B, 9 A and 9 B. Truncated or extended nucleic acids are encompassed by the invention provided they retain one or more of the biological properties of OPG. The hybridizing nucleic acids may also include adjacent noncoding regions which are 5′ and/or 3′ to the OPG coding region. The noncoding regions include regulatory regions involved in OPG expression, such as promoters, enchancers, translational initiation sites, transcription termination sites and the like.

Hybridization conditions for nucleic acids are described in Sambrook et al. Molecular Cloning: A Laboratory Manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989)

DNA encoding rat OPG was provided in plasmid pMO-B1.1 deposited with the American Type Culture Collection, Rockville, Md. on Dec. 27, 1995 under ATCC accession no. 69970. DNA encoding mouse OPG was provided in plasmid pRcCMV-murine OPG deposited with the American Type Culture Collection, Rockville, Md. on Dec. 27, 1995 under accession no. 69971. DNA encoding human OPG was provided in plasmid pRcCMV-human OPG deposited with the American Type Culture Collection, Rockville, Md. on Dec. 27, 1995 under accession no. 69969. The nucleic acids of the invention will hybridize under stringent conditions to the DNA inserts of ATCC accession nos. 69969, 69970, and 69971 and have at least one of the biological activities of OPG.

Also provided by the invention are derivatives of the nucleic acid sequences as shown in FIGS. 2B, 9 A and 9 B. As used herein, derivatives include nucleic acid sequences having addition, substitution, insertion or deletion of one or more residues such that the resulting sequences encode polypeptides having one or more amino acid residues which have been added, deleted, inserted or substituted and the resulting polypeptide has the activity of OPG. The nucleic acid derivatives may be naturally occurring, such as by splice variation or polymorphism, or may be constructed using site-directed mutagenesis techniques available to the skilled worker. One example of a naturally occurring variant of OPG is a nucleic acid encoding a lys to asn change at residue 3 within the leader sequence (see Example 5). It is anticipated that nucleic acid derivatives will encode amino acid changes in regions of the molecule which are least likely to disrupt biological activity. Other derivatives include a nucleic acid encoding a membrane-bound form of OPG having an extracellular domain as shown in FIGS. 2B, 9 A and 9 B along with transmembrane and cytoplasmic domains.

In one embodiment, derivatives of OPG include nucleic acids encoding truncated forms of OPG having one or more amino acids deleted from the carboxy terminus. Nucleic acids encoding OPG may have from 1 to 216 amino acids deleted from the carboxy terminus. Optionally, an antibody Fc region may extend from the new carboxy terminus to yield a biologically active OPG-Fc fusion polypeptide. (see Example 11). In preferred embodiments, nucleic acids encode OPG having the amino acid sequence from residues 22-185, 22-189, 22-194 or 22-201 (using numbering in FIG. 9C) and optionally, encoding an Fc region of human IgG.

Also included are nucleic acids encoding truncated forms of OPG having one or more amino acids deleted from the amino terminus. Truncated forms include those lacking part or all the 21 amino acids comprising the leader sequence. Additionally, the invention provides for nucleic acids encoding OPG having from 1 to 10 amino acids deleted from the mature amino terminus (at residue 22) and, optionally, having from 1 to 216 amino acids deleted from the carboxy terminus (at residue 401). Optionally, the nucleic acids may encode a methionine residue at the amino terminus. Examples of such OPG truncated polypeptides are described in Example 8.

Examples of the nucleic acids of the invention include cDNA, genomic DNA, synthetic DNA and RNA. cDNA is obtained from libraries prepared from mRNA isolated from various tissues expressing OPG. In humans, tissue sources for OPG include kidney, liver, placenta and heart. Genomic DNA encoding OPG is obtained from genomic libraries which are commercially available from a variety of species. Synthetic DNA is obtained by chemical synthesis of overlapping oligonucleotide fragments followed by assembly of the fragments to reconstitute part or all of the coding region and flanking sequences (see U.S. Pat. No. 4,695,623 describing the chemical synthesis of interferon genes). RNA is obtained most easily by procaryotic expression vectors which direct high-level synthesis of mRNA, such as vectors using T7 promoters and RNA polymerase.

Nucleic acid sequences of the invention are used for the detection of OPG sequences in biological samples in order to determine which cells and tissues are expressing OPG mRNA. The sequences may also be used to screen cDNA and genomic libraries for sequences related to OPG. Such screening is well within the capabilities of one skilled in the art using appropriate hybridization conditions to detect homologus sequences. The nucleic acids are also useful for modulating the expression of OPG levels by anti-sense therapy or gene therapy. The nucleic acids are also used for the development of transgenic animals which may be used for the production of the polypeptide and for the study of biological activity (see Example 3).

Vectors and Host Cells

Expression vectors containing nucleic acid sequences encoding OPG, host cells transformed with said vectors and methods for the production of OPG are also provided by the invention. An overview of expression of recombinant proteins is found in Methods of Enzymology v. 185, Goeddel, D. V. ed. Academic Press (1990).

Host cells for the production of OPG include procaryotic host cells, such as E. coli , yeast, plant, insect and mammalian host cells. E. coli strains such as HB101 or JM101 are suitable for expression. Preferred mammalian host cells include COS, CHOd-, 293, CV-1, 3T3, baby hamster kidney (BHK) cells and others. Mammalian host cells are preferred when post-translational modifications, such as glycosylation and polypeptide processing, are important for OPG activity. Mammalian expression allows for the production of secreted polypeptides which may be recovered from the growth medium.

Vectors for the expression of OPG contain at a minimum sequences required for vector propagation and for expression of the cloned insert. These sequences include a replication origin, selection marker, promoter, ribosome binding site, enhancer sequences, RNA splice sites and transcription termination site. Vectors suitable for expression in the aforementioned host cells are readily available and the nucleic acids of the invention are inserted into the vectors using standard recombinant DNA techniques. Vectors for tissue-specific expression of OPG are also included. Such vectors include promoters which function specifically in liver, kidney or other organs for production in mice, and viral vectors for the expression of OPG in targeted human cells.

Using an appropriate host-vector system, OPG is produced recombinantly by culturing a host cell transformed with an expression vector containing nucleic acid sequences encoding OPG under conditions such that OPG is produced, and isolating the product of expression. OPG is produced in the supernatant of transfected mammalian cells or in inclusion bodies of transformed bacterial host cells. OPG so produced may be purified by procedures known to one skilled in the art as described below. The expression of OPG in mammalian and bacterial host systems is described in Examples 7 and 8. Expression vectors for mammalian hosts are exemplified by plasmids such as pDSRα described in PCT Application No. 90/14363. Expression vectors for bacterial host cells are exemplified by plasmids pAMG21 and pAMG22-His described in Example 8. Plasmid pAMG21 was deposited with the American Type Culture Collection, Rockville, Md. on Jul. 24, 1996 under accession no. 98113. Plasmid pAMG22-His was deposited with the American Type Culture Collection, Rockville, Md. on Jul. 24, 1996 under accession no. 98112. It is anticipated that the specific plasmids and host cells described are for illustrative purposes and that other available plasmids and host cells could also be used to express the polypeptides.

The invention also provides for expression of OPG from endogenous nucleic acids by in vivo or ex vivo recombination events to allow modulation of OPG from the host chromosome. Expression of OPG by the introduction of exogenous regulatory sequences (e.g. promoters or enhancers) capable of directing the production of OPG from endogenous OPG coding regions is also encompassed. Stimulation of endogenous regulatory sequences capable of directing OPG production (e.g. by exposure to transcriptional enhancing factors) is also provided by the invention.

Polypeptides

The invention provides for OPG, a novel member of the TNF receptor superfamily, having an activity associated with bone metabolism and in particular having the activity of inhibiting bone resorption thereby increasing bone density. OPG refers to a polypeptide having an amino acid sequence of mouse, rat or human OPG or a derivative thereof having at least one of the biological activities of OPG. The amino acid sequences of rat, mouse and human OPG are shown in FIGS. 2B, 9 A and 9 B respectively. A derivative of OPG refers to a polypeptide having an addition, deletion, insertion or substitution of one or more amino acids such that the resulting polypeptide has at least one of the biological activities of OPG. The biological activities of OPG include, but are not limited to, activities involving bone metabolism. Preferably, the polypeptides will have the amino terminal leader sequence of 21 amino acids removed.

OPG polypeptides encompassed by the invention include rat [1-401], rat [22-180], rat [22-401], rat [22-401]-Fc fusion, rat [1-180]-Fc fusion, mouse [1-401], mouse [1-180], mouse [22-401], human [1-401], mouse [22-180], human [22-401], human [22-180], human [1-180], human [22-180]-Fc fusion and human met-32-401. Amino acid numbering is as shown in SEQ ID NO: 124 (rat), SEQ ID NO: 126 (mouse) and SEQ ID NO: 128 (human). Also encompassed are polypeptide derivatives having deletions or carboxy-terminal truncations of part or all of amino acids residues 180-401 of OPG; one or more amino acid changes in residues 180-401; deletion of part or all of a cysteine-rich domain of OPG, in particular deletion of the distal (carboxy-terminal) cysteine-rich domain; and one or more amino acid changes in a cysteine-rich domain, in particular in the distal (carboxy-terminal) cysteine-rich domain. In one embodiment, OPG has from 1 to about 216 amino acids deleted from the carboxy terminus. In another embodiment, OPG has from 1 to about 10 amino acids deleted from the mature amino terminus (wherein the mature amino terminus is at residue 22) and, optionally, has from 1 to about 216 amino acids deleted from the carboxy terminus.

Additional OPG polypeptides encompassed by the invention include the following: human [22-180]-Fc fusion, human [22-201]-Fc fusion, human [22-401]-Fc fusion, mouse [22-185]-Fc fusion, mouse [22-194]-Fc fusion. These polypeptides are produced in mammalian host cells, such as CHO or 293 cells, Additional OPG polypeptides encompassed by the invention which are expressed in procaryotic host cells include the following: human met[22-401], Fc-human met[22-401] fusion (Fc region is fused at the amino terminus of the full-length OPG coding sequence as described in Example 8), human met[22-401]-Fc fusion (Fc region fused to the full-lengh OPG sequence), Fc-mouse met[22-401] fusion, mouse met[22-401]-Fc fusion, human met[27-401], human met[22-185], human met[22-189], human met[22-194], human met[22-194] (P25A), human met[27-185], human met[27-189], human met[27-194], human met-arg-gly-ser-(his) 6 [22-401], human met-lys [22-401], human met-(lys) 3 -[22-401 ], human met[22-401]-Fc (P25A), human met[22-401] (P25A), human met[22-401] (P26A), human met[22-401] (P26D), mouse met[22-401], mouse met[27-401], mouse met[32-401], mouse met[27-180], mouse met[22-189], mouse met[22-194], mouse met[27-189], mouse met[27-194], mouse met-lys[22-401], mouse HEK[22-401] (A45T), mouse met-lys-(his) 7 [22-401], mouse met-lys[22-401]-(his) 7 and mouse met[27-401] (P33E, G36S, A45P). It is understood that the above OPG polypeptides produced in procaryotic host cells have an amino-terminal methionine residue, if such a residue is not indicated. In specific examples, OPG-Fc fusion were produced using a 227 amino acid region of human IgG1-γ1 was used having the sequence as shown in Ellison et al. (Nuc. Acids Res. 10, 4071-4079 (1982)). However, variants of the Fc region of human IgG may also be used.

Analysis of the biological activity of carboxy-terminal OPG truncations fused to the human IgG1 Fc region indicates a portion of OPG of about 164 amino acids which is required for activity. This region encompasses amino acids 22-185, preferably those in FIG. 9B, and comprises four cysteine-rich domains characteristic of the cysteine-rich domains of TNFR extraceullular domains.

Using the homology between OPG and the extracellular ligand binding domains of TNF receptor family members, a three-dimensional model of OPG was generated based upon the known crystal structure of the extracellular domain of TNFR-I (see Example 6). This model was used to identify those residues within OPG which may be important for biological activity. Cysteine residues that are involved in maintaining the structure of the four cysteine-rich domains were identified. The following disulfide bonds were identified in the model: Domain 1: cys41 to cys54, cys44 to cys62, tyr23 and his 66 may act to stabilize the structure of this domain; Domain 2: cys65 to cys80, cys83 to cys98, cys87 to cys105; Domain 3: cys107 to cys118, cys124 to cys142; Domain 4: cys145 to cys160, cys166 to cys185. Residues were also identified which were in close proximity to TNFβ as shown in FIGS. 11 and 12. In this model, it is assumed that OPG binds to a corresponding ligand; TNFβ was used as a model ligand to simulate the interaction of OPG with its ligand. Based upon this modeling, the following residues in OPG may be important for ligand binding: glu34, lys43, pro66 to gln91 (in particular, pro66, his68, tyr69, tyr70, thr71, asp72, ser73, his76, ser77, asp78, glu79, leu81, tyr82, pro85, val86, lys88, glu90 and gln91), glu153 and ser155.

Alterations in these amino acid residues, either singly or in combination, may alter the biological activity of OPG. For example, changes in specific cysteine residues may alter the structure of individual cysteine-rich domains, whereas changes in residues important for ligand binding may affect physical interactions of OPG with ligand. Structural models can aid in identifying analogs which have more desirable properties, such as enhanced biological activity, greater stability, or greater ease of formulation.

The invention also provides for an OPG multimer comprising OPG monomers. OPG appears to be active as a multimer (e.g, dimer, trimer of a higher number of monomers). Preferably, OPG multimers are dimers or trimers. OPG multimers may comprise monomers having the amino acid sequence of OPG sufficient to promote multimer formation or may comprise monomers having heterologous sequences such as an antibody Fc region. Analysis of carboxy-terminal deletions of OPG suggest that at least a portion of the region 186-401 is involved in association of OPG polypeptides. Substitution of part or all of the region of OPG amino acids 186-401 with an amino acid sequence capable of self-association is also encompassed by the invention. Alternatively, OPG polypeptides or derivatives thereof may be modified to form dimers or multimers by site directed mutagenesis to create unpaired cysteine residues for interchain disulfide bond romation, by photochemical crosslinking, such as exposure to ultraviolet light, or by chemical crosslinking with bifunctional linker molecules such as bifunctional polyethylene glycol and the like.

Modifications of OPG polypeptides are encompassed by the invention and include post-translational modifications (e.g., N-linked or O-linked carbohydrate chains, processing of N-terminal or C-terminal ends), attachment of chemical moieties to the amino acid backbone, chemical modifications of N-linked or O-linked carbohydrate chains, and addition of an N-terminal methionine residue as a result of procaryotic host cell expression. The polypeptides may also be modified with a detectable label, such as an enzymatic, fluorescent, isotopic or affinity label to allow for detection and isolation of the protein.

Further modifications of OPG include chimeric proteins wherein OPG is fused to a heterologous amino acid sequence. The heterologous sequence may be any sequence which allows the resulting fusion protein to retain the activity of OPG. The heterologous sequences include for example, immunoglobulin fusions, such as Fc fusions, which may aid in purification of the protein. A heterologous sequence which promotes association of OPG monomers to form dimers, trimers and other higher multimeric forms is preferred.

The polypeptides of the invention are isolated and purified from other polypeptides present in tissues, cell lines and transformed host cells expressing OPG, or purified from components in cell cultures containing the secreted protein. In one embodiment, the polypeptide is free from association with other human proteins, such as the expression product of a bacterial host cell.

Also provided by the invention are chemically modified derivatives of OPG which may provide additional advantages such as increasing stability and circulating time of the polypeptide, or decreasing immunogenicity (see U.S. Pat. No. 4,179,337). The chemical moieties for derivitization may be selected from water soluble polymers such as polyethylene glycol, ethylene glycol/propylene glycol copolymers, carboxymethylcellulose, dextran, polyvinyl alcohol and the like. The polypeptides may be modified at random positions within the molecule, or at predetermined positions within the molecule and may include one, two, three or more attached chemical moieties.

A method for the purification of OPG from natural sources and from transfected host cells is also included. The purification process may employ one or more standard protein purification steps in an appropriate order to obtain purified protein. The chromatography steps can include ion exchange, gel filtration, hydrophobic interaction, reverse phase, chromatofocusing, affinity chromatography employing an anti-OPG antibody or biotin-streptavidin affinity complex and the like.

Antibodies

Also encompassed by the invention are antibodies specifically binding to OPG. Antigens for the generation of antibodies may be full-length polypeptides or peptides spanning a portion of the OPG sequence. Immunological procedures for the generation of polyclonal or monoclonal antibodies reactive with OPG are known to one skilled in the art (see, for example, Harlow and Lane, Antibodies: A Laboratory Manual Cold Spring Harbor Laboratory Press, Cold Spring Harbor N.Y. (1988)). Antibodies so produced are characterized for binding specificity and epitope recognition using standard enzyme-linked immunosorbent assays. Antibodies also include chimeric antibodies having variable and constant domain regions derived from different species. In one embodiment, the chimeric antibodies are humanized antibodies having murine variable domains and human constant domains. Also encompassed are complementary determining regions grafted to a human framework (so-called CDR-grafted antibodies). Chimeric and CDR-grafted antibodies are made by recombinant methods known to one skilled in the art. Also encompassed are human antibodies made in mice.

Anti-OPG antibodies of the invention may be used as an affinity reagent to purify OPG from biological samples (see Example 10). In one method, the antibody is immobilized on CnBr-activated Sepharose and a column of antibody-Sepharose conjugate is used to remove OPG from liquid samples. Antibodies are also used as diagnostic reagents to detect and quantitate OPG in biological samples by methods described below.

Pharmaceutical Compositions

The invention also provides for pharmaceutical compositions comprising a therapeutically effective amount of the polypeptide of the invention together with a pharmaceutically acceptable diluent, carrier, solubilizer, emulsifier, preservative and/or adjuvant. The term “therapeutically effective amount” means an amount which provides a therapeutic effect for a specified condition and route of administration. The composition may be in a liquid or lyophilized form and comprises a diluent (Tris, acetate or phosphate buffers) having various pH values and ionic strengths, solubilizer such as Tween or Polysorbate, carriers such as human serum albumin or gelatin, preservatives such as thimerosal or benzyl alcohol, and antioxidants such as ascrobic acid or sodium metabisulfite. Also encompassed are compositions comprising OPG modified with water soluble polymers to increase solubility or stability. Compositions may also comprise incorporation of OPG into liposomes, microemulsions, micelles or vesicles for controlled delivery over an extended period of time. Selection of a particular composition will depend upon a number of factors, including the condition being treated, the route of administration and the pharmacokinetic parameters desired. A more extensive survey of component suitable for pharmaceutical compositions is found in Remington's Pharmaceutical Sciences, 18th ed. A. R. Gennaro, ed. Mack, Easton, Pa. (1980).

Compositions of the invention may be administered by injection, either subcutaneous, intravenous or intramuscular, or by oral, nasal, pulmonary or rectal administration. The route of administration eventually chosen will depend upon a number of factors and may be ascertained by one skilled in the art.

The invention also provides for pharmaceutical compositions comprising a therapeutically effective amount of the nucleic acids of the invention together with a pharmaceutically acceptable adjuvant. Nucleic acid compositions will be suitable for the delivery of part or all of the OPG coding region to cells and tissues as part of an anti-sense or gene therapy regimen.

Methods of Treatment

Bone tissue provides support for the body and consists of mineral (largely calcium and phosphorous), a matrix of collagenous and noncollagenous proteins, and cells. Three types of cells found in bone, osteocytes, osteoblasts and osteoclasts, are involved in the dynamic process by which bone is continually formed and resorbed. Osteoblasts promote formation of bone tissue whereas osteoclasts are associated with resorption. Resorption, or the dissolution of bone matrix and mineral, is a fast and efficient process compared to bone formation and can release large amounts of mineral from bone. Osteoclasts are involved in the regulation of the normal remodeling of skeletal tissue and in resorption induced by hormones. For instance, resorption is stimulated by the secretion of parathyroid hormone in response to decreasing concentrations of calcium ion in extracellular fluids. In contrast, inhibition of resorption is the principal function of calcitonin. In addition, metabolites of vitamin D alter the responsiveness of bone to parathyroid hormone and calcitonin.

After skeletal maturity, the amount of bone in the skeleton reflects the balance (or imbalance) of bone formation and bone resorption. Peak bone mass occurs after skeletal maturity prior to the fourth decade. Between the fourth and fifth decades, the equilibrium shifts and bone resorption dominates. The inevitable decrease in bone mass with advancing years starts earlier in females than males and is distinctly accelerated after menopause in some females (principally those of Caucasian and Asian descent).

Osteopenia is a condition relating generally to any decrease in bone mass to below normal levels. Such a condition may arise from a decrease in the rate of bone synthesis or an increase in the rate of bone destruction or both. The most common form of osteopenia is primary osteoporosis, also referred to as postmenopausal and senile osteoporosis. This form of osteoporosis is a consequence of the universal loss of bone with age and is usually a result of increase in bone resorption with a normal rate of bone formation. About 25 to 30 percent of all white females in the United States develop symptomatic osteoporosis. A direct relationship exists between osteoporosis and the incidence of hip, femoral, neck and inter-trochanteric fracture in women 45 years and older. Elderly males develop symptomatic osteoporosis between the ages of 50 and 70, but the disease primarily affects females.

The cause of postmenopausal and senile osteoporosis is unknown. Several factors have been identified which may contribute to the condition. They include alteration in hormone levels accompanying aging and inadequate calcium consumption attributed to decreased intestinal absorption of calcium and other minerals. Treatments have usually included hormone therapy or dietary supplements in an attempt to retard the process. To date, however, an effective treatment for bone loss does not exist.

The invention provides for a method of treating a bone disorder using a therapeutically effective amount of OPG. The bone disorder may be any disorder characterized by a net bone loss (osteopenia or osteolysis). In general, treatment with OPG is anticipated when it is necessary to suppress the rate of bone resorption. Thus treatment may be done to reduce the rate of bone resorption where the resorption rate is above normal or to reduce bone resorption to below normal levels in order to compensate for below normal levels of bone formation.

Conditions which are treatable with OPG include the following:

Osteoporosis, such as primary osteoporosis, endocrine osteoporosis (hyperthyroidism, hyperparathryoidism, Cushing's syndrome, and acromegaly), hereditary and congenital forms of osteoporosis (osteogenesis imperfecta, homocystinuria, Menkes' syndrome, and Riley-Day syndrome) and osteoporosis due to immobilization of extremities.

Paget's disease of bone (osteitis deformans) in adults and juveniles.

Osteomyelitis, or an infectious lesion in bone, leading to bone loss.

Hypercalcemia resulting from solid tumors (breast, lung and kidney) and hematologic malignacies (multiple myeloma, lymphoma and leukemia), idiopathic hypercalcemia, and hypercalcemia associated with hyperthryoidism and renal function disorders.

Osteopenia following surgery, induced by steroid administration, and associated with disorders of the small and large intestine and with chronic hepatic and renal diseases.

Osteonecrosis, or bone cell death, associated with traumatic injury or nontraumatic necrosis associated with Gaucher's disease, sickle cell anemia, systemic lupus erythematosus and other conditions.

Bone loss due to rheumatoid arthritis.

Periodontal bone loss.

Osteolytic metastasis

It is understood that OPG may be used alone or in conjunction with other factors for the treatment of bone disorders. In one embodiment, osteoprotegerein is used in conjunction with a therapeutically effective amount of a factor which stimulates bone formation. Such factors include but are not limited to the bone morphogenic factors designated BMP-1 through BMP-12, transforming growth factor-β (TGF-β) and TGF-β family members, interleukin-1 inhibitors, TNFα inhibitors, parathyroid hormone and analogs thereof, parathyroid related protein and analogs thereof, E series prostaglandins, bisphosphonates (such as alendronate and others), and bone-enhancing minerals such as fluoride and calcium.

The following examples are offered to more fully illustrate the invention, but are not construed as limiting the scope thereof.

-TACCACTGGCGGTGATACTGAGCACAT  3′ (SEQ ID NO:47)

-ATGGTGACCGCCACTATGACTCGTGTAGC5′(SEQ ID NO:54)

ClaI

and then (c) substituting the small DNA sequence between the unique ClaI and KpnI restriction sites with the following oligonucleotide:

The expression plasmid pAMG21 can then be derived from pCFM1656 by making a series of site directed base changes by PCR overlapping oligo mutagenesis and DNA sequence substitutions. Starting with the BglII site (plasmid bp # 180) immediately 5′ to the plasmid replication promoter PcopB and proceeding toward the plasmid replication genes, the base pair changes are as follows:

The DNA sequence between the unique AatII (position #4364 in pCFM1656) and SacII (position #4585 in pCFM1656) restriction sites is substituted with the following DNA sequence:

[AatII sticky end]               5′     GCGTAACGTATGCATGGTCTCC-

(position #4358 in PAMG21)      3′ TGCACGCATTGCATACGTACCAGAGG-

AatII

SacII

-AACCGCTCTTCACGCTCTTCACGC 3′ (SEQ ID NO:50) [SacII sticky end]

-TTGGCGAGAAGTGCGAGAAGTG   5′ (SEQ ID NO:46) (position #5904 in pAMG21)

During the ligation of the sticky ends of this substitution DNA sequence, the outside AatII and SacII sites are destroyed. There are unique AaII and SacII sites in the substituted DNA.

pAMG22-His

The expression plasmid pAMG22-His can be derived from the Amgen expression vector pAMG22 by substituting the small DNA sequence between the unique NdeI (#4797) and EcorRI (#4818) restriction sites of pAMG22 with the following oligonucleotide duplex:

pAMG22

The expression plasmid pAMG22 can be derived from the Amgen expression vector pCFM1656 (ATCC #69576) which in turn be derived from the Amgen expression vector system described in U.S. Pat. No. 4,710,473 granted Dec. 1, 1987. The pCFM1656 plasmid can be derived from the described pCFM836 plasmid (U.S. Pat. No. 4,710,473) by: (a) destroying the two endogenous NdeI restriction sites by end filling with T4 polymerase enzyme followed by blunt end ligation; (b) replacing the DNA sequence between the unique AatII and ClaI restriction sites containing the synthetic PL promoter with a similar fragment obtained from pCFM636 (U.S. Pat. No. 4,710,473) containing the PL promoter

AatII

5′    CTAATTCCGCTCTCACCTACCAAACAATGCCCCCCTGCAAAAAATAAATTCATAT-

3′TGCAGATTAAGGCGAGAGTGGATGGTTTGTTACGGGGGGACGTTTTTTATTTAAGTATA-

TACCACTGGCGGTGATACTGAGCACAT 3′(SEQ ID NO: 53)

ATGGTGACCGCCACTATGACTCGTGTAGC5′(SEQ ID NO: 54)

ClaI

and then (c) substituting the small DNA sequence between the unique Clal and KpnI restriction sites with the following oligonucleotide:

The expression plasmid pAMG22 can then be derived from pCFM1656 by making a series of site directed base changes by PCR overlapping oligo mutagenesis and DNA sequence substitutions. Starting with the BglII site (plasmid bp #180) immediately 5′ to the plasmid replication promoter PcopB and proceeding toward the plasmid replication genes, the base pair changes are as follows:

The DNA sequence between the unique AatII (position #4364 in pCFM1656) and Sacli (position #4585 in pCFM1656) restriction sites is substituted with the following DNA sequence:

5′     GCGTAACGTATGCATGGTCTCCCCATGCGAGAGTAGGGAACTGCCAGGCATCAA-

3′ TGCACGCATTGCATACGTACCAGAGGGGTACGCTCTCATCCCTTGACGGTCCGTAGTT-

AatII

SacII

CGCTCTTCACGC 3′(SEQ ID NO: 58)

GCGAGAAGTG 5′(SEQ ID NO: 57)

[SacII sticky end] (position #5024 in pAMG22)

During the ligation of the sticky ends of this substitution DNA sequence, the outside AatII and SacII sites are destroyed. There are unique AatII and SacII sites in the substituted DNA.

B. Human OPG Met[32-401]

In the example, the expression vector used was pAMG21, a derivative of pCFM1656 (ATCC accession no. 69576) which contains appropriate restriction sites for insertion of genes downstream from the lux PR promoter. (See U.S. Pat. No. 5,169,318 for description of the lux expression system). The host cell used was GM120 (ATCC accession no. 55764). This host has the lacIQ promoter and lacI gene integrated into a second site in the host chromosome of a prototrophic E. coli K12 host. Other commonly used E. coli expression vectors and host cells are also suitable for expression.

A DNA sequence coding for an N-terminal methionine and amino acids 32-401 of the human OPG polypeptide was placed under control of the luxPR promoter in the plasmid expression vector pAMG21 as follows. To accomplish this, PCR using oligonucleotides #1257-20 and #1257-19 as primers was performed using as a template plasmid pRcCMV-Hu OPG DNA containing the human OPG cDNA and thermocycling for 30 cycles with each cycle being: 94° C. for 20 seconds, followed by 37° C. for 30 seconds, followed by 72° C. for 30 seconds. The resulting PCR sample was resolved on an agarose gel, the PCR product was excised, purified, and restricted with KpnI and BamHI restriction endonucleases and purified. Synthetic oligonucleotides #1257-21 and #1257-22 were phophorylated individually using T4 polynucleotide kinase and ATP, and were then mixed together, heated at 94° C. and allowed to slow cool to room temperature to form an oligonucleotide linker duplex containing NdeI and KpnI sticky ends. The phosphorylated linker duplex formed between oligonucleotides #1257-21 and #1257-22 containing NdeI and KpnI cohesive ends (see FIG. 11A) and the KpnI and BamHI digested and purified PCR product generated using oligo primers #1257-20 and #1257-19 (see above) was directionally inserted between two sites of the plasmid vector pAMG21, namely the NdeI site and BamHI site, using standard recominant DNA methodology (see FIG. 14 A and sequences below). The synthetic linker utilized E. coli codons and provided for a N-terminal methionine.

Two clones were selected and plasmid DNA isolated, and the human OPG insert was subsequently DNA sequence confirmed. The resulting pAMG21 plasmid containing amino acids 32-401 of the human OPG polypeptide immediately preceded in frame by a methionine is referred to as pAMG21-huOPG met[32-401] or pAMG21-huOPG met[32-401].

Oligo#1257-19

5′-TACGCACTGGATCCTTATAAGCAGCTTATTTTTACTGATTGGAC-3′ (SEQ ID NO:59)

Oligo#1257-20

5 ′-GTCCTCCTGGTACCTACCTAAAACAAC-3′ (SEQ ID NO:60)

Oligo#1257-21

5 ′-TATGGATGAAGAAACTTCTCATCAGCTGCTGTGTGATAAATGTCCGCCGGGTAC -3′ (SEQ ID NO:61)

Oligo#1257-22

5 ′-CCGGCGGACATTTATCACACAGCAGCTGATGAGAAGTTTCTTCATCCA-3′ (SEQ ID NO:121)

Cultures of pAMG21-huOPG met[32-401] in E. coli GM120 in 2XYT media containing 20 μg/ml kanamycin were incubated at 30° C. prior to induction. Induction of huOPG met[32-401] gene product expression from the luxPR promoter was achieved following the addition of the synthetic autoinducer N-(3-oxohexanoyl)-DL-homoserine lactone to the culture media to a final concentration of 30 ng/ml and cultures were incubated at either 30° C. or 37° C. for a further 6 hours. After 6 hours, the bacterial cultures were examined by microscopy for the presence of inclusion bodies and were then pelletted by centrifugation. Refractile inclusion bodies were observed in induced cultures indicating that some of the recombinant huOPG met[32-401] gene product was produced insolubly in E. coli. Some bacterial pellets were resuspended in 10 mM Tris-HCl/pH8, 1 mM EDTA and lysed directly by addition of 2×Laemlli sample buffer to 1×final, and β-mercaptoethanol to 5% final concentration, and analyzed by SDS-PAGE. A substantially more intense coomassie stained band of approximately 42 kDa was observed on a SDS-PAGE gel containing total cell lysates of 30° C. and 37° C. induced cultures versus lane 2 which is a total cell lysate of a 30° C. uninduced culture (FIG. 14 B). The expected gene product would be 370 amino acids in length and have an expected molecular weight of about 42.2 kDa. Following induction at 37° C. for 6 hours, an additional culture was pelleted and either processed for isolation of inclusion bodies (see below) or processed by microfluidizing. The pellet processed for microfluidizing was resuspended in 25 mM Tris-HCl/pH8, 0.5 M NaCl buffer and passed 20 times through a Microfluidizer Model 1108 (Microfluidics Corp.) and collected. An aliquot was removed of the collected sample (microfluidized total lysate), and the remainder was pelleted at 20,000×g for 20 minutes. The supernatant following centrifugation was removed (microfluidized soluble fraction) and the pellet resuspended in a 25 mM Tris-HCl/pH8, 0.5M NaCl, 6M urea solution (microfluidized insoluble fraction). To an aliquot of either the total soluble, or insoluble fraction was added to an equal volume of 2×Laemalli sample buffer and β-mercaptoethanol to 5% final concentration. The samples were then analyzed by SDS-PAGE. A significant amount of recombinant huOPG met[32-401] gene product appeared to be found in the insoluble fraction. To purify the recombinant protein inclusion bodies were purified as follows: Bacterial cells were separated from media by density gradient centrifugation in a Beckman J-6B centrifuge equipped with a JS-4.2 rotor at 4,900×g for 15 minutes at 4° C. The bacterial pellet was resuspended in 5 ml of water and then diluted to a final volume of 10 ml with water. This suspension was transferred to a stainless steel cup cooled in ice and subjected to sonic disruption using a Branson Sonifier equipped with a standard tip (power setting=5, duty cycle=95%, 80 bursts). The sonicated cell suspension was centrifuged in a Beckman Optima TLX ultracentrifuge equipped with a TLA 100.3 rotor at 195,000×g for 5 to 10 minutes at 23° C. The supernatant was discarded and the pellet rinsed with a stream of water from a squirt bottle. The pellets were collected by scraping with a micro spatula and transferred to a glass homogenizer (15 ml capacity). Five ml of Percoll solution (75% liquid Percoll, 0.15 M sodium chloride) was added to the homogenizer and the contents are homogenized until uniformly suspended. The volume was increased to 19.5 ml by the addition of Percoll solution, mixed, and distributed into 3 Beckman Quick-Seal tubes (13×32 mm). Tubes were sealed according to manufacturers instructions. The tubes were spun in a Beckman TLA 100.3 rotor at 23° C., 20,000 rpm (21,600×g), 30 minutes. The tubes were examined for the appropriate banding pattern. To recover the refractile bodies, gradient fractions were recovered and pooled, then diluted with water. The inclusion bodies were pelleted by centrifugation, and the protein concentration estimated following SDS-PAGE.

An aliquot of inclusion bodies isolated as described below was dissolved into 1×Laemlli sample buffer with 5% β-mercaptoethanol and resolved on a SDS-PAGE gel and the isolated inclusion bodies provide a highly purified recombinant huOPG[32-401] gene product. The major ˜42 kDa band observed after resolving inclusion bodies on a SDS-polyacrylamide gel was excised from a separate gel and the N-terminal amino acid sequence determined essentially as described (Matsudaira et al. J. Biol. Chem. 262, 10-35 (1987)). The following sequence was determined after 19 cycles:

NH 2 -MDEETSHQLLCDKCPPGTY-COOH (SEQ ID NO:62)

This sequence was found to be identical to the first 19 amino acids encoded by the pAMG21 Hu-OPG met[32-401] expression vector, produced by a methionine residue provided by the bacterial expression vector.

C. Human OPG met [22-401]

A DNA sequence coding for an N-terminal methionine and amino acids 22 through 401 of human OPG was placed under control of the luxPR promoter in a prokaryotic plasmid expression vector pAMG21 as follows. Isolated plasmid DNA of pAMG21-huOPG met[32-401] (see Section B) was cleaved with KpnI and BamHI restriction endonucleases and the resulting fragments were resolved on an agarose gel. The B fragment (˜1064 bp fragment) was isolated from the gel using standard methodology. Synthetic oligonucleotides (oligos) #1267-06 and #1267-07 were phosphorylated individually and allowed to form an oligo linker duplex, which contained NdeI and KpnI cohesive ends, using methods described in Section B. The synthetic linker duplex utilized E. coli codons and provided for an N-terminal methionine. The phosphorylated oligo linker containing NdeI and KpnI cohesive ends and the isolated ˜1064 bp fragment of pAMG21-huOP met[32-401] digested with KpnI and BamHI restriction endonucleases were directionally inserted between the NdeI and BamHI sites of pAMG21 using standard recombinant DNA methodology. The ligation mixture was transformed into E. coli host 393 by electroporation utilizing the manufacturer's protocol. Clones were selected, plasmid DNA was isolated, and DNA sequencing was performed to verify the DNA sequence of the huOPG-met[22-401] gene.

Cultures of pAMG21-huOPG-met[22-401] in E. coli host 393 were placed in 2XYT media containing 20 μg/ml kanamycin and were incubated at 30° C. prior to induction. Induction of recombinant gene product expression from the luxPR promoter of vector pAMG21 was achieved following the addition of the synthetic autoinducer N-(3-oxohexanoyl)-DL-homoserine lactone to the culture media to a final concentration of 30 ng/ml and incubation at either 30° C. or 37° C. for a further 6 hours. After 6 hours, bacterial cultures were pelleted by centrifugation (=30° C. I+6 or 37° C. I+6). Bacterial cultures were also either pelleted just prior to induction (=30° C. PreI) or alternatively no autoinducer was added to a separate culture which was allowed to incubate at 30° C. for a further 6 hours to give an uninduced (UI) culture (=30° C. UI) . Bacterial pellets of either 30° C. PreI, 30° C. UI, 30° C. I+6, or 37° C. I+6 cultures were resuspended, lysed, and analyzed by SDS-polyacrylamide gel electrophoresis (PAGE) as described in Section B. Polyacrylamide gels were either stained with coomassie blue and/or Western transferred to nitrocellulose and immunoprobed with rabbit anti-mu OPG-Fc polyclonal antibody as described in Example 10. The level of gene product following induction compared to either an uninduced (30° C. UI) or pre-induction (30° C. PreI) sample.

D. Murine OPG met[ 22-401]

A DNA sequence coding for an N-terminal methionine and amino acids 22 through 401 of the murine (mu) OPG (OPG) polypeptide was placed under control of the luxPR promoter in a prokaryotic plasmid expression vector pAMG21 as follows. PCR was performed using oligonucleotides #1257-16 and #1257-15 as primers, plasmid pRcCMV-Mu OPG DNA as a template and thermocycling conditions as described in Section B. The PCR product was purified and cleaved with KpnI and BamHI restriction endonucleases as described in Section B. Synthetic oligos #1260-61 and #1260-82 were phosphorylated individually and allowed to form an oligo linker duplex with NdeI and KpnI cohesive ends using methods described in Section B. The synthetic linker duplex utilized E. coli codons and provided for an N-terminal methionine. The phosphorylated linker duplex formed between oligos #1260-61 and #1260-82 containing NdeI and KpnI cohesive ends and the KpnI and BamHI digested and purified PCR product generated using oligo primers #1257-16 and #1257-15 were directionally inserted between the NdeI and BamHI sites of pAMG21 using standard methodology. The ligation mixture was transformed into E. coli host 393 by electroporation utilizing the manufacturer's protocol. Clones were selected, plamid DNA was isolated, and DNA sequencing was performed to verify the DNA sequence of the MuOPG met[22-401] gene.

Expression of recombinant muOPG met[22-401] polypeptide from cultures of 393 cells harboring plasmid pAMG21-MuOPG met[22-401] following induction was determined using methods described in Section C.

E. Murine OPG met [32-401]

A DNA sequence coding for an N-terminal methionine and amino acids 32 through 401 of murine OPG was placed under control of the luxPR promoter in a prokaryotic plasmid expression vector pAMG21 as follows. To accomplish this, Synthetic oligos #1267-08 and #1267-09 were phosphorylated individually and allowed to form an oligo linker duplex using methods described in Section B. The synthetic linker duplex utilized E. coli codons and provided for an N-terminal methionine. The phosphorylated linker duplex formed between oligos #1267-08 and #1267-09 containing NdeI and KpnI cohesive ends, and the KpnI and BamHI digested and purified PCR product described earlier (see Section D), was directionally inserted between the NdeI and BamHI sites of pAMG21 using standard methodology. The ligation mixture was transformed into E. coli host 393 by electroporation utilizing the manufacturer's protocol. Clones were selected, plamid DNA was isolated, and DNA sequencing was performed to verify the DNA sequence of the muOPG-met[32-401] gene.

Expression of recombinant muOPG-met [32-401] polypeptide from cultures of 393 cells harboring the pAMG21 recombinant plasmid following induction was determined using methods described in Section C.

F. Murine OPG met-lys[ 22-401]

A DNA sequence coding for an N-terminal methionine followed by a lysine residue and amino acids 22 through 401 of murine OPG was placed under control of the lux PR promoter in prokaryotic expression vector pAMG21 as follows. Synthetic oligos # 1282-95 and #1282-96 were phosphorylated individually and allowed to form an oligo linker duplex using methods described in Section B. The synthetic linker duplex utilized E. coli codons and provided for an N-terminal methionine. The phosphorylated linker duplex formed between oligos #1282-95 and #1282-96 containing NdeI and KpnI cohesive ends and the KpnI and BamHI digested and purified PCR product described in Section D was directionally inserted between the NdeI and BamHI sites in pAMG21 using standard methodology. The ligation mixture was transformed into E. coli host 393 by electroporation utilizing the manufacturer's protocol. Clones were selected, plasmid DNA was isolated, and DNA sequencing was performed to verify the DNA sequence of the MuOPG-Met-Lys[22-401] gene.

Expression of recombinant MuOPG Met-Lys[22-401] polypeptide from transformed 393 cells harboring the recombinant pAMG21 plasmid following induction was determined using methods described in Section C.

G. Murine OPG met-lys-(his) 7[ 22-401]

A DNA sequence coding for N-terminal residues Met-Lys-His-His-His-His-His-His-His (=MKH) followed by amino acids 22 through 401 of Murine OPG was placed under control of the lux PR promoter in prokaryotic expression vector pAMG21 as follows. PCR was performed using oligonucleotides #1300-50 and #1257-15 as primers and plasmid pAMG21-muOPG-met[22-401] DNA as template. Thermocycling conditions were as described in Section B. The resulting PCR sample was resolved on an agarose gel, the PCR product was excised, purified, cleaved with NdeI and BamHI restriction endonucleases and purified. The NdeI and BamHI digested and purified PCR product generated using oligo primers #1300-50 and #1257-15 was directionally inserted between the NdeI and BamHI sites of pAMG21 using standard DNA methodology. The ligation mixture was transformed into E. coli host 393 by electroporation utilizing the manufacturer's protocol. Clones were selected, plasmid DNA was isolated, and DNA sequencing performed to verify the DNA sequence of the muOPG-MKH[22-401] gene.

Expression of recombinant MuOPG-MKH[22-401] polypeptide from transformed 393 cultures harboring the recombinant pAMG21 plasmid following induction was determined using methods described in Section C.

Oligo #1257-15

(see Section D)

H. Murine OPG met-lys[22-401](his)7

A DNA sequence coding for a N-terminal met-lys, amino acids 22 through 401 murine OPG, and seven histidine residues following amino acid 401 (=muOPG MK[22-401]-H 7 ), was placed under control of the lux PR promoter in prokaryotic expression vector pAMG21 as follows. PCR was performed using oligonucleotides #1300-49 and #1300-51 as primers and pAMG21-muOPG met[22-401] DNA as template. Thermocycling conditions were as described in Section B. The resulting PCR sample was resolved on an agarose gel, the PCR product was excised, purified, restricted with NdeI and BamHI restriction endonucleases, and purified. The NdeI and BamHI digested and purified PCR product was directionally inserted between the NdeI and BamHI sites in pAMG21 using standard methodology. The ligation was transformed into E. coli host 393 by electroporation utilizing the manufacturer's protocol. Clones were selected, plasmid DNA was isolated, and DNA sequencing was performed to verify the DNA sequence of the muOPG MK[22-401]-H 7 gene.

Expression of the recombinant muOPG MK-[22-401]-H 7 polypeptide from a transformed 393 cells harboring the recombinant pAMG21 plasmid following induction was determined using methods described in

I. Murine OPG met[27-401]

A DNA sequence coding for a N-terminal methionine and amino acids 27 through 401 of murine OPG was placed under control of the lux PR promoter of prokaryotic expression vector pAMG21 as follows. PCR was performed with oligonucleotides #1309-74 and #1257-15 as primers and plasmid pAMG21-muOPG-met[22-401] DNA as template. Thermocycling conditions were as described in Section B. The resulting PCR sample was resolved on an agarose gel, the PCR product was excised, purified, cleaved with NdeI and BamHI restriction endonucleases, and purified. The NdeI and BamHI digested and purified PCR product was directionally inserted between the NdeI and BamHI sites of pAMG21 using standard methodology. The ligation mixture was transformed into E. coli host 393 by electroporation utilizing the manufacturer's protocol. Clones were selected, plasmid DNA was isolated, and DNA sequencing was performed to verify the DNA sequence of the muOPG-met[27-401] gene.

Expression of recombinant muOPG-met[27-401] polypeptide from a transfected 393 culture harboring the recombinant pAMG21 plasmid following induction was determined using methods described in Section C.

Oligo#1257-15

(See Section D)

J. Human OPG met[27-401]

A DNA sequence coding for a N-terminal methionine and amino acids 27 through 401 of human OPG was placed under control of the lux PR promoter of prokaryotic expression vector pAMG21 as follows. PCR was performed using oligonucleotides #1309-75 and #1309-76 as primers and plasmid pAMG21-huOPG-met[22-401] DNA as template. Thermocycling conditios were as described in Section B. The resulting PCR sample was resolved on an agarose gel, the PCR product was excised, purified, restricted with AseI and BamHI restriction endonucleases, and purified. The AseI and BamHI digested and purified PCR product above was directionally inserted between the NdeI and BamHI sites of pAMG21 using standard methodology. The ligation mixture was transformed into E. coli host 393 by electroporation utilizing the manufacturer's protocol. Clones were selected, plasmid DNA was isolated, and DNA sequencing was performed to verify the DNA sequence of the huOPG-met[27-401] gene.

Expression of the recombinant huOPG-met[27-401] polypeptide following induction of from transfected 393 cells harboring the recombinant pAMG21 plasmid was determined using methods described in Section C.

K. Murine OPG met[22-180]

A DNA sequence coding for a N-terminal methionine and amino acids 22 through 180 of murine OPG was placed under control of the lux PR promoter of prokaryotic expression vector pAMG21 as follows. PCR was performed with oligonucleotides #1309-72 and #1309-73 as primers and plasmid pAMG21-muOPG-met[22-401] DNA as template. Thermocycling conditions were as described in Section B. The resulting PCR sample was resolved on an agarose gel, the PCR product was excised, purified, restricted with NdeI and BamHI restriction endonucleases, and purified. The NdeI and BamHI digested and purified PCR product above was directionally inserted between the NdeI and BamHI sites of pAMG21 using standard methodology. The ligation was transformed into E. coli host 393 by electroporation utilizing the manufacturer's protocol. Clones were selected, plasmid DNA was isolated, and DNA sequencing was performed to verify the DNA sequence of the muOPG-met[22-180] gene.

Expression of recombinant muOPG-met[22-180] polypeptide from transformed 393 cultures harboring the recombinant pAMG21 plasmid following induction was determined using methods described in Section C.

L. Murine OPG met[27-180]

A DNA sequence coding for a N-terminal methionine and amino acids 27 through 180 of murine OPG was placed under the control of the lux PR promoter of prokaryotic expression vector pAMG21 as follows. PCR was performed using oligonucleotides #1309-74 (see Section I) and #1309-73 (see Section K) as primers and plasmid pAMG21-muOPG met[22-401] DNA as template. Thermocycling conditions were as described in Section B. The resulting PCR sample was resolved on an agarose gel, the PCR product excised, purified, restricted with NdeI and BamHI restriction endonucleases, and purified. The NdeI and BamHI digested and purified PCR product above was directionally inserted between the NdeI and BamHI sites in pAMG21 using standard methodology. The ligation mixture was transformed into E. coli host 393 by electroporation utilizing the manufacturer's protocol. Clones were selected, plasmid DNA was isolated, and DNA sequencing was performed to verify the DNA sequence of the muOPG met [27-180] gene.

Expression of recombinant muOPG met [27-180] polypeptide from cultures of transformed 393 cells harboring the recombinant pAMG21 plasmid following induction was determined using methods described in Section C.

M. Murine OPG met[22-189]and met[22-194]

A DNA sequence coding for a N-terminal methionine and either amino acids 22 through 189, or 22 through 194 of murine OPG was placed under control of the lux PR promoter of prokaryotic expression vector pAMG21 as follows. The pair of synthetic oligonucleotides #1337-92 and #1337-93 (=muOPG-189 linker) or #1333-57 and #1333-58 (=muOPG-194 linker) were phosphorylated individually and allowed to form an oligo linker duplex pair using methods described in Section B. Purified plasmid DNA of pAMG21-muOPG-met[22-401] was cleaved with KpnI and BspEI restriction endonucleases and the resulting DNA fragments were resolved on an agarose gel. The ˜413 bp B fragment was isolated using standard recombinant DNA methodology. The phosphorylated oligo linker duplexes formed between either oligos #1337-92 and #1337-93 (muOPG-189 linker) or oligos #1333-57 and #1333-58 (muOPG-194 linker) containing BspEI and BamHI cohesive ends, and the isolated ˜413 bp B fragment of plasmid pAMG21-muOPG-met[22-401] digested with KpnI and BspEI restriction endonucleases above, was directionally inserted between the KpnI and BamHI sites of pAMG21-muOPG met[22-401] using standard methodology. Each ligation mixture was transformed into E. coli host 393 by electroporation utilizing the manufacturer's protocol. Clones were selected, plasmid DNA was isolated, and DNA sequencing was performed to verify the DNA sequence of either the muOPG-met [22-189] or muOPG-met [22-194] genes.

Expression of recombinant muOPG-met[22-189] and muOPG-met[22-194] polypeptides from recombinant pAMG21 plasmids transformed into 393 cells was determined using methods described in Section C.

N. Murine OPG met [27-189] and met [27-194]

A DNA sequence coding for a N-terminal methionine and either amino acids 27 through 189, or 27 through 194 of murine OPG was placed under control of the lux PR promoter of prokaryotic expression vector pAMG21 as follows. Phosphorylated oligo linkers either “muOPG-189 linker” or “muOPG-194 linker” (see Section M) containing BspEI and BamHI cohesive ends, and the isolated ˜413 bp B fragment of plasmid pAMG21-muOPG-met [22-401] digested with KpnI and BspEI restriction endonucleases were directionally inserted between the KpnI and BamHI sites of plasmid pAMG21-muOPG-met [27-401] using standard methodology. Each ligation was transformed into E. coli host 393 by electroporation utilizing the manufacturer's protocol. Clones were selected, plasmid DNA was isolated, and DNA sequencing was performed to verify the DNA sequence of either the muOPG met [27-189] or muOPG met [27-194] genes.

Expression of recombinant muOPG met [27-189] and muOPG met [27-194] following induction of 393 cells harboring recombinant pAMG21 plasmids was determined using methods described in Section C.

O. Human OPG met [22-185], met [22-189], met [22-194]

A DNA sequence coding for a N-terminal methionine and either amino acids 22 through 185, 22 through 189, or 22 through 194 of the human OPG polypeptide was placed under control of the lux PR promoter of prokaryotic expression vector pAMG21 as follows. The pair of synthetic oligonucleotides #1331-87 and #1331-88 (=huOPG-185 linker), #1331-89 and #1331-90 (=huOPG-189 linker), or #1331-91 & #1331-92 (=huOPG-194 linker) were phosphorylated individually and each allowed to form an oligo linker duplex pair using methods described in Section B. Purified plasmid DNA of pAMG21-huOPG-met [27-401] was restricted with KpnI and NdeI restriction endonucleases and the resulting DNA fragments were resolved on an agarose gel. The ˜407 bp B fragment was isolated using standard recombinant DNA methodology. The phophorylated oligo linker duplexes formed between either oligos #1331-87 and #1331-88 (huOPG-185 linker), oligos #1331-89 and #1331-90 (huOPG-189 linker), or oligos #1331-91 and #1331-92 (huOPG-194 linker)[each linker contains NdeI and BamHI cohesive ends], and the isolated ˜407 bp B fragment of plasmid pAMG21-huOPG-met [27-401] digested with KpnI and NdeI restriction endonucleases above, was directionally inserted between the KpnI and BamHI sites of plasmid pAMG21-huOPG-met [22-401] using standard methodology. Each ligation was transformed into E. coli host 393 by electroporation utilizing the manufacturer's protocol. Clones were selected, plasmid DNA was isolated, and DNA sequencing was performed to verify the DNA sequence of either the huOPG-met [22-185], huOPG-met [22-189], or huOPG-met [22-194] genes.

Expression of recombinant huOPG-met [22-185], huOPG-met [22-189] or huOPG-met [22-194] in transformed 393 cells harboring recombinant pAMG21 plasmids following induction was determined using methods described in Section C.

P. Human OPG met [27-185], met [27-189], met [27-194]

A DNA sequence coding for a N-terminal methionine and either amino acids 27 through 185, 27 through 189, or 27 through 194 of the human OPG polypeptide was placed under control of the lux PR promoter of prokaryotic expression vector pAMG21 as follows. Phosphorylated oligo linkers “huOPG-185 linker”, “huOPG-189 linker”, or “huOPG-194 linker” (See Section O) each containing NdeI and BamHI cohesive ends, and the isolated ˜407 bp B fragment of plasmid pAMG21-huOPG-met [27-401] digested with KpnI and NdeI restriction endonucleases (See Section O) were directionally inserted between the KpnI and BamHI sites of plasmid pAMG21-huOPG-met [27-401] (See Section J) using standard methodology. Each ligation was transformed into E. coli host 393 by electroporation utilizing the manufacturer's protocol. Clones were selected, plasmid DNA isolated, and DNA sequencing performed to verify the DNA sequence of either the huOPG-met [27-185], huOPG-met [27-189], or huOPG-met [27-194] genes.

Expression of recombinant huOPG-met [27-185], huOPG-met [27-189], and huOPG-met [27-194] from recombinant pAMG21 plasmids transformed into 393 cells was determined using methods described in Section C.

O. Murine OPG met [27-4011 (P33E, G36S, A45P)

A DNA sequence coding for an N-terminal methionine and amino acids 27 through 48 of human OPG followed by amino acid residues 49 through 401 of murine OPG was placed under control of the lux PR promoter of prokaryotic expression vector pAMG21 as follows. Purified plasmid DNA of pAMG21-huOPG-met [27-401] (See Section J) was cleaved with AatII and KpnI restriction endonucleases and a ˜1075 bp B fragment isolated from an agarose gel using standard recombinant DNA methodology. Additionally, plasmid pAMG21-muOPG-met [22-401] DNA (See Section D) was digested with KpnI and BamHI restriction endonucleases and the ˜1064 bp B fragment isolated as described above. The isolated ˜1075 bp pAMG21-huOPG-met [27-401] restriction fragment containing AatII & KpnI cohesive ends (see above), the ˜1064 bp pAMG21-muOPG-met [22-401] restriction fragment containing KpnI and BamHI sticky ends and a ˜5043 bp restriction fragment containing AatII and BamHI cohesive ends and corresponding to the nucleic acid sequence of pAMG21 between AatII & BamHI were ligated using standard recombinant DNA methodology. The ligation was transformed into E. coli host 393 by electroporation utilizing the manufacturer's protocol. Clones were selected, and the presence of the recombinant insert in the plasmid verified using standard DNA methodology. muOPG-27-401 (P33E, G36S, A45P) gene. Amino acid changes in muOPG from proline-33 to glutamic acid-33, glycine-36 to serine-36, and alanine-45 to proline-45, result from replacement of muOPG residues 27 through 48 with huOPG residues 27 through 48.

Expression of recombinant muOPG-met [27-401] (P33E, G36S, A45P) from transformed 393 cells harboring the recombinant pAMG21 plasmid was determined using methods described in Section C.

R. Murine OPG met-lys-(his) 7 -ala-ser-(asp) 4 -lys˜22-401](A45T)

A DNA sequence coding for an N-terminal His tag and enterokinase recognition sequence which is (NH 2 to COOH terminus): Met-Lys-His-His-His-His-His-His-His-Ala-Ser-Asp-Asp-Asp-Asp-Lys (=HEK) (SEQ ID NO: 145), followed by amino acids 22 through 401 of the murine OPG polypeptide was placed under control of the lac repressor regulated Ps4 promoter as follows. pAMAG22-His (See Section A) was digested with NheI and BamHI restriction endonucleases, and the large fragment (the A fragment) isolated from an agarose gel using standard recombinant DNA methodology. Oligonucleotides #1282-91 and #1282-92 were phosphorylated individually and allowed to form an oligo linker duplex using methods previously described (See Section B). The phosphorylated linker duplex formed between oligos #1282-91 and #1282-92 containing NheI and KpnI cohesive ends, the KpnI and BamHI digested and purified PCR product described (see Section D), and the A fragment of vector pAMG22-His digested with NheI and BamHI were ligated using standard recombinant DNA methodology. The ligation was transformed into E. coli host GM120 by electroporation utilizing the manufacturer's protocol. Clones were selected, plasmid DNA isolated and DNA sequencing performed to verify the DNA sequence of the muOPG-HEK[22-401] gene. DNA sequencing revealed a spurious mutation in the natural muOPG sequence that resulted in a single amino acid change of Alanine-45 of muOPG polypeptide to a Threonine.

Expression of recombinant muOPG-HEK[22-401] (A45T) from GM120 cells harboring the recombinant pAMG21 plasmid was determined using methods similar to those described in Section C, except instead of addition of the synthetic autoinducer, IPTG was added to 0.4 mM final to achieve induction.

S. Human OPG met-arg-aly-ser-(his) 6 [22-401]

Eight oligonucleotides (1338-09 to 1338-16 shown below) were designed to produce a 175 base fragment as overlapping, double stranded DNA. The oligos were annealed, ligated, and the 5′ and 3′ oligos were used as PCR primers to produce large quantities of the 175 base fragment. The final PCR gene products were digested with restriction endonucleases ClaI and KpnI to yield a fragment which replaces the N-terminal 28 codons of human OPG. The ClaI and KpnI digested PCR product was inserted into pAMG21-huOPG [27-401] which had also been cleaved with ClaI and KpnI. Ligated DNA was transformed into competent host cells of E. coli strain 393. Clones were screened for the ability to produce the recombinant protein product and to possess the gene fusion having the correct nucleotide sequence. Protein expression levels were determined from 50 ml shaker flask studies. Whole cell lysate and sonic pellet were analyzed for expression of the construct by Coomassie stained PAGE gels and Western analysis with murine anti-OPG antibody. Expression of huOPG Met-Arg-Gly-Ser-(His) 6 [22-401] resulting in the formation of large inclusion bodies and the protein was localized to the insoluble (pellet) fraction.

T. Human OPG met-lys[22-401] and met(lys) 3 [22-401]

To construct the met-lys and met-(lys) 3 versions of human OPG[22-401], overlapping oligonucleotides were designed to add the appropriate number of lysine residues. The two oligos for each construct were designed to overlap, allowing two rounds of PCR to produce the final product. The template for the first PCR reaction was a plasmid DNA preparation containing the human OPG 22-401 gene. The first PCR added the lysine residue(s). The second PCR used the product of the first round and added sequence back to the first restriction site, ClaI.

The final PCR gene products were digested with restriction endonucleases ClaI and KpnI, which replace the N-terminal 28 codons of hu OPG, and then ligated into plasmid pAMG21-hu OPG [27-401] which had been also digested with the two restriction endonucleases. Ligated DNA was transformed into competent host cells of E. coli strain 393. Clones were screened for the ability to produce the recombinant protein product and to possess the gene fusion having the correct nucleotide sequence. Protein expression levels were determined from 50 ml shaker flask studies. Whole cell lysate and sonic pellet were analyzed for expression of the construct by Coomassie stained PAGE gels and Western analysis with murine anti-OPG antibody. Neither construct had a detectable level of protein expression and inclusion bodies were not visible. The DNA sequences were confirmed by DNA sequencing.

Oligonucleotide primers to prepare Met-Lys huOPG[22-401]:

Oligonucleotide primers to prepare Met-(Lys) 3 -huOPG[22-401]:

U. Human and Murine OPG [22-401]/Fc Fusions

Four OPG-Fc fusions were constructed where the Fc region of human IgG1 was fused at the N-terminus of either human or murine Osteoprotegerin amino acids 22 to 401 (referred to as Fc/OPG [22-401]) or at the C-terminus (referred to as OPG[22-401]/Fc). Fc fusions were constructed using the fusion vector pFc-A3 described in Example 7.

All fusion genes were constructed using standard PCR technology. Template for PCR reactions were plasmid preparations containing the target genes. Overlapping oligos were designed to combine the C-terminal portion of one gene with the N terminal portion of the other gene. This process allows fusing the two genes together in the correct reading frame after the appropriate PCR reactions have been performed. Initially one “fusion” oligo for each gene was put into a PCR reaction with a universal primer for the vector carrying the target gene. The complimentary “fusion” oligo was used with a universal primer to PCR the other gene. At the end of this first PCR reaction, two separate products were obtained, with each individual gene having the fusion site present, creating enough overlap to drive the second round of PCR and create the desired fusion. In the second round of PCR, the first two PCR products were combined along with universal primers and via the overlapping regions, the full length fusion DNA sequence was produced.

The final PCR gene products were digested with restriction endonucleases XbaI and BamHI, and then ligated into the vector pAMG21 having been also digested with the two restriction endonucleases. Ligated DNA was transformed into competent host cells of E. coli strain 393. Clones were screened for the ability to produce the recombinant protein product and to possess the gene fusion having the correct nucleotide sequence. Protein expression levels were determined from 50 ml shaker flask studies. Whole cell lysate, sonic pellet, and supernatant were analyzed for expression of the fusion by Coomassie stained PAGE gels and Western analysis with murine anti-OPG antibody.

Fc/huOPG [22-401]

Expression of the Fc/hu OPG [22-401] fusion peptide was detected on a Coomassie stained PAGE gel and on a Western blot. The cells have very large inclusion bodies, and the majority of the product is in the insoluble (pellet) fraction. The following primers were used to construct this OPG-Fc fusion:

Fc/muOPG [22-401]

Expression of the fusion peptide was detected on a Coomassie stained gel and on a Western blot. The cells have very large inclusion bodies, and the majority of the product is in the insoluble (pellet) fraction. The following primers were used to construct this OPG-Fc fusion:

muOPG [22-401]/Fc

Expression of the fusion peptide was detected on a Coomassie stained gel and on a Western blot. The amount of recombinant product was less than the OPG fusion proteins having the Fc region in the N terminal position. Obvious inclusion bodies were not detected. Most of the product appeared to be in the insoluble (pellet) fraction. The following primers were used to construct this OPG-Fc fusion:

huOPG [22-401]/Fc

Expression of the fusion peptide was not detected on a Coomassie stained gel, although a faint Western positive signal was present. Obvious inclusion bodies were not detected. The following primers were used to prepare this OPG-Fc fusion:

V. Human OPG met[22-401]-Fc Fusion (P25A)

This construct combines a proline to alanine amino acid change at position 25 (P25A) with the huOPG met[22-401]-Fc fusion. The plasmid was digested with restriction endonucleases ClaI and KpnI, which removes the N-terminal 28 codons of the gene,and the resulting small (less than 200 base pair) fragment was gel purified. This fragment containing the proline to alanine change was then ligated into plasmid pAMG21-huOPG [22-401]-Fc fusion which had been digested with the two restriction endonucleases. The ligated DNA was transformed into competent host cells of E. coli strain 393. Clones were screened for the ability to produce the recombinant protein product and to possess the gene fusion having the correct nucleotide sequence. Protein expression levels were determined from 50 ml shaker flask studies. Whole cell lysate and sonic pellet were analyzed for expression of the construct by Coomassie stained PAGE gels and Western analysis with murine anti-OPG antibody. The expression level of the fusion peptide was detected on a Coomassie stained PAGE gel and on a Western blot. The protein was in the insoluble (pellet) fraction. The cells had large inclusion bodies.

W. Human OPG met[22-401] (P25A)

A DNA sequence coding for an N-terminal methionine and amino acids 22 through 401 of human OPG with the proline at position 25 being substituted by alanine under control of the lux P R promoter in prokaryotic expression vector pAMG21 was constructed as follows: Synthetic oligos #1289-84 and 1289-85 were annealed to form an oligo linker duplex with XbaI and KpnI cohesive ends. The synthetic linker duplex utilized optimal E. coli codons and encoded an N-terminal methionine. The linker also included an SpeI restriction site which was not present in the original sequence. The linker duplex was directionally inserted between the XbaI and KpnI sites in pAMG21-huOPG-22-401 using standard methods. The ligation mixture was introduced into E. coli host GM221 by transformation. Clones were initially screened for production of the recombinant protein. Plasmid DNA was isolated from positive clones and DNA sequencing was performed to verify the DNA sequence of the HuOPG-Met[22-401] (P25A) gene. The following oligonucleotides were used to generate the XbaI-KpnI linker:

X. Human OPG met[22-401] (P26A) and (P26D)

A DNA sequence coding for an N-terminal methionine and amino acids 22 through 401 of human OPG with the proline at position 26 being substituted by alanine under control of the lux P R promoter in prokaryotic expression vector pAMG21 was constructed as follows: Synthetic oligos #1289-86 and 1289-87 were annealed to form an oligo linker duplex with XbaI and SpeI cohesive ends. The synthetic linker duplex utilized optimal E. coli codons and encoded an N-terminal methionine. The linker duplex was directionally inserted between the XbaI and SpeI sites in pAMG21-huOPG[22-401] (P25A) using standard methods. The ligation mixture was introduced into E. coli host GM221 by transformation. Clones were initially screened for production of the recombinant protein. Plasmid DNA was isolated from positive clones and DNA sequencing was performed to verify the DNA sequence of the huOPG-met[22-401] (P26A) gene. One of the clones sequenced was found to have the proline at position 26 substituted by aspartic acid rather than alanine, and this clone was designated huOPG-met[22-401] (P26D). The following oligonucleotides were used to generate the XbaI-SpeI linker:

Y. Human OPG met[22-194] (P25A)

A DNA sequence coding for an N-terminal methionine and amino acids 22 through 194 of human OPG with the proline at position 25 being substituted by alanine under control of the lux P R promoter in prokaryotic expression vector pAMG21 was constructed as follows: The plasmids pAMG21-huOPG[27-194] and pAMG21-huOPG[22-401] (P25A) were each digested with KpnI and BamHI endonucleases. The 450 bp fragment was isolated from pAMG21-huOPG[27-194] and the 6.1 kbp fragment was isolated from pAMG21-huOPG[22-401] (P25A). These fragments were ligated together and introduced into E. coli host GM221 by transformation. Clones were initially screened for production of the recombinant protein. Plasmid DNA was isolated from positive clones and DNA sequencing was performed to verify the DNA sequence of the huOPG-Met[22-194] (P25A) gene.

Artificial Sequence

Synthetic Oligonucleotide

1

aaaggaagga aaaaagcggc cgctacannn nnnnnt 36

2

16

Artificial Sequence

Synthetic Oligonucleotide

2

tcgacccacg cgtccg 16

3

12

Artificial Sequence

Synthetic Oligonucleotide

3

gggtgcgcag gc 12

4

18

Artificial Sequence

Synthetic Oligonucleotide

4

tgtaaaacga cggccagt 18

5

18

Artificial Sequence

Synthetic Oligonucleotide

5

caggaaacag ctatgacc 18

6

20

Artificial Sequence

Synthetic Oligonucleotide

6

caattaaccc tcactaaagg 20

7

23

Artificial Sequence

Synthetic Oligonucleotide

7

gcattatgac ccagaaaccg gac 23

8

23

Artificial Sequence

Synthetic Oligonucleotide

8

aggtagcgcc cttcctcaca ttc 23

9

30

Artificial Sequence

Synthetic Oligonucleotide

9

gactagtccc acaatgaaca agtggctgtg 30

10

45

Artificial Sequence

Synthetic Oligonucleotide

10

ataagaatgc ggccgctaaa ctatgaaaca gcccagtgac cattc 45

11

21

Artificial Sequence

Synthetic Oligonucleotide

11

gcctctagaa agagctggga c 21

12

21

Artificial Sequence

Synthetic Oligonucleotide

12

cgccgtgttc catttatgag c 21

13

24

Artificial Sequence

Synthetic Oligonucleotide

13

atcaaaggca gggcatactt cctg 24

14

24

Artificial Sequence

Synthetic Oligonucleotide

14

gttgcactcc tgtttcacgg tctg 24

15

24

Artificial Sequence

Synthetic Oligonucleotide

15

caagacacct tgaagggcct gatg 24

16

24

Artificial Sequence

Synthetic Oligonucleotide

16

taacttttac agaagagcat cagc 24

17

33

Artificial Sequence

Synthetic Oligonucleotide

17

agcgcggccg catgaacaag tggctgtgct gcg 33

18

31

Artificial Sequence

Synthetic Oligonucleotide

18

agctctagag aaacagccca gtgaccattc c 31

19

24

Artificial Sequence

Synthetic Oligonucleotide

19

gtgaagctgt gcaagaacct gatg 24

20

24

Artificial Sequence

Synthetic Oligonucleotide

20

atcaaaggca gggcatactt cctg 24

21

24

Artificial Sequence

Synthetic Oligonucleotide

21

cagatcctga agctgctcag tttg 24

22

33

Artificial Sequence

Synthetic Oligonucleotide

22

agcgcggccg cggggaccac aatgaacaag ttg 33

23

33

Artificial Sequence

Synthetic Oligonucleotide

23

agctctagaa ttgtgaggaa acagctcaat ggc 33

24

39

Artificial Sequence

Synthetic Oligonucleotide

24

atagcggccg ctgagcccaa atcttgtgac aaaactcac 39

25

45

Artificial Sequence

Synthetic Oligonucleotide

25

tctagagtcg acttatcatt tacccggaga cagggagagg ctctt 45

26

38

Artificial Sequence

Synthetic Oligonucleotide

26

cctctgagct caagcttccg aggaccacaa tgaacaag 38

27

43

Artificial Sequence

Synthetic Oligonucleotide

27

cctctgcggc cgctaagcag cttattttca cggattgaac ctg 43

28

38

Artificial Sequence

Synthetic Oligonucleotide

28

cctctgagct caagcttccg aggaccacaa tgaacaag 38

29

24

Artificial Sequence

Synthetic Oligonucleotide

29

tccgtaagaa acagcccagt gacc 24

30

31

Artificial Sequence

Synthetic Oligonucleotide

30

cctctgcggc cgctgttgca tttcctttct g 31

31

19

Mus musculus

31

Glu Thr Leu Pro Pro Lys Tyr Leu His Tyr Asp Pro Glu Thr Gly His

1 5 10 15

Gln Leu Leu

32

21

Artificial Sequence

Synthetic Oligonucleotide

32

tcccttgccc tgaccactct t 21

33

34

Artificial Sequence

Synthetic Oligonucleotide

33

cctctgcggc cgcacacacg ttgtcatgtg ttgc 34

34

21

Artificial Sequence

Synthetic Oligonucleotide

34

tcccttgccc tgaccactct t 21

35

34

Artificial Sequence

Synthetic Oligonucleotide

35

cctctgcggc cgccttttgc gtggcttctc tgtt 34

36

34

Artificial Sequence

Synthetic Oligonucleotide

36

ctgagctcaa gcttggtttc cggggaccac aatg 34

37

38

Artificial Sequence

Synthetic Oligonucleotide

37

cctctgcggc cgctaagcag cttattttta ctgaatgg 38

38

37

Artificial Sequence

Synthetic Oligonucleotide

38

cctctgagct caagcttggt ttccggggac cacaatg 37

39

33

Artificial Sequence

Synthetic Oligonucleotide

39

cctctgcggc cgccagggta acatctattc cac 33

40

35

Artificial Sequence

Synthetic Oligonucleotide

40

ccgaagcttc caccatgaac aagtggctgt gctgc 35

41

40

Artificial Sequence

Synthetic Oligonucleotide

41

cctctgtcga ctattataag cagcttattt tcacggattg 40

42

21

Artificial Sequence

Synthetic Oligonucleotide

42

tcccttgccc tgaccactct t 21

43

35

Artificial Sequence

Synthetic Oligonucleotide

43

cctctgtcga cttaacacac gttgtcatgt gttgc 35

44

21

Artificial Sequence

Synthetic Oligonucleotide

44

tcccttgccc tgaccactct t 21

45

35

Artificial Sequence

Synthetic Oligonucleotide

45

cctctgtcga cttacttttg cgtggcttct ctgtt 35

46

1548

Artificial Sequence

Synthetic Oligonucleotide

46

tgcacgcatt gcatacgtac cagaggggta cgctctcatc ccttgacggt ccgtagttta 60

ttttgctttc cgagtcagct ttctgacccg gaaagcaaaa tagacaacaa acagccactt 120

gcgagaggac tcatcctgtt taggcggccc tcgcctaaac ttgcaacgct tcgttgccgg 180

gcctcccacc gcccgtcctg cgggcggtat ttgacggtcc gtagtttaat tcgtcttccg 240

gtaggactgc ctaccggaaa aacgcaaaga tgtttgagaa aacaaataaa aagatttatg 300

taagtttata cctgcagcat gaattgaaaa tttcataccc gttagttaac gaggacaatt 360

ttaacgaaat ctttatgaaa ccgtcgccaa acaacataac tcaaagtaaa cgcgtaacca 420

atttaccttt cactggcacg cgaatgatgt cggattataa aaactttata gggttctcga 480

aaaaggaagc gtacgggtgc gatttgtaag aaaaagagaa aaccaattta gcaacaaact 540

aaataataaa cgatataaat aaaaagctat taatagttga tctcttcctt gttaattacc 600

atacaagtat gtgcgtacat ttttatttga tagatatatc aacagaaaga gacttacacg 660

ttttgattcg taaggcttcg gtaataatcg tcatacttat ccctttgatt tgggtcacta 720

ttctggacta ctaaagcgaa gaaattaatg taaacctcta aaaaataaat gtcgtaacaa 780

aagtttatat aaggttaatt agccacttac taacctcaat cttattagat gatatcctag 840

tataaaataa tttaatcgca gtagtattat aacggaggta aaaaatccca ttaataggtc 900

ttaactttat agtctaaatt ggtatcttac tcctatttac tagcgctcat ttattataag 960

tgttacatgg taaaatcagt atagtctatt cgtaactaat tatagtaata acgaagatgt 1020

ccgaaattaa aataattaat aagacattca cagcagccgt aaatacagaa agtatgggta 1080

gagaaatagg aatggataac aaacagcgtt caaaacgcac aatatatagt aattttgcca 1140

ttatctaact gtaaactaag attatttaac ctaaaaacag tgtgataata tagcgaactt 1200

tatgttaaca aattgtattc atggacatcc tagcatgtcc aaatgcgttc ttttaccaaa 1260

caatatcagc taattagcta aactaagatc taaacaaaat tgattaattt cctccttatt 1320

gtataccaat tgcgcaacct taagctcgag tgatcacagc tggacgtccc atggtacctt 1380

cgaatgagct cctaggcgcc tttcttcttc ttcttcttct ttcgggcttt ccttcgactc 1440

aaccgacgac ggtggcgact cgttattgat cgtattgggg aaccccggag atttgcccag 1500

aactccccaa aaaacgactt tcctccttgg cgagaagtgc gagaagtg 1548

47

141

Artificial Sequence

Synthetic Oligonucleotide

47

ctaattccgc tctcacctac caaacaatgc ccccctgcaa aaaataaatt catataaaaa 60

acatacagat aaccatctgc ggtgataaat tatctctggc ggtgttgaca taaataccac 120

tggcggtgat actgagcaca t 141

48

55

Artificial Sequence

Synthetic Oligonucleotide

48

cgatttgatt ctagaaggag gaataacata tggttaacgc gttggaattc ggtac 55

49

49

Artificial Sequence

Synthetic Oligonucleotide

49

cgaattccaa cgcgttaacc atatgttatt cctccttcta gaatcaaat 49

50

1546

Artificial Sequence

Synthetic Oligonucleotide

50

51

47

Artificial Sequence

Synthetic Oligonucleotide

51

tatgaaacat catcaccatc accatcatgc tagcgttaac gcgttgg 47

52

50

Artificial Sequence

Synthetic Oligonucleotide

52

aactttgtag tagtggtagt ggtagtacga tcgcaattgc gcaaccttaa 50

53

141

Artificial Sequence

Synthetic Oligonucleotide

53

ctaattccgc tctcacctac caaacaatgc ccccctgcaa aaaataaatt catataaaaa 60

acatacagat aaccatctgc ggtgataaat tatctctggc ggtgttgaca taaataccac 120

tggcggtgat actgagcaca t 141

54

147

Artificial Sequence

Synthetic Oligonucleotide

54

tgcagattaa ggcgagagtg gatggtttgt tacgggggga cgttttttat ttaagtatat 60

tttttgtatg tctattggta gacgccacta tttaatagag accgccacaa ctgtatttat 120

ggtgaccgcc actatgactc gtgtagc 147

55

55

Artificial Sequence

Synthetic Oligonucleotide

55

cgatttgatt ctagaaggag gaataacata tggttaacgc gttggaattc ggtac 55

56

49

Artificial Sequence

Synthetic Oligonucleotide

56

taaactaaga tcttcctcct tattgtatac caattgcgca accttaagc 49

57

668

Artificial Sequence

Synthetic Oligonucleotide

57

tgcacgcatt gcatacgtac cagaggggta cgctctcatc ccttgacggt ccgtagttta 60

ttttgctttc cgagtcagct ttctgacccg gaaagcaaaa tagacaacaa acagccactt 120

gcgagaggac tcatcctgtt taggcggccc tcgcctaaac ttgcaacgct tcgttgccgg 180

gcctcccacc gcccgtcctg cgggcggtat ttgacggtcc gtagtttaat tcgtcttccg 240

gtaggactgc ctaccggaaa aacgcaaaga tgtttgagaa aacaaataaa aagatttatg 300

taagtttata cctgcagagt attaaaaatt ttttaagtaa actgtttacg attttaagaa 360

ctaattataa gagttaacac tcgcgagtgt taaatagcta aactaagatc taaactcaat 420

tgattaattt cctccttatt gtataccaat tgcgcaacct taagctcgag tgatcacagc 480

tggacgtccc atggtacctt cgaatgagct cctaggcgcc tttcttcttc ttcttcttct 540

ttcgggcttt ccttcgactc aaccgacgac ggtggcgact cgttattgat cgtattgggg 600

aaccccggag atttgcccag aactccccaa aaaacgactt tcctccttgg cgagaagtgc 660

gagaagtg 668

58

726

Artificial Sequence

Synthetic Oligonucleotide

58

gcgtaacgta tgcatggtct ccccatgcga gagtagggaa ctgccaggca tcaaataaaa 60

cgaaaggctc agtcgaaaga ctgggccttt cgttttatct gttgtttgtc ggtgaacgct 120

ctcctgagta ggacaaatcc gccgggagcg gatttgaacg ttgcgaagca acggcccgga 180

gggtggcggg caggacgccc gccataaact gccaggcatc aaattaagca gaaggggcct 240

cccaccgccc gtcctgcggg cggtatttga cggtccgtag tttaattcgt cttcgccatc 300

ctgacggatg gcctttttgc gtttctacaa actcttttgt ttatttttct aaatacattc 360

aaatatggac gtctcataat ttttaaaaaa ttcatttgac aaatgctaaa attcttgatt 420

aatattctca attgtgagcg ctcacaattt atcgatttga ttctagattt gttttaacta 480

attaaaggag gaataacata tggttaacgc gttggaattc gagctcacta gtgtcgacct 540

gcagggtacc atggaagctt actcgaggat ccgcggaaag aagaagaaga agaagaaagc 600

ccgaaaggaa gctgagttgg ctgctgccac cgctgagcaa taactagcat aaccccttgg 660

ggcctctaaa cgggtcttga ggggtttttt gctgaaagga ggaaccgctc ttcacgctct 720

tcacgc 726

59

44

Artificial Sequence

Synthetic Oligonucleotide

59

tacgcactgg atccttataa gcagcttatt tttactgatt ggac 44

60

27

Artificial Sequence

Synthetic Oligonucleotide

60

gtcctcctgg tacctaccta aaacaac 27

61

102

Artificial Sequence

Synthetic Oligonucleotide

61

tatggatgaa gaaacttctc atcagctgct gtgtgataaa tgtccgccgg gtacccggcg 60

gacatttatc acacagcagc tgatgagaag tttcttcatc ca 102

62

19

Homo sapiens

62

Met Asp Glu Glu Thr Ser His Gln Leu Leu Cys Asp Lys Cys Pro Pro

1 5 10 15

Gly Thr Tyr

63

84

Artificial Sequence

Synthetic Oligonucleotide

63

tatggaaact tttcctccaa aatatcttca ttatgatgaa gaaacttctc atcagctgct 60

gtgtgataaa tgtccgccgg gtac 84

64

78

Artificial Sequence

Synthetic Oligonucleotide

64

ccggcggaca tttatcacac agcagctgat gagaagtttc ttcatcataa tgaagatatt 60

ttggaggaaa agtttcca 78

65

44

Artificial Sequence

Synthetic Oligonucleotide

65

tacgcactgg atccttataa gcagcttatt ttcacggatt gaac 44

66

38

Artificial Sequence

Synthetic Oligonucleotide

66

gtgctcctgg tacctaccta aaacagcact gcacagtg 38

67

84

Artificial Sequence

Synthetic Oligonucleotide

67

tatggaaact ctgcctccaa aatacctgca ttacgatccg gaaactggtc atcagctgct 60

gtgtgataaa tgtgctccgg gtac 84

68

78

Artificial Sequence

Synthetic Oligonucleotide

68

ccggagcaca tttatcacac agcagctgat gaccagtttc cggatcgtaa tgcaggtatt 60

ttggaggcag agtttcca 78

69

54

Artificial Sequence

Synthetic Oligonucleotide

69

tatggaccca gaaactggtc atcagctgct gtgtgataaa tgtgctccgg gtac 54

70

48

Artificial Sequence

Synthetic Oligonucleotide

70

ccggagcaca tttatcacac agcagctgat gaccagtttc tgggtcca 48

71

87

Artificial Sequence

Synthetic Oligonucleotide

71

tatgaaagaa actctgcctc caaaatacct gcattacgat ccggaaactg gtcatcagct 60

gctgtgtgat aaatgtgctc cgggtac 87

72

81

Artificial Sequence

Synthetic Oligonucleotide

72

ccggagcaca tttatcacac agcagctgat gaccagtttc cggatcgtaa tgcaggtatt 60

ttggaggcag agtttctttc a 81

73

71

Artificial Sequence

Synthetic Oligonucleotide

73

gttctcctca tatgaaacat catcaccatc accatcatga aactctgcct ccaaaatacc 60

tgcattacga t 71

74

43

Artificial Sequence

Synthetic Oligonucleotide

74

gttctcctca tatgaaagaa actctgcctc caaaatacct gca 43

75

76

Artificial Sequence

Synthetic Oligonucleotide

75

tacgcactgg atccttaatg atggtgatgg tgatgatgta agcagcttat tttcacggat 60

tgaacctgat tcccta 76

76

47

Artificial Sequence

Synthetic Oligonucleotide

76

gttctcctca tatgaaatac ctgcattacg atccggaaac tggtcat 47

77

43

Artificial Sequence

Synthetic Oligonucleotide

77

gttctcctat taatgaaata tcttcattat gatgaagaaa ctt 43

78

40

Artificial Sequence

Synthetic Oligonucleotide

78

tacgcactgg atccttataa gcagcttatt tttactgatt 40

79

40

Artificial Sequence

Synthetic Oligonucleotide

79

gttctcctca tatggaaact ctgcctccaa aatacctgca 40

80

43

Artificial Sequence

Synthetic Oligonucleotide

80

tacgcactgg atccttatgt tgcatttcct ttctgaatta gca 43

81

18

Artificial Sequence

Synthetic Oligonucleotide

81

ccggaaacag ataatgag 18

82

18

Artificial Sequence

Synthetic Oligonucleotide

82

gatcctcatt atctgttt 18

83

30

Artificial Sequence

Synthetic Oligonucleotide

83

ccggaaacag agaagccacg caaaagtaag 30

84

30

Artificial Sequence

Synthetic Oligonucleotide

84

gatccttact tttgcgtggc ttctctgttt 30

85

12

Artificial Sequence

Synthetic Oligonucleotide

85

tatgttaatg ag 12

86

14

Artificial Sequence

Synthetic Oligonucleotide

86

gatcctcatt aaca 14

87

21

Artificial Sequence

Synthetic Oligonucleotide

87

tatgttccgg aaacagttaa g 21

88

23

Artificial Sequence

Synthetic Oligonucleotide

88

gatccttaac tgtttccgga aca 23

89

36

Artificial Sequence

Synthetic Oligonucleotide

89

tatgttccgg aaacagtgaa tcaactcaaa aataag 36

90

38

Artificial Sequence

Synthetic Oligonucleotide

90

gatccttatt tttgagttga ttcactgttt ccggaaca 38

91

100

Artificial Sequence

Synthetic Oligonucleotide

91

ctagcgacga cgacgacaaa gaaactctgc ctccaaaata cctgcattac gatccggaaa 60

ctggtcatca gctgctgtgt gataaatgtg ctccgggtac 100

92

92

Artificial Sequence

Synthetic Oligonucleotide

92

ccggagcaca tttatcacac agcagctgat gaccagtttc cggatcgtaa tgcaggtatt 60

ttggaggcag agtttctttg tcgtcgtcgt cg 92

93

26

Artificial Sequence

Synthetic Oligonucleotide

93

acaaacacaa tcgatttgat actaga 26

94

50

Artificial Sequence

Synthetic Oligonucleotide

94

tttgttttaa ctaattaaag gaggaataaa atatgagagg atcgcatcac 50

95

50

Artificial Sequence

Synthetic Oligonucleotide

95

catcaccatc acgaaacctt cccgccgaaa tacctgcact acgacgaaga 50

96

49

Artificial Sequence

Synthetic Oligonucleotide

96

aacctcccac cagctgctgt gcgacaaatg cccgccgggt acccaaaca 49

97

26

Artificial Sequence

Synthetic Oligonucleotide

97

tgtttgggta cccggcgggc atttgt 26

98

50

Artificial Sequence

Synthetic Oligonucleotide

98

cgcacagcag ctggtgggag gtttcttcgt cgtagtgcag gtatttcggc 50

99

49

Artificial Sequence

Synthetic Oligonucleotide

99

gggaaggttt cgtgatggtg atggtgatgc gatcctctca tattttatt 49

100

50

Artificial Sequence

Synthetic Oligonucleotide

100

cctcctttaa ttagttaaaa caaatctagt atcaaatcga ttgtgtttgt 50

101

59

Artificial Sequence

Synthetic Oligonucleotide

101

acaaacacaa tcgatttgat actagatttg ttttaactaa ttaaaggagg aataaaatg 59

102

48

Artificial Sequence

Synthetic Oligonucleotide

102

ctaattaaag gaggaataaa atgaaagaaa cttttcctcc aaaatatc 48

103

31

Artificial Sequence

Synthetic Oligonucleotide

103

tgtttgggta cccggcggac atttatcaca c 31

104

59

Artificial Sequence

Synthetic Oligonucleotide

104

acaaacacaa tcgatttgat actagatttg ttttaactaa ttaaaggagg aataaaatg 59

105

54

Artificial Sequence

Synthetic Oligonucleotide

105

ctaattaaag gaggaataaa atgaaaaaaa aagaaacttt tcctccaaaa tatc 54

106

31

Artificial Sequence

Synthetic Oligonucleotide

106

tgtttgggta cccggcggac atttatcaca c 31

107

44

Artificial Sequence

Synthetic Oligonucleotide

107

cagcccgggt aaaatggaaa cgtttcctcc aaaatatctt catt 44

108

44

Artificial Sequence

Synthetic Oligonucleotide

108

cgtttccatt ttacccgggc tgagcgagag gctcttctgc gtgt 44

109

45

Artificial Sequence

Synthetic Oligonucleotide

109

cgctcagccc gggtaaaatg gaaacgttgc ctccaaaata cctgc 45

110

39

Artificial Sequence

Synthetic Oligonucleotide

110

ccattttacc cgggctgagc gagaggctct tctgcgtgt 39

111

36

Artificial Sequence

Synthetic Oligonucleotide

111

gaaaataagc tgcttagctg cagctgaacc aaaatc 36

112

34

Artificial Sequence

Synthetic Oligonucleotide

112

cagctgcagc taagcagctt attttcacgg attg 34

113

36

Artificial Sequence

Synthetic Oligonucleotide

113

aaaaataagc tgcttagctg cagctgaacc aaaatc 36

114

35

Artificial Sequence

Synthetic Oligonucleotide

114

cagctgcagc taagcagctt atttttactg attgg 35

115

102

Artificial Sequence

Synthetic Oligonucleotide

115

ctagaaggag gaataacata tggaaacttt tgctccaaaa tatcttcatt atgatgaaga 60

aactagtcat cagctgctgt gtgataaatg tccgccgggt ac 102

116

94

Artificial Sequence

Synthetic Oligonucleotide

116

ccggcggaca tttatcacac agcagctgat gactagtttc ttcatcataa tgaagatatt 60

ttggagcaaa agtttccata tgttattcct cctt 94

117

62

Artificial Sequence

Synthetic Oligonucleotide

117

ctagaaggag gaataacata tggaaacttt tcctgctaaa tatcttcatt atgatgaaga 60

aa 62

118

62

Artificial Sequence

Synthetic Oligonucleotide

118

ctagtttctt catcataatg aagatattta gcaggaaaag tttccatatg ttattcctcc 60

tt 62

119

70

Homo sapiens

119

Ala Leu Leu Val Phe Leu Asp Ile Ile Glu Trp Thr Thr Gln Glu Thr

1 5 10 15

Phe Pro Pro Lys Tyr Leu His Tyr Asp Pro Glu Thr Gly Arg Gln Leu

20 25 30

Leu Cys Asp Lys Cys Ala Pro Gly Thr Tyr Leu Lys Gln His Cys Thr

35 40 45

Val Arg Arg Lys Thr Leu Cys Val Pro Cys Pro Asp Tyr Ser Tyr Thr

50 55 60

Asp Ser Trp His Thr Ser

65 70

120

120

Homo sapiens

120

His Ala Leu Pro Ala Gln Val Ala Phe Thr Pro Tyr Ala Pro Glu Pro

1 5 10 15

Gly Ser Thr Cys Arg Leu Arg Glu Tyr Tyr Asp Gln Thr Ala Gln Met

20 25 30

Cys Cys Ser Lys Cys Ser Pro Gly Gln His Ala Lys Val Phe Cys Thr

35 40 45

Lys Thr Ser Asp Thr Val Cys Asp Ser Cys Glu Asp Ser Thr Tyr Thr

50 55 60

Gln Leu Trp Asn Trp Val Pro Glu Cys Leu Ser Cys Gly Ser Arg Cys

65 70 75 80

Ser Ser Asp Gln Val Glu Thr Gln Ala Cys Thr Arg Glu Gln Asn Arg

85 90 95

Ile Cys Thr Cys Arg Pro Gly Trp Tyr Cys Ala Leu Ser Lys Gln Glu

100 105 110

Gly Cys Arg Leu Cys Ala Pro Leu

115 120

121

48

Artificial Sequence

Synthetic Oligonucleotide

121

ccggcggaca tttatcacac agcagctgat gagaagtttc ttcatcca 48

122

48

Artificial Sequence

Synthetic Oligonucleotide

122

acctacttct ttgaagagta gtcgacgaca cactatttac aggcggcc 48

123

atcaaaggca gggcatactt cctgttgccc agaccttata taaaacgtca tgttcgcctg 60

ggcagcagag aagcacctag cactggccca gcggctgccg cctgaggttt ccagaggacc 120

aca atg aac aag tgg ctg tgc tgt gca ctc ctg gtg ttc ttg gac atc 168

Met Asn Lys Trp Leu Cys Cys Ala Leu Leu Val Phe Leu Asp Ile

1 5 10 15

att gaa tgg aca acc cag gaa acc ttt cct cca aaa tac ttg cat tat 216

Ile Glu Trp Thr Thr Gln Glu Thr Phe Pro Pro Lys Tyr Leu His Tyr

20 25 30

gac cca gaa acc gga cgt cag ctc ttg tgt gac aaa tgt gct cct ggc 264

Asp Pro Glu Thr Gly Arg Gln Leu Leu Cys Asp Lys Cys Ala Pro Gly

35 40 45

acc tac cta aaa cag cac tgc aca gtc agg agg aag aca ctg tgt gtc 312

Thr Tyr Leu Lys Gln His Cys Thr Val Arg Arg Lys Thr Leu Cys Val

50 55 60

cct tgc cct gac tac tct tat aca gac agc tgg cac acg agt gat gaa 360

Pro Cys Pro Asp Tyr Ser Tyr Thr Asp Ser Trp His Thr Ser Asp Glu

65 70 75

tgc gtg tac tgc agc ccc gtg tgc aag gaa ctg cag acc gtg aaa cag 408

Cys Val Tyr Cys Ser Pro Val Cys Lys Glu Leu Gln Thr Val Lys Gln

80 85 90 95

gag tgc aac cgc acc cac aac cga gtg tgc gaa tgt gag gaa ggg cgc 456

Glu Cys Asn Arg Thr His Asn Arg Val Cys Glu Cys Glu Glu Gly Arg

100 105 110

tac ctg gag ctc gaa ttc tgc ttg aag cac cgg agc tgt ccc cca ggc 504

Tyr Leu Glu Leu Glu Phe Cys Leu Lys His Arg Ser Cys Pro Pro Gly

115 120 125

ttg ggt gtg ctg cag gct ggg acc cca gag cga aac acg gtt tgc aaa 552

Leu Gly Val Leu Gln Ala Gly Thr Pro Glu Arg Asn Thr Val Cys Lys

130 135 140

aga tgt ccg gat ggg ttc ttc tca ggt gag acg tca tcg aaa gca ccc 600

Arg Cys Pro Asp Gly Phe Phe Ser Gly Glu Thr Ser Ser Lys Ala Pro

145 150 155

tgt agg aaa cac acc aac tgc agc tca ctt ggc ctc ctg cta att cag 648

Cys Arg Lys His Thr Asn Cys Ser Ser Leu Gly Leu Leu Leu Ile Gln

160 165 170 175

aaa gga aat gca aca cat gac aat gta tgt tcc gga aac aga gaa gca 696

Lys Gly Asn Ala Thr His Asp Asn Val Cys Ser Gly Asn Arg Glu Ala

180 185 190

act caa aat tgt gga ata gat gtc acc ctg tgc gaa gag gca ttc ttc 744

Thr Gln Asn Cys Gly Ile Asp Val Thr Leu Cys Glu Glu Ala Phe Phe

195 200 205

agg ttt gct gtg cct acc aag att ata ccg aat tgg ctg agt gtt ctg 792

Arg Phe Ala Val Pro Thr Lys Ile Ile Pro Asn Trp Leu Ser Val Leu

210 215 220

gtg gac agt ttg cct ggg acc aaa gtg aat gca gag agt gta gag agg 840

Val Asp Ser Leu Pro Gly Thr Lys Val Asn Ala Glu Ser Val Glu Arg

225 230 235

ata aaa cgg aga cac agc tcg caa gag caa act ttc cag cta ctt aag 888

Ile Lys Arg Arg His Ser Ser Gln Glu Gln Thr Phe Gln Leu Leu Lys

240 245 250 255

ctg tgg aag cat caa aac aga gac cag gaa atg gtg aag aag atc atc 936

Leu Trp Lys His Gln Asn Arg Asp Gln Glu Met Val Lys Lys Ile Ile

260 265 270

caa gac att gac ctc tgt gaa agc agt gtg caa cgg cat atc ggc cac 984

Gln Asp Ile Asp Leu Cys Glu Ser Ser Val Gln Arg His Ile Gly His

275 280 285

gcg aac ctc acc aca gag cag ctc cgc atc ttg atg gag agc ttg cct 1032

Ala Asn Leu Thr Thr Glu Gln Leu Arg Ile Leu Met Glu Ser Leu Pro

290 295 300

ggg aag aag atc agc cca gac gag att gag aga acg aga aag acc tgc 1080

Gly Lys Lys Ile Ser Pro Asp Glu Ile Glu Arg Thr Arg Lys Thr Cys

305 310 315

aaa ccc agc gag cag ctc ctg aag cta ctg agc ttg tgg agg atc aaa 1128

Lys Pro Ser Glu Gln Leu Leu Lys Leu Leu Ser Leu Trp Arg Ile Lys

320 325 330 335

aat gga gac caa gac acc ttg aag ggc ctg atg tac gca ctc aag cac 1176

Asn Gly Asp Gln Asp Thr Leu Lys Gly Leu Met Tyr Ala Leu Lys His

340 345 350

ttg aaa gca tac cac ttt ccc aaa acc gtc acc cac agt ctg agg aag 1224

Leu Lys Ala Tyr His Phe Pro Lys Thr Val Thr His Ser Leu Arg Lys

355 360 365

acc atc agg ttc ttg cac agc ttc acc atg tac cga ttg tat cag aaa 1272

Thr Ile Arg Phe Leu His Ser Phe Thr Met Tyr Arg Leu Tyr Gln Lys

370 375 380

ctc ttt cta gaa atg ata ggg aat cag gtt caa tca gtg aag ata agc 1320

Leu Phe Leu Glu Met Ile Gly Asn Gln Val Gln Ser Val Lys Ile Ser

385 390 395

tgc tta tagttaggaa tggtcactgg gctgtttctt caggatgggc caacactgat 1376

Cys Leu

400

ggagcagatg gctgcttctc cggctcttga aatggcagtt gattcctttc tcatcagttg 1436

gtgggaatga agatcctcca gcccaacaca cacactgggg agtctgagtc aggagagtga 1496

ggcaggctat ttgataattg tgcaaagctg ccaggtgtac acctagaaag tcaagcaccc 1556

tgagaaagag gatattttta taacctcaaa cataggccct ttccttcctc tccttatgga 1616

tgagtactca gaaggcttct actatcttct gtgtcatccc tagatgaagg cctcttttat 1676

ttattttttt attctttttt tcggagctgg ggaccgaacc cagggccttg cgcttgcgag 1736

gcaagtgctc taccactgag ctaaatctcc aacccctgaa ggcctctttc tttctgcctc 1796

tgatagtcta tgacattctt ttttctacaa ttcgtatcag gtgcacgagc cttatcccat 1856

ttgtaggttt ctaggcaagt tgaccgttag ctatttttcc ctctgaagat ttgattcgag 1916

ttgcagactt ggctagacaa gcaggggtag gttatggtag tttatttaac agactgccac 1976

caggagtcca gtgtttcttg ttcctctgta gttgtaccta agctgactcc aagtacattt 2036

agtatgaaaa ataatcaaca aattttattc cttctatcaa cattggctag ctttgtttca 2096

gggcactaaa agaaactact atatggagaa agaattgata ttgcccccaa cgttcaacaa 2156

cccaatagtt tatccagctg tcatgcctgg ttcagtgtct actgactatg cgccctctta 2216

ttactgcatg cagtaattca actggaaata gtaataataa taatagaaat aaaatctaga 2276

ctccattgga tctctctgaa tatgggaata tctaacttaa gaagctttga gatttcagtt 2336

gtgttaaagg cttttattaa aaagctgatg ctcttctgta aaagttacta atatatctgt 2396

aagactatta cagtattgct atttatatcc atccag 2432

124

401

Rattus rattus

124

Met Asn Lys Trp Leu Cys Cys Ala Leu Leu Val Phe Leu Asp Ile Ile

1 5 10 15

Glu Trp Thr Thr Gln Glu Thr Phe Pro Pro Lys Tyr Leu His Tyr Asp

20 25 30

Pro Glu Thr Gly Arg Gln Leu Leu Cys Asp Lys Cys Ala Pro Gly Thr

35 40 45

Tyr Leu Lys Gln His Cys Thr Val Arg Arg Lys Thr Leu Cys Val Pro

50 55 60

Cys Pro Asp Tyr Ser Tyr Thr Asp Ser Trp His Thr Ser Asp Glu Cys

65 70 75 80

Val Tyr Cys Ser Pro Val Cys Lys Glu Leu Gln Thr Val Lys Gln Glu

85 90 95

Cys Asn Arg Thr His Asn Arg Val Cys Glu Cys Glu Glu Gly Arg Tyr

100 105 110

Leu Glu Leu Glu Phe Cys Leu Lys His Arg Ser Cys Pro Pro Gly Leu

115 120 125

Gly Val Leu Gln Ala Gly Thr Pro Glu Arg Asn Thr Val Cys Lys Arg

130 135 140

Cys Pro Asp Gly Phe Phe Ser Gly Glu Thr Ser Ser Lys Ala Pro Cys

145 150 155 160

Arg Lys His Thr Asn Cys Ser Ser Leu Gly Leu Leu Leu Ile Gln Lys

165 170 175

Gly Asn Ala Thr His Asp Asn Val Cys Ser Gly Asn Arg Glu Ala Thr

180 185 190

Gln Asn Cys Gly Ile Asp Val Thr Leu Cys Glu Glu Ala Phe Phe Arg

195 200 205

Phe Ala Val Pro Thr Lys Ile Ile Pro Asn Trp Leu Ser Val Leu Val

210 215 220

Asp Ser Leu Pro Gly Thr Lys Val Asn Ala Glu Ser Val Glu Arg Ile

225 230 235 240

Lys Arg Arg His Ser Ser Gln Glu Gln Thr Phe Gln Leu Leu Lys Leu

245 250 255

Trp Lys His Gln Asn Arg Asp Gln Glu Met Val Lys Lys Ile Ile Gln

260 265 270

Asp Ile Asp Leu Cys Glu Ser Ser Val Gln Arg His Ile Gly His Ala

275 280 285

Asn Leu Thr Thr Glu Gln Leu Arg Ile Leu Met Glu Ser Leu Pro Gly

290 295 300

Lys Lys Ile Ser Pro Asp Glu Ile Glu Arg Thr Arg Lys Thr Cys Lys

305 310 315 320

Pro Ser Glu Gln Leu Leu Lys Leu Leu Ser Leu Trp Arg Ile Lys Asn

325 330 335

Gly Asp Gln Asp Thr Leu Lys Gly Leu Met Tyr Ala Leu Lys His Leu

340 345 350

Lys Ala Tyr His Phe Pro Lys Thr Val Thr His Ser Leu Arg Lys Thr

355 360 365

Ile Arg Phe Leu His Ser Phe Thr Met Tyr Arg Leu Tyr Gln Lys Leu

370 375 380

Phe Leu Glu Met Ile Gly Asn Gln Val Gln Ser Val Lys Ile Ser Cys

385 390 395 400

Leu

125

ccttatataa acgtcatgat tgcctgggct gcagagacgc acctagcact gacccagcgg 60

ctgcctcctg aggtttcccg aggaccaca atg aac aag tgg ctg tgc tgc gca 113

Met Asn Lys Trp Leu Cys Cys Ala

1 5

ctc ctg gtg ctc ctg gac atc att gaa tgg aca acc cag gaa acc ctt 161

Leu Leu Val Leu Leu Asp Ile Ile Glu Trp Thr Thr Gln Glu Thr Leu

10 15 20

cct cca aag tac ttg cat tat gac cca gaa act ggt cat cag ctc ctg 209

Pro Pro Lys Tyr Leu His Tyr Asp Pro Glu Thr Gly His Gln Leu Leu

25 30 35 40

tgt gac aaa tgt gct cct ggc acc tac cta aaa cag cac tgc aca gtg 257

Cys Asp Lys Cys Ala Pro Gly Thr Tyr Leu Lys Gln His Cys Thr Val

45 50 55

agg agg aag aca ttg tgt gtc cct tgc cct gac cac tct tat acg gac 305

Arg Arg Lys Thr Leu Cys Val Pro Cys Pro Asp His Ser Tyr Thr Asp

60 65 70

agc tgg cac acc agt gat gag tgt gtg tat tgc agc cca gtg tgc aag 353

Ser Trp His Thr Ser Asp Glu Cys Val Tyr Cys Ser Pro Val Cys Lys

75 80 85

gaa ctg cag tcc gtg aag cag gag tgc aac cgc acc cac aac cga gtg 401

Glu Leu Gln Ser Val Lys Gln Glu Cys Asn Arg Thr His Asn Arg Val

90 95 100

tgt gag tgt gag gaa ggg cgt tac ctg gag atc gaa ttc tgc ttg aag 449

Cys Glu Cys Glu Glu Gly Arg Tyr Leu Glu Ile Glu Phe Cys Leu Lys

105 110 115 120

cac cgg agc tgt ccc ccg ggc tcc ggc gtg gtg caa gct gga acc cca 497

His Arg Ser Cys Pro Pro Gly Ser Gly Val Val Gln Ala Gly Thr Pro

125 130 135

gag cga aac aca gtt tgc aaa aaa tgt cca gat ggg ttc ttc tca ggt 545

Glu Arg Asn Thr Val Cys Lys Lys Cys Pro Asp Gly Phe Phe Ser Gly

140 145 150

gag act tca tcg aaa gca ccc tgt ata aaa cac acg aac tgc agc aca 593

Glu Thr Ser Ser Lys Ala Pro Cys Ile Lys His Thr Asn Cys Ser Thr

155 160 165

ttt ggc ctc ctg cta att cag aaa gga aat gca aca cat gac aac gtg 641

Phe Gly Leu Leu Leu Ile Gln Lys Gly Asn Ala Thr His Asp Asn Val

170 175 180

tgt tcc gga aac aga gaa gcc acg caa aag tgt gga ata gat gtc acc 689

Cys Ser Gly Asn Arg Glu Ala Thr Gln Lys Cys Gly Ile Asp Val Thr

185 190 195 200

ctg tgt gaa gag gcc ttc ttc agg ttt gct gtt cct acc aag att ata 737

Leu Cys Glu Glu Ala Phe Phe Arg Phe Ala Val Pro Thr Lys Ile Ile

205 210 215

cca aat tgg ctg agt gtt ttg gtg gac agt ttg cct ggg acc aaa gtg 785

Pro Asn Trp Leu Ser Val Leu Val Asp Ser Leu Pro Gly Thr Lys Val

220 225 230

aat gcc gag agt gta gag agg ata aaa cgg aga cac agc tca caa gag 833

Asn Ala Glu Ser Val Glu Arg Ile Lys Arg Arg His Ser Ser Gln Glu

235 240 245

caa acc ttc cag ctg ctg aag ctg tgg aaa cat caa aac aga gac cag 881

Gln Thr Phe Gln Leu Leu Lys Leu Trp Lys His Gln Asn Arg Asp Gln

250 255 260

gaa atg gtg aag aag atc atc caa gac att gac ctc tgt gaa agc agc 929

Glu Met Val Lys Lys Ile Ile Gln Asp Ile Asp Leu Cys Glu Ser Ser

265 270 275 280

gtg cag cgg cat ctc ggc cac tcg aac ctc acc aca gag cag ctt ctt 977

Val Gln Arg His Leu Gly His Ser Asn Leu Thr Thr Glu Gln Leu Leu

285 290 295

gcc ttg atg gag agc ctg cct ggg aag aag atc agc cca gaa gag att 1025

Ala Leu Met Glu Ser Leu Pro Gly Lys Lys Ile Ser Pro Glu Glu Ile

300 305 310

gag aga acg aga aag acc tgc aaa tcg agc gag cag ctc ctg aag cta 1073

Glu Arg Thr Arg Lys Thr Cys Lys Ser Ser Glu Gln Leu Leu Lys Leu

315 320 325

ctc agt tta tgg agg atc aaa aat ggt gac caa gac acc ttg aag ggc 1121

Leu Ser Leu Trp Arg Ile Lys Asn Gly Asp Gln Asp Thr Leu Lys Gly

330 335 340

ctg atg tat gcc ctc aag cac ttg aaa aca tcc cac ttt ccc aaa act 1169

Leu Met Tyr Ala Leu Lys His Leu Lys Thr Ser His Phe Pro Lys Thr

345 350 355 360

gtc acc cac agt ctg agg aag acc atg agg ttc ctg cac agc ttc aca 1217

Val Thr His Ser Leu Arg Lys Thr Met Arg Phe Leu His Ser Phe Thr

365 370 375

atg tac aga ctg tat cag aag ctc ttt tta gaa atg ata ggg aat cag 1265

Met Tyr Arg Leu Tyr Gln Lys Leu Phe Leu Glu Met Ile Gly Asn Gln

380 385 390

gtt caa tcc gtg aaa ata agc tgc tta taactaggaa tggtcactgg 1312

Val Gln Ser Val Lys Ile Ser Cys Leu

395 400

gctgtttctt ca 1324

126

401

Mus musculus

126

Met Asn Lys Trp Leu Cys Cys Ala Leu Leu Val Leu Leu Asp Ile Ile

1 5 10 15

Glu Trp Thr Thr Gln Glu Thr Leu Pro Pro Lys Tyr Leu His Tyr Asp

20 25 30

Pro Glu Thr Gly His Gln Leu Leu Cys Asp Lys Cys Ala Pro Gly Thr

35 40 45

Tyr Leu Lys Gln His Cys Thr Val Arg Arg Lys Thr Leu Cys Val Pro

50 55 60

Cys Pro Asp His Ser Tyr Thr Asp Ser Trp His Thr Ser Asp Glu Cys

65 70 75 80

Val Tyr Cys Ser Pro Val Cys Lys Glu Leu Gln Ser Val Lys Gln Glu

85 90 95

Cys Asn Arg Thr His Asn Arg Val Cys Glu Cys Glu Glu Gly Arg Tyr

100 105 110

Leu Glu Ile Glu Phe Cys Leu Lys His Arg Ser Cys Pro Pro Gly Ser

115 120 125

Gly Val Val Gln Ala Gly Thr Pro Glu Arg Asn Thr Val Cys Lys Lys

130 135 140

Cys Pro Asp Gly Phe Phe Ser Gly Glu Thr Ser Ser Lys Ala Pro Cys

145 150 155 160

Ile Lys His Thr Asn Cys Ser Thr Phe Gly Leu Leu Leu Ile Gln Lys

165 170 175

Gly Asn Ala Thr His Asp Asn Val Cys Ser Gly Asn Arg Glu Ala Thr

180 185 190

Gln Lys Cys Gly Ile Asp Val Thr Leu Cys Glu Glu Ala Phe Phe Arg

195 200 205

Phe Ala Val Pro Thr Lys Ile Ile Pro Asn Trp Leu Ser Val Leu Val

210 215 220

Asp Ser Leu Pro Gly Thr Lys Val Asn Ala Glu Ser Val Glu Arg Ile

225 230 235 240

Lys Arg Arg His Ser Ser Gln Glu Gln Thr Phe Gln Leu Leu Lys Leu

245 250 255

Trp Lys His Gln Asn Arg Asp Gln Glu Met Val Lys Lys Ile Ile Gln

260 265 270

Asp Ile Asp Leu Cys Glu Ser Ser Val Gln Arg His Leu Gly His Ser

275 280 285

Asn Leu Thr Thr Glu Gln Leu Leu Ala Leu Met Glu Ser Leu Pro Gly

290 295 300

Lys Lys Ile Ser Pro Glu Glu Ile Glu Arg Thr Arg Lys Thr Cys Lys

305 310 315 320

Ser Ser Glu Gln Leu Leu Lys Leu Leu Ser Leu Trp Arg Ile Lys Asn

325 330 335

Gly Asp Gln Asp Thr Leu Lys Gly Leu Met Tyr Ala Leu Lys His Leu

340 345 350

Lys Thr Ser His Phe Pro Lys Thr Val Thr His Ser Leu Arg Lys Thr

355 360 365

Met Arg Phe Leu His Ser Phe Thr Met Tyr Arg Leu Tyr Gln Lys Leu

370 375 380

Phe Leu Glu Met Ile Gly Asn Gln Val Gln Ser Val Lys Ile Ser Cys

385 390 395 400

Leu

127

gtatatataa cgtgatgagc gtacgggtgc ggagacgcac cggagcgctc gcccagccgc 60

cgctccaagc ccctgaggtt tccggggacc aca atg aac aag ttg ctg tgc tgc 114

Met Asn Lys Leu Leu Cys Cys

1 5

gcg ctc gtg ttt ctg gac atc tcc att aag tgg acc acc cag gaa acg 162

Ala Leu Val Phe Leu Asp Ile Ser Ile Lys Trp Thr Thr Gln Glu Thr

10 15 20

ttt cct cca aag tac ctt cat tat gac gaa gaa acc tct cat cag ctg 210

Phe Pro Pro Lys Tyr Leu His Tyr Asp Glu Glu Thr Ser His Gln Leu

25 30 35

ttg tgt gac aaa tgt cct cct ggt acc tac cta aaa caa cac tgt aca 258

Leu Cys Asp Lys Cys Pro Pro Gly Thr Tyr Leu Lys Gln His Cys Thr

40 45 50 55

gca aag tgg aag acc gtg tgc gcc cct tgc cct gac cac tac tac aca 306

Ala Lys Trp Lys Thr Val Cys Ala Pro Cys Pro Asp His Tyr Tyr Thr

60 65 70

gac agc tgg cac acc agt gac gag tgt cta tac tgc agc ccc gtg tgc 354

Asp Ser Trp His Thr Ser Asp Glu Cys Leu Tyr Cys Ser Pro Val Cys

75 80 85

aag gag ctg cag tac gtc aag cag gag tgc aat cgc acc cac aac cgc 402

Lys Glu Leu Gln Tyr Val Lys Gln Glu Cys Asn Arg Thr His Asn Arg

90 95 100

gtg tgc gaa tgc aag gaa ggg cgc tac ctt gag ata gag ttc tgc ttg 450

Val Cys Glu Cys Lys Glu Gly Arg Tyr Leu Glu Ile Glu Phe Cys Leu

105 110 115

aaa cat agg agc tgc cct cct gga ttt gga gtg gtg caa gct gga acc 498

Lys His Arg Ser Cys Pro Pro Gly Phe Gly Val Val Gln Ala Gly Thr

120 125 130 135

cca gag cga aat aca gtt tgc aaa aga tgt cca gat ggg ttc ttc tca 546

Pro Glu Arg Asn Thr Val Cys Lys Arg Cys Pro Asp Gly Phe Phe Ser

140 145 150

aat gag acg tca tct aaa gca ccc tgt aga aaa cac aca aat tgc agt 594

Asn Glu Thr Ser Ser Lys Ala Pro Cys Arg Lys His Thr Asn Cys Ser

155 160 165

gtc ttt ggt ctc ctg cta act cag aaa gga aat gca aca cac gac aac 642

Val Phe Gly Leu Leu Leu Thr Gln Lys Gly Asn Ala Thr His Asp Asn

170 175 180

ata tgt tcc gga aac agt gaa tca act caa aaa tgt gga ata gat gtt 690

Ile Cys Ser Gly Asn Ser Glu Ser Thr Gln Lys Cys Gly Ile Asp Val

185 190 195

acc ctg tgt gag gag gca ttc ttc agg ttt gct gtt cct aca aag ttt 738

Thr Leu Cys Glu Glu Ala Phe Phe Arg Phe Ala Val Pro Thr Lys Phe

200 205 210 215

acg cct aac tgg ctt agt gtc ttg gta gac aat ttg cct ggc acc aaa 786

Thr Pro Asn Trp Leu Ser Val Leu Val Asp Asn Leu Pro Gly Thr Lys

220 225 230

gta aac gca gag agt gta gag agg ata aaa cgg caa cac agc tca caa 834

Val Asn Ala Glu Ser Val Glu Arg Ile Lys Arg Gln His Ser Ser Gln

235 240 245

gaa cag act ttc cag ctg ctg aag tta tgg aaa cat caa aac aaa gcc 882

Glu Gln Thr Phe Gln Leu Leu Lys Leu Trp Lys His Gln Asn Lys Ala

250 255 260

caa gat ata gtc aag aag atc atc caa gat att gac ctc tgt gaa aac 930

Gln Asp Ile Val Lys Lys Ile Ile Gln Asp Ile Asp Leu Cys Glu Asn

265 270 275

agc gtg cag cgg cac att gga cat gct aac ctc acc ttc gag cag ctt 978

Ser Val Gln Arg His Ile Gly His Ala Asn Leu Thr Phe Glu Gln Leu

280 285 290 295

cgt agc ttg atg gaa agc tta ccg gga aag aaa gtg gga gca gaa gac 1026

Arg Ser Leu Met Glu Ser Leu Pro Gly Lys Lys Val Gly Ala Glu Asp

300 305 310

att gaa aaa aca ata aag gca tgc aaa ccc agt gac cag atc ctg aag 1074

Ile Glu Lys Thr Ile Lys Ala Cys Lys Pro Ser Asp Gln Ile Leu Lys

315 320 325

ctg ctc agt ttg tgg cga ata aaa aat ggc gac caa gac acc ttg aag 1122

Leu Leu Ser Leu Trp Arg Ile Lys Asn Gly Asp Gln Asp Thr Leu Lys

330 335 340

ggc cta atg cac gca cta aag cac tca aag acg tac cac ttt ccc aaa 1170

Gly Leu Met His Ala Leu Lys His Ser Lys Thr Tyr His Phe Pro Lys

345 350 355

act gtc act cag agt cta aag aag acc atc agg ttc ctt cac agc ttc 1218

Thr Val Thr Gln Ser Leu Lys Lys Thr Ile Arg Phe Leu His Ser Phe

360 365 370 375

aca atg tac aaa ttg tat cag aag tta ttt tta gaa atg ata ggt aac 1266

Thr Met Tyr Lys Leu Tyr Gln Lys Leu Phe Leu Glu Met Ile Gly Asn

380 385 390

cag gtc caa tca gta aaa ata agc tgc tta taactggaaa tggccattga 1316

Gln Val Gln Ser Val Lys Ile Ser Cys Leu

395 400

gctgtttcct cacaattggc gagatcccat ggatgataa 1355

128

401

Homo sapiens

128

Met Asn Lys Leu Leu Cys Cys Ala Leu Val Phe Leu Asp Ile Ser Ile

1 5 10 15

Lys Trp Thr Thr Gln Glu Thr Phe Pro Pro Lys Tyr Leu His Tyr Asp

20 25 30

Glu Glu Thr Ser His Gln Leu Leu Cys Asp Lys Cys Pro Pro Gly Thr

35 40 45

Tyr Leu Lys Gln His Cys Thr Ala Lys Trp Lys Thr Val Cys Ala Pro

50 55 60

Cys Pro Asp His Tyr Tyr Thr Asp Ser Trp His Thr Ser Asp Glu Cys

65 70 75 80

Leu Tyr Cys Ser Pro Val Cys Lys Glu Leu Gln Tyr Val Lys Gln Glu

85 90 95

Cys Asn Arg Thr His Asn Arg Val Cys Glu Cys Lys Glu Gly Arg Tyr

100 105 110

Leu Glu Ile Glu Phe Cys Leu Lys His Arg Ser Cys Pro Pro Gly Phe

115 120 125

Gly Val Val Gln Ala Gly Thr Pro Glu Arg Asn Thr Val Cys Lys Arg

130 135 140

Cys Pro Asp Gly Phe Phe Ser Asn Glu Thr Ser Ser Lys Ala Pro Cys

145 150 155 160

Arg Lys His Thr Asn Cys Ser Val Phe Gly Leu Leu Leu Thr Gln Lys

165 170 175

Gly Asn Ala Thr His Asp Asn Ile Cys Ser Gly Asn Ser Glu Ser Thr

180 185 190

Gln Lys Cys Gly Ile Asp Val Thr Leu Cys Glu Glu Ala Phe Phe Arg

195 200 205

Phe Ala Val Pro Thr Lys Phe Thr Pro Asn Trp Leu Ser Val Leu Val

210 215 220

Asp Asn Leu Pro Gly Thr Lys Val Asn Ala Glu Ser Val Glu Arg Ile

225 230 235 240

Lys Arg Gln His Ser Ser Gln Glu Gln Thr Phe Gln Leu Leu Lys Leu

245 250 255

Trp Lys His Gln Asn Lys Ala Gln Asp Ile Val Lys Lys Ile Ile Gln

260 265 270

Asp Ile Asp Leu Cys Glu Asn Ser Val Gln Arg His Ile Gly His Ala

275 280 285

Asn Leu Thr Phe Glu Gln Leu Arg Ser Leu Met Glu Ser Leu Pro Gly

290 295 300

Lys Lys Val Gly Ala Glu Asp Ile Glu Lys Thr Ile Lys Ala Cys Lys

305 310 315 320

Pro Ser Asp Gln Ile Leu Lys Leu Leu Ser Leu Trp Arg Ile Lys Asn

325 330 335

Gly Asp Gln Asp Thr Leu Lys Gly Leu Met His Ala Leu Lys His Ser

340 345 350

Lys Thr Tyr His Phe Pro Lys Thr Val Thr Gln Ser Leu Lys Lys Thr

355 360 365

Ile Arg Phe Leu His Ser Phe Thr Met Tyr Lys Leu Tyr Gln Lys Leu

370 375 380

Phe Leu Glu Met Ile Gly Asn Gln Val Gln Ser Val Lys Ile Ser Cys

385 390 395 400

Leu

129

139

Homo sapiens

129

Cys Pro Gln Gly Lys Tyr Ile His Pro Gln Asn Asn Ser Ile Cys Cys

1 5 10 15

Thr Lys Cys His Lys Gly Thr Tyr Leu Tyr Asn Asp Cys Pro Gly Pro

20 25 30

Gly Gln Asp Thr Asp Cys Arg Glu Cys Glu Ser Gly Ser Phe Thr Ala

35 40 45

Ser Glu Asn His Leu Arg His Cys Leu Ser Cys Ser Lys Cys Arg Lys

50 55 60

Glu Met Gly Gln Val Glu Ile Ser Ser Cys Thr Val Asp Arg Asp Thr

65 70 75 80

Val Cys Gly Cys Arg Lys Asn Gln Tyr Arg His Tyr Trp Ser Glu Asn

85 90 95

Leu Phe Gln Cys Phe Asn Cys Ser Leu Cys Leu Asn Gly Thr Val His

100 105 110

Leu Ser Cys Gln Glu Lys Gln Asn Thr Val Cys Thr Cys His Ala Gly

115 120 125

Phe Phe Leu Arg Glu Asn Glu Cys Val Ser Cys

130 135

130

139

Homo sapiens

130

Pro Pro Lys Tyr Leu His Tyr Asp Glu Glu Thr Ser His Gln Leu Leu

1 5 10 15

Cys Asp Lys Cys Pro Pro Gly Thr Tyr Leu Lys Gln His Cys Thr Ala

20 25 30

Lys Trp Lys Thr Val Cys Ala Pro Cys Pro Asp His Tyr Tyr Thr Asp

35 40 45

Ser Trp His Thr Ser Asp Glu Cys Leu Tyr Cys Ser Pro Val Cys Lys

50 55 60

Glu Leu Gln Tyr Val Lys Gln Glu Cys Asn Arg Thr His Asn Arg Val

65 70 75 80

Cys Glu Cys Lys Glu Gly Arg Tyr Leu Glu Ile Glu Phe Cys Leu Lys

85 90 95

His Arg Ser Cys Pro Pro Gly Phe Gly Val Val Gln Ala Gly Thr Pro

100 105 110

Glu Arg Asn Thr Val Cys Lys Arg Cys Pro Asp Gly Phe Phe Ser Asn

115 120 125

Glu Thr Ser Ser Lys Ala Pro Cys Arg Lys His

130 135

131

219

Homo sapiens

131

Met Leu Gly Ile Trp Thr Leu Leu Pro Leu Val Leu Thr Ser Val Ala

1 5 10 15

Arg Leu Ser Ser Lys Ser Val Asn Ala Gln Val Thr Asp Ile Asn Ser

20 25 30

Lys Gly Leu Glu Leu Arg Lys Thr Val Thr Thr Val Glu Thr Gln Asn

35 40 45

Leu Glu Gly Leu His His Asp Gly Gln Phe Cys His Lys Pro Cys Pro

50 55 60

Pro Gly Glu Arg Lys Ala Arg Asp Cys Thr Val Asn Gly Asp Glu Pro

65 70 75 80

Asp Cys Val Pro Cys Gln Glu Gly Lys Glu Tyr Thr Asp Lys Ala His

85 90 95

Phe Ser Ser Lys Cys Arg Arg Cys Arg Leu Cys Asp Glu Gly His Gly

100 105 110

Leu Glu Val Glu Ile Asn Cys Thr Arg Thr Gln Asn Thr Lys Cys Arg

115 120 125

Cys Lys Pro Asn Phe Phe Cys Asn Ser Thr Val Cys Glu His Cys Asp

130 135 140

Pro Cys Thr Lys Cys Glu His Gly Ile Ile Lys Glu Cys Thr Leu Thr

145 150 155 160

Ser Asn Thr Lys Cys Lys Glu Glu Gly Ser Arg Ser Asn Leu Gly Trp

165 170 175

Leu Cys Leu Leu Leu Leu Pro Ile Pro Leu Ile Val Trp Val Lys Arg

180 185 190

Lys Glu Val Gln Lys Thr Cys Arg Lys His Arg Lys Glu Asn Gln Gly

195 200 205

Ser His Glu Ser Pro Thr Leu Asn Pro Glu Thr

210 215

132

280

Homo sapiens

132

Met Gly Leu Ser Thr Val Pro Asp Leu Leu Leu Pro Leu Val Leu Leu

1 5 10 15

Glu Leu Leu Val Gly Ile Tyr Pro Ser Gly Val Ile Gly Leu Val Pro

20 25 30

His Leu Gly Asp Arg Glu Lys Arg Asp Ser Val Cys Pro Gln Gly Lys

35 40 45

Tyr Ile His Pro Gln Asn Asn Ser Ile Cys Cys Thr Lys Cys His Lys

50 55 60

Gly Thr Tyr Leu Tyr Asn Asp Cys Pro Gly Pro Gly Gln Asp Thr Asp

65 70 75 80

Cys Arg Glu Cys Glu Ser Gly Ser Phe Thr Ala Ser Glu Asn His Leu

85 90 95

Arg His Cys Leu Ser Cys Ser Lys Cys Arg Lys Glu Met Gly Gln Val

100 105 110

Glu Ile Ser Ser Cys Thr Val Asp Arg Asp Thr Val Cys Gly Cys Arg

115 120 125

Lys Asn Gln Tyr Arg His Tyr Trp Ser Glu Asn Leu Phe Gln Cys Phe

130 135 140

Asn Cys Ser Leu Cys Leu Asn Gly Thr Val His Leu Ser Cys Gln Glu

145 150 155 160

Lys Gln Asn Thr Val Cys Thr Cys His Ala Gly Phe Phe Leu Arg Glu

165 170 175

Asn Glu Cys Val Ser Cys Ser Asn Cys Lys Lys Ser Leu Glu Cys Thr

180 185 190

Lys Leu Cys Leu Pro Gln Ile Glu Asn Val Lys Gly Thr Glu Asp Ser

195 200 205

Gly Thr Thr Val Leu Leu Pro Leu Val Ile Phe Phe Gly Leu Cys Leu

210 215 220

Leu Ser Leu Leu Phe Ile Gly Leu Met Tyr Arg Tyr Gln Arg Trp Lys

225 230 235 240

Ser Lys Leu Tyr Ser Ile Val Cys Gly Lys Ser Thr Pro Glu Lys Glu

245 250 255

Gly Glu Leu Glu Gly Thr Thr Thr Lys Pro Leu Ala Pro Asn Pro Ser

260 265 270

Phe Ser Pro Thr Pro Gly Phe Thr

275 280

133

207

Homo sapiens

133

Met Leu Arg Leu Ile Ala Leu Leu Val Cys Val Val Tyr Val Tyr Gly

1 5 10 15

Asp Asp Val Pro Tyr Ser Ser Asn Gln Gly Lys Cys Gly Gly His Asp

20 25 30

Tyr Glu Lys Asp Gly Leu Cys Cys Ala Ser Cys His Pro Gly Phe Tyr

35 40 45

Ala Ser Arg Leu Cys Gly Pro Gly Ser Asn Thr Val Cys Ser Pro Cys

50 55 60

Glu Asp Gly Thr Phe Thr Ala Ser Thr Asn His Ala Pro Ala Cys Val

65 70 75 80

Ser Cys Arg Gly Pro Cys Thr Gly His Leu Ser Glu Ser Gln Pro Cys

85 90 95

Asp Arg Thr His Asp Arg Val Cys Asn Cys Ser Thr Gly Asn Tyr Cys

100 105 110

Leu Leu Lys Gly Gln Asn Gly Cys Arg Ile Cys Ala Pro Gln Thr Lys

115 120 125

Cys Pro Ala Gly Tyr Gly Val Ser Gly His Thr Arg Ala Gly Asp Thr

130 135 140

Leu Cys Glu Lys Cys Pro Pro His Thr Tyr Ser Asp Ser Leu Ser Pro

145 150 155 160

Thr Glu Arg Cys Gly Thr Ser Phe Asn Tyr Ile Ser Val Gly Phe Asn

165 170 175

Leu Tyr Pro Val Asn Glu Thr Ser Cys Thr Thr Thr Ala Gly His Asn

180 185 190

Glu Val Ile Lys Thr Lys Glu Phe Thr Val Thr Leu Asn Tyr Thr

195 200 205

134

227

Homo sapiens

134

Met Ala Pro Val Ala Val Trp Ala Ala Leu Ala Val Gly Leu Glu Leu

1 5 10 15

Trp Ala Ala Ala His Ala Leu Pro Ala Gln Val Ala Phe Thr Pro Tyr

20 25 30

Ala Pro Glu Pro Gly Ser Thr Cys Arg Leu Arg Glu Tyr Tyr Asp Gln

35 40 45

Thr Ala Gln Met Cys Cys Ser Lys Cys Ser Pro Gly Gln His Ala Lys

50 55 60

Val Phe Cys Thr Lys Thr Ser Asp Thr Val Cys Asp Ser Cys Glu Asp

65 70 75 80

Ser Thr Tyr Thr Gln Leu Trp Asn Trp Val Pro Glu Cys Leu Ser Cys

85 90 95

Gly Ser Arg Cys Ser Ser Asp Gln Val Glu Thr Gln Ala Cys Thr Arg

100 105 110

Glu Gln Asn Arg Ile Cys Thr Cys Arg Pro Gly Trp Tyr Cys Ala Leu

115 120 125

Ser Lys Gln Glu Gly Cys Arg Leu Cys Ala Pro Leu Arg Lys Cys Arg

130 135 140

Pro Gly Phe Gly Val Ala Arg Pro Gly Thr Glu Thr Ser Asp Val Val

145 150 155 160

Cys Lys Pro Cys Ala Pro Gly Thr Phe Ser Asn Thr Thr Ser Ser Thr

165 170 175

Asp Ile Cys Arg Pro His Gln Ile Cys Asn Val Val Ala Ile Pro Gly

180 185 190

Asn Ala Ser Arg Asp Ala Val Cys Thr Ser Thr Ser Pro Thr Arg Ser

195 200 205

Met Ala Pro Gly Ala Val His Leu Pro Gln Pro Val Ser Thr Arg Ser

210 215 220

Gln His Thr

225

135

197

Homo sapiens

135

Met Val Ser Leu Pro Arg Leu Cys Ala Leu Trp Gly Cys Leu Leu Thr

1 5 10 15

Ala Val His Leu Gly Gln Cys Val Thr Cys Ser Asp Lys Gln Tyr Leu

20 25 30

His Asp Gly Gln Cys Cys Asp Leu Cys Gln Pro Gly Ser Arg Leu Thr

35 40 45

Ser His Cys Thr Ala Leu Glu Lys Thr Gln Cys His Pro Cys Asp Ser

50 55 60

Gly Glu Phe Ser Ala Gln Trp Asn Arg Glu Ile Arg Cys His Gln His

65 70 75 80

Arg His Cys Glu Pro Asn Gln Gly Leu Arg Val Lys Lys Glu Gly Thr

85 90 95

Ala Glu Ser Asp Thr Val Cys Thr Cys Lys Glu Gly Gln His Cys Thr

100 105 110

Ser Lys Asp Cys Glu Ala Cys Ala Gln His Thr Pro Cys Ile Pro Gly

115 120 125

Phe Gly Val Met Glu Met Ala Thr Glu Thr Thr Asp Thr Val Cys His

130 135 140

Pro Cys Pro Val Gly Phe Phe Ser Asn Gln Ser Ser Leu Phe Glu Lys

145 150 155 160

Cys Tyr Pro Trp Thr Ser Cys Glu Asp Lys Asn Leu Glu Val Leu Gln

165 170 175

Lys Gly Thr Ser Gln Thr Asn Val Ile Cys Gly Leu Lys Ser Arg Met

180 185 190

Arg Ala Leu Leu Val

195

136

174

Homo sapiens

136

Met Asn Lys Trp Leu Cys Cys Ala Leu Leu Val Phe Leu Asp Ile Ile

1 5 10 15

Glu Trp Thr Thr Gln Glu Thr Phe Pro Pro Lys Tyr Leu His Tyr Asp

20 25 30

Pro Glu Thr Gly Arg Gln Leu Leu Cys Asp Lys Cys Ala Pro Gly Thr

35 40 45

Tyr Leu Lys Gln His Cys Thr Val Arg Arg Lys Thr Leu Cys Val Pro

50 55 60

Cys Pro Asp Tyr Ser Tyr Thr Asp Ser Trp His Thr Ser Asp Glu Cys

65 70 75 80

Val Tyr Cys Ser Pro Val Cys Lys Glu Leu Gln Thr Val Lys Gln Glu

85 90 95

Cys Asn Arg Thr His Asn Arg Val Cys Glu Cys Glu Glu Gly Arg Tyr

100 105 110

Leu Glu Leu Glu Phe Cys Leu Lys His Arg Ser Cys Pro Pro Gly Leu

115 120 125

Gly Val Leu Gln Ala Gly Thr Pro Glu Arg Asn Thr Val Cys Lys Arg

130 135 140

Cys Pro Asp Gly Phe Phe Ser Gly Glu Thr Ser Ser Lys Ala Pro Cys

145 150 155 160

Arg Lys His Thr Asn Cys Ser Ser Leu Gly Leu Leu Leu Ile

165 170

137

224

Homo sapiens

137

Met Gly Ala Gly Ala Thr Gly Arg Ala Met Asp Gly Pro Arg Leu Leu

1 5 10 15

Leu Leu Leu Leu Leu Gly Val Ser Leu Gly Gly Ala Lys Glu Ala Cys

20 25 30

Pro Thr Gly Leu Tyr Thr His Ser Gly Glu Cys Cys Lys Ala Cys Asn

35 40 45

Leu Gly Glu Gly Val Ala Gln Pro Cys Gly Ala Asn Gln Thr Val Cys

50 55 60

Glu Pro Cys Leu Asp Ser Val Thr Phe Ser Asp Val Val Ser Ala Thr

65 70 75 80

Glu Pro Cys Lys Pro Cys Thr Glu Cys Val Gly Leu Gln Ser Met Ser

85 90 95

Ala Pro Cys Val Glu Ala Asp Asp Ala Val Cys Arg Cys Ala Tyr Gly

100 105 110

Tyr Tyr Gln Asp Glu Thr Thr Gly Arg Cys Glu Ala Cys Arg Val Cys

115 120 125

Glu Ala Gly Ser Gly Leu Val Phe Ser Cys Gln Asp Lys Gln Asn Thr

130 135 140

Val Cys Glu Glu Cys Pro Asp Gly Thr Tyr Ser Asp Glu Ala Asn His

145 150 155 160

Val Asp Pro Cys Leu Pro Cys Thr Val Cys Glu Asp Thr Glu Arg Gln

165 170 175

Leu Arg Glu Cys Thr Arg Trp Ala Asp Ala Glu Cys Glu Glu Ile Pro

180 185 190

Gly Arg Trp Ile Thr Arg Ser Thr Pro Pro Glu Gly Ser Asp Ser Thr

195 200 205

Ala Pro Ser Thr Gln Glu Pro Glu Ala Pro Pro Glu Gln Asp Leu Ile

210 215 220

138

205

Homo sapiens

138

Met Tyr Val Trp Val Gln Gln Pro Thr Ala Phe Leu Leu Leu Gly Leu

1 5 10 15

Ser Leu Gly Val Thr Val Lys Leu Asn Cys Val Lys Asp Thr Tyr Pro

20 25 30

Ser Gly His Lys Cys Cys Arg Glu Cys Gln Pro Gly His Gly Met Val

35 40 45

Ser Arg Cys Asp His Thr Arg Asp Thr Val Cys His Pro Cys Glu Pro

50 55 60

Gly Phe Tyr Asn Glu Ala Val Asn Tyr Asp Thr Cys Lys Gln Cys Thr

65 70 75 80

Gln Cys Asn His Arg Ser Gly Ser Glu Leu Lys Gln Asn Cys Thr Pro

85 90 95

Thr Glu Asp Thr Val Cys Gln Cys Arg Pro Gly Thr Gln Pro Arg Gln

100 105 110

Asp Ser Ser His Lys Leu Gly Val Asp Cys Val Pro Cys Pro Pro Gly

115 120 125

His Phe Ser Pro Gly Ser Asn Gln Ala Cys Lys Pro Trp Thr Asn Cys

130 135 140

Thr Leu Ser Gly Lys Gln Ile Arg His Pro Ala Ser Asn Ser Leu Asp

145 150 155 160

Thr Val Cys Glu Asp Arg Ser Leu Leu Ala Thr Leu Leu Trp Glu Thr

165 170 175

Gln Arg Thr Thr Phe Arg Pro Thr Thr Val Pro Ser Thr Thr Val Trp

180 185 190

Pro Arg Thr Ser Gln Leu Pro Ser Thr Pro Thr Leu Val

195 200 205

139

191

Homo sapiens

139

Met Gly Asn Asn Cys Tyr Asn Val Val Val Ile Val Leu Leu Leu Val

1 5 10 15

Gly Cys Glu Lys Val Gly Ala Val Gln Asn Ser Cys Asp Asn Cys Gln

20 25 30

Pro Gly Thr Phe Cys Arg Lys Tyr Asn Pro Val Cys Lys Ser Cys Pro

35 40 45

Pro Ser Thr Phe Ser Ser Ile Gly Gly Gln Pro Asn Cys Asn Ile Cys

50 55 60

Arg Val Cys Ala Gly Tyr Phe Arg Phe Lys Lys Phe Cys Ser Ser Thr

65 70 75 80

His Asn Ala Glu Cys Glu Cys Ile Glu Gly Phe His Cys Leu Gly Pro

85 90 95

Gln Cys Thr Arg Cys Glu Lys Asp Cys Arg Pro Gly Gln Glu Leu Thr

100 105 110

Lys Gln Gly Cys Lys Thr Cys Ser Leu Gly Thr Phe Asn Asp Gln Asn

115 120 125

Gly Thr Gly Val Cys Arg Pro Trp Thr Asn Cys Ser Leu Asp Gly Arg

130 135 140

Ser Val Leu Lys Thr Gly Thr Thr Glu Lys Asp Val Val Cys Gly Pro

145 150 155 160

Pro Val Val Ser Phe Ser Pro Ser Thr Thr Ile Ser Val Thr Pro Glu

165 170 175

Gly Gly Pro Gly Gly His Ser Leu Gln Val Leu Thr Leu Phe Leu

180 185 190

140

54

Artificial Sequence

Synthetic Oligonucleotide

140

tatggatgaa gaaacttctc atcagctgct gtgtgataaa tgtccgccgg gtac 54

141

364

Homo sapiens

141

Glu Thr Leu Pro Pro Lys Tyr Leu His Tyr Asp Pro Glu Thr Gly His

1 5 10 15

Gln Leu Leu Cys Asp Lys Cys Ala Pro Gly Thr Tyr Leu Lys Gln His

20 25 30

Cys Thr Val Arg Arg Lys Thr Leu Cys Val Pro Cys Pro Asp His Ser

35 40 45

Tyr Thr Asp Ser Trp His Thr Ser Asp Glu Cys Val Tyr Cys Ser Pro

50 55 60

Asn Arg Val Cys Glu Cys Glu Glu Gly Arg Tyr Leu Glu Ile Glu Phe

65 70 75 80

Cys Leu Lys His Arg Ser Cys Pro Pro Gly Ser Gly Val Val Gln Ala

85 90 95

Gly Thr Pro Glu Arg Asn Thr Val Cys Lys Lys Cys Pro Asp Gly Phe

100 105 110

Phe Ser Gly Glu Thr Ser Ser Lys Ala Pro Cys Ile Lys His Thr Asn

115 120 125

Cys Ser Thr Phe Gly Leu Leu Leu Ile Gln Lys Gly Asn Ala Thr His

130 135 140

Asp Asn Val Cys Ser Gly Asn Arg Glu Ala Thr Gln Lys Cys Gly Ile

145 150 155 160

Asp Val Thr Leu Cys Glu Glu Ala Phe Phe Arg Phe Ala Val Pro Thr

165 170 175

Lys Ile Ile Pro Asn Trp Leu Ser Val Leu Val Asp Ser Leu Pro Gly

180 185 190

Thr Lys Val Asn Ala Glu Ser Val Glu Arg Ile Lys Arg Arg His Ser

195 200 205

Ser Gln Glu Gln Thr Phe Gln Leu Leu Lys Leu Trp Lys His Gln Asn

210 215 220

Arg Asp Gln Glu Met Val Lys Lys Ile Ile Gln Asp Ile Asp Leu Cys

225 230 235 240

Glu Ser Ser Val Gln Arg His Leu Gly His Ser Asn Leu Thr Thr Glu

245 250 255

Gln Leu Leu Ala Leu Met Glu Ser Leu Pro Gly Lys Lys Ile Ser Pro

260 265 270

Glu Glu Ile Glu Arg Thr Arg Lys Thr Cys Lys Ser Ser Glu Gln Leu

275 280 285

Leu Lys Leu Leu Ser Leu Trp Arg Ile Lys Asn Gly Asp Gln Asp Thr

290 295 300

Leu Lys Gly Leu Met Tyr Ala Leu Lys His Leu Lys Thr Ser His Phe

305 310 315 320

Pro Lys Thr Val Thr His Ser Leu Arg Lys Thr Met Arg Phe Leu His

325 330 335

Ser Phe Thr Met Tyr Arg Leu Tyr Gln Lys Leu Phe Leu Glu Met Ile

340 345 350

Gly Asn Gln Val Gln Ser Val Lys Ile Ser Cys Leu

355 360

142

364

Mus musculus

142

Glu Thr Phe Pro Pro Lys Tyr Leu His Tyr Asp Glu Glu Thr Ser His

1 5 10 15

Gln Leu Leu Cys Asp Lys Cys Pro Pro Gly Thr Tyr Leu Lys Gln His

20 25 30

Cys Thr Ala Lys Trp Lys Thr Val Cys Ala Pro Cys Pro Asp His Tyr

35 40 45

Tyr Thr Asp Ser Trp His Thr Ser Asp Glu Cys Leu Tyr Cys Ser Pro

50 55 60

Val Cys Lys Glu Leu Gln Tyr Val Lys Gln Glu Cys Asn Arg Thr His

65 70 75 80

Asn Arg Val Cys Glu Cys Lys Glu Gly Arg Tyr Leu Glu Ile Glu Phe

85 90 95

Cys Leu Lys His Arg Ser Cys Pro Pro Gly Phe Gly Val Val Gln Ala

100 105 110

Gly Thr Pro Glu Arg Asn Thr Val Cys Lys Arg Cys Pro Asp Gly Phe

115 120 125

Phe Ser Asn Glu Thr Ser Ser Lys Ala Pro Cys Arg Lys His Thr Asn

130 135 140

Asp Asn Ile Cys Ser Gly Asn Ser Glu Ser Thr Gln Lys Cys Gly Ile

145 150 155 160

Asp Val Thr Leu Cys Glu Glu Ala Phe Phe Arg Phe Ala Val Pro Thr

165 170 175

Lys Phe Thr Pro Asn Trp Leu Ser Val Leu Val Asp Asn Leu Pro Gly

180 185 190

Thr Lys Val Asn Ala Glu Ser Val Glu Arg Ile Lys Arg Gln His Ser

195 200 205

Ser Gln Glu Gln Thr Phe Gln Leu Leu Lys Leu Trp Lys His Gln Asn

210 215 220

Lys Ala Gln Asp Ile Val Lys Lys Ile Ile Gln Asp Ile Asp Leu Cys

225 230 235 240

Glu Asn Ser Val Gln Arg His Ile Gly His Ala Asn Leu Thr Phe Glu

245 250 255

Gln Leu Arg Ser Leu Met Glu Ser Leu Pro Gly Lys Lys Val Gly Ala

260 265 270

Glu Asp Ile Glu Lys Thr Ile Lys Ala Cys Lys Pro Ser Asp Gln Ile

275 280 285

Leu Lys Leu Leu Ser Leu Trp Arg Ile Lys Asn Gly Asp Gln Asp Thr

290 295 300

Leu Lys Gly Leu Met His Ala Leu Lys His Ser Lys Thr Tyr His Phe

305 310 315 320

Pro Lys Thr Val Thr Gln Ser Leu Lys Lys Thr Ile Arg Phe Leu His

325 330 335

Ser Phe Thr Met Tyr Lys Leu Tyr Gln Lys Leu Phe Leu Glu Met Ile

340 345 350

Gly Asn Gln Val Gln Ser Val Lys Ile Ser Cys Leu

355 360

143

47

Rattus rattus

143

Tyr Leu His Tyr Asp Pro Glu Thr Gly Arg Gln Leu Leu Cys Asp Lys

1 5 10 15

Cys Ala Pro Gly Thr Tyr Leu Lys Gln His Cys Thr Val Arg Arg Lys

20 25 30

Thr Leu Cys Val Pro Cys Pro Asp Tyr Ser Tyr Thr Asp Ser Trp

35 40 45

144

51

Artificial Sequence

Synthetic Oligonucleotide

144

Tyr His Tyr Tyr Asp Gln Asn Gly Arg Met Cys Glu Glu Cys His Met

1 5 10 15

Cys Gln Pro Gly His Phe Leu Val Lys His Cys Lys Gln Pro Lys Arg

20 25 30

Asp Thr Val Cys His Lys Pro Cys Glu Pro Gly Val Thr Tyr Thr Asp

35 40 45

Asp Trp His

50

145

16

Artificial Sequence

Synthetic Oligonucleotide

145

Met Lys His His His His His His His Ala Ser Asp Asp Asp Asp Lys

1 5 10 15